Human Molecular Genetics Advance Access originally published online on June 15, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Human Molecular Genetics, 2004, Vol. 13, No. 16 1815-1825
DOI: 10.1093/hmg/ddh186
Human Molecular Genetics, Vol. 13, No. 16 © Oxford University Press 2004; all rights reserved
Pms2 is a genetic enhancer of trinucleotide CAG·CTG repeat somatic mosaicism: implications for the mechanism of triplet repeat expansion
Institute of Biomedical and Life Sciences, University of Glasgow, Anderson College Complex, 56 Dumbarton Road, Glasgow G11 6NU, UK
Received May 10, 2004; Accepted June 4, 2004
| ABSTRACT |
|---|
|
|
|---|
The expansion of CAG·CTG repeat sequences is the cause of several inherited human disorders. Longer alleles are associated with an earlier age of onset and more severe symptoms, and are highly unstable in the germline and soma with a marked tendency towards repeat length gains. Germinal expansions underlie anticipation; whereas age-dependent, tissue-specific, expansion-biased somatic instability probably contributes toward the progressive nature and tissue-specificity of the symptoms. The mechanism(s) of repeat instability is not known, but recent data have implicated mismatch-repair (MMR) gene mutS homologues in driving expansion. To gain further insight into the expansion mechanism, we have determined the levels of somatic mosaicism of a transgenic expanded CAG·CTG repeat in mice deficient for the Pms2 MMR gene. Pms2 is a MutL homologue that plays a critical role in the downstream processing of DNA mismatches. The rate of somatic expansion was reduced by
50% in Pms2-null mice. A higher frequency of rare, but very large, deletions was also detected in these animals. No significant differences were observed between Pms2+/+ and Pms2+/ mice, indicating that a single functional Pms2 allele is sufficient to generate normal levels of somatic mosaicism. These findings reveal that as well as MMR enzymes that directly bind mismatched DNA, proteins that are subsequently recruited to the complex also play a central role in the accumulation of repeat length changes. These data suggest that somatic expansion results not by replication slippage, single stranded annealing or simple MutS-mediated stabilization of secondary structures, but by inappropriate DNA MMR. | INTRODUCTION |
|---|
|
|
|---|
The expansion of unstable simple repeat sequences within the human genome has been identified as the genetic basis of a number of complex disorders including myotonic dystrophy (DM), Huntington disease (HD), Friedreich ataxia, fragile-X syndrome and several of the spinocerebellar ataxias (1). Most of these diseases are associated with trinucleotide CAG·CTG repeat expansions. Such trinucleotide repeat sequences are usually polymorphic within the general population and are relatively stable when transmitted from parent to child. However, once into the expanded disease-associated range, the repeats become dramatically unstable in both the germline and soma (1). Mutations are strongly biased toward further expansion with longer alleles associated with a more severe phenotype and an earlier age of onset. Expansion-biased germline instability therefore provides the molecular basis for the phenomenon of anticipationthe decreasing age of onset and increased severity of clinical symptoms observed in successive generations of an affected family. Somatic instability of trinucleotide repeats involves a dynamic process in which the repeat size increases slowly with age, at diverse rates in different tissues, in a process that appears to be mediated by multiple small length gains (24). Interestingly, for some disorders at least, there is a correlation between the tissue specificity of somatic expansion and the affected tissue. Most notably, very large somatic expansions are observed in the skeletal muscle of DM type 1 patients (57) and in the affected brain regions of HD patients (8). Age-dependent, expansion-biased, tissue-specific somatic instability may therefore account for the progressive nature of the symptoms and the variable tissue-specific pathogenesis associated with the different disorders.
Understanding the molecular mechanisms that drive trinucleotide repeat expansion in the soma is therefore of great interest as it might be intimately associated with disease development and progression. The most favoured mechanism of triplet repeat mutation, the DNA polymerase slippage model, predicts that repeat size variability arises during DNA replication in a cell division-dependent manner (9). DNA polymerase stalling and slippage might be facilitated by the propensity of trinucleotide repeat sequences to fold into alternative non-B-DNA structures such as hairpins (10) and slipped-stranded DNA (S-DNA) (11). Slipped-stranded intermediate DNA species (SI-DNA) formed during DNA replication slippage (12) should be repaired by the DNA mismatch-repair (MMR) pathway, thus preventing expansions and deletions during replication. However, at large expanded repeat tracts they may occur so frequently that they overwhelm the capacity of the system. Non-repaired SI-intermediates may then give rise to repeat length changes following some other repair event or a second round of replication. As a result, mutation rates would be expected to increase with MMR gene mutations and higher cell division rates. Support for such a model is provided by the observation of elevated genetic instability at short simple DNA repeat sequences in hereditary non-polyposis colorectal cancer (HNPCC) tumours that are defective for MMR (13).
MMR has been reported to have at least two effects on the stability of long expanded CAG·CTG repeat arrays cloned into Escherichia coli. Although mutations in MMR genes reduce the frequency of large contractions in very long repeat tracts, smaller length change mutations are elevated as in HNPCC (1417). In Saccharomyces cerevisiae, more frequent small expansions and deletions are observed in MMR deficient strains, but the frequency of large contractions is not affected (18). Although the analysis of trinucleotide repeat dynamics in microbial models has thus provided support for the replication slippage model, relatively little is understood about the molecular pathways that control triplet repeat instability in complex mammalian cells.
Mouse models have been used to investigate the dynamic nature of triplet repeat sequences, providing an accurate model of the age-dependent, expansion-biased, tissue-specific somatic instability observed in man (1924). Monitoring of somatic mosaicism in tissues collected from these mice has revealed the lack of an obvious correlation between levels of trinucleotide instability and the rates of cell turnover, with high levels of somatic mosaicism being observed in post-mitotic tissues such as brain and muscle (19,20,22,25). Moreover, the levels of trinucleotide repeat instability in homogeneous mouse cell lines do not correlate with cell division rates in vitro (26). Considered together, these observations have raised serious reservations about the relevance of the replication slippage model in mammalian cells, and suggest that the expansion mechanism is not entirely dependent on DNA replication.
In bacteria, post-replication MMR is mediated by three major proteins MutS, MutL and MutH (27). A MutS dimer recognizes the physical mismatch and recruits a MutL dimer, which in turn recruits MutH. MutH utilizes the methylation status of newly synthesized DNA to distinguish the template and daughter strands and to nick the daughter strand. The nick is then used to initiate excision of the incorrectly synthesized DNA allowing error-free resynthesis. In eukaryotes MMR is more complex. The current mammalian model implicates at least six MutS and MutL homologues (13) and a mechanism of strand discrimination that probably involves a direct physical link to the replication fork via PCNA (28). The major MutS homologue is MSH2, which can form a heterodimer with either MSH6, to form MutS
, or with MSH3, to form MutSß (13). MutS
is critical for the recognition of single base mismatches and MutSß for the recognition of small insertion/deletion loops, such as those found in SI-DNA. Recruitment of a second heterodimer consisting of MLH1 and either PMS2 (MutL
) or MLH3 (MutLß) is thought to be essential for subsequent excision and resynthesis, resulting in DNA repair. In contrast to the predictions resulting from the replication slippage model, murine MutS homologues Msh2 and Msh3 are required for the development of expansion-biased trinucleotide somatic instability in transgenic mouse models carrying expanded CAG·CTG repeat tracts (24,29,30). Interestingly, Msh6 activity suppresses the accumulation of repeat length variation, possibly by competing more effectively than Msh3 for Msh2 and thus limiting the amount of MutSß complex (24). These observations suggest a key role for MutS homologues in triplet repeat expansion in mammalian cells.
How MutS homologues Msh2 and Msh3 mediate expansions at CAG·CTG repeat loci has not yet been determined. It has been suggested that this occurs via a process that does not involve MMR, but instead relies on the stabilization and protection from repair of CAG·CTG hairpin structures (29,31). Consistent with this model, MSH2 has been shown to bind to both S-DNA and SI-DNA in vitro (12). However, in these experiments the absence of either MSH6 or MSH3, the two MSH2 partners in vivo, make the biological relevance of this observation unclear. MutS homologues are also involved in additional DNA repair pathways, and it has been suggested that expansion could be mediated via mechanisms such as single stranded annealing (SSA) repair of double-strand breaks (30), which are independent of MutL homologues (32). Currently unknown, but critical to gaining further insight into the mechanism, is the question of whether there is a requirement for MutL homologues in the triplet repeat expansion pathway. One of the three MutL homologues in mammals is PMS2. Mutations in PMS2 have been associated with dramatic microsatellite instability both in normal and tumour tissues of Turcot syndrome patients (33,34) and in tumour tissue of HNPCC patients (35). In order to gain a better understanding of the function of the Pms2 protein in the MMR pathway of higher eukaryotes, Pms2 knock-out mice have been generated by gene targeting procedures (36). Pms2-null homozygotes develop spontaneous lymphomas and sarcomas, whereas mice heterozygous for the Pms2 disruption develop normally, with no predisposition to tumour formation (36,37). As expected, spontaneous microsatellite mutation rates of di- and mono-nucleotide sequences are raised up to 100-fold in many tissues of Pms2 nullizygous mice, confirming a key role for Pms2 in the maintenance of genomic stability in multiple, if not all, cell lineages (36,38). In an attempt to clarify the role of MutL homologues as modifiers of trinucleotide repeat dynamics in mammalian cells, we have crossed Pms2-deficient mice (36) with mice carrying an expanded CTG·CAG repeat transgene (39), and have used sensitive small pool polymerase chain reaction (SP-PCR) detection methods (4) to investigate somatic mosaicism.
| RESULTS |
|---|
|
|
|---|
Pms2 deficiency reduces the rate of somatic expansion of a large CAG·CTG repeat tract
In order to assess the involvement of Pms2 in the metabolism of expanded trinucleotide repeats we crossed the previously described Pms2-null allele (36) into mice carrying the Dmt-D transgene, which shows high levels of tissue-specific, age-dependent, expansion-biased somatic mosaicism (19). Mice carrying a single copy of the Dmt-D transgene and all three genotypes at the Pms2 locus (+/+, +/ and /) were allowed to age so that somatic expansions might accumulate. Complete Pms2 deficiency is associated with a severe cancer predisposition phenotype (37) and in our colony Pms2/ mice rarely survived beyond 5 months of age and never beyond 8 months of age before developing tumours. Tissues from Pms2/ and age-matched littermate controls (Pms2+/+ and Pms2+/) were collected and analysed for somatic mosaicism using sensitive SP-PCR techniques (4). In order that we might detect both increases and/or decreases in the rate of expansion, four different tissues were selected to cover the range of trinucleotide repeat instability that presents in Dmt-D transgenic mice (19). Lung and heart were chosen to represent those tissues that show low levels of repeat instability and in which an increase in the rate of expansion might be distinguished readily. Kidney was selected as the tissue where the transgene exhibits the most dramatic repeat length changes, and hence the most appropriate target for detecting a decrease in the rate of expansion. Brain was also included, because it not only displays relatively high levels of repeat instability, but is also one of the most commonly affected tissues in the CAG·CTG expansion disorders. The degree of somatic mosaicism of the expanded CAG·CTG repeat Dmt-D transgene normally detectable in mice aged
5 months is relatively low. Nonetheless, our analyses revealed consistently lower rates of somatic expansion of the expanded CAG·CTG repeat Dmt-D transgene in the kidney (Fig. 1A) and brain in a Pms2/ genetic background. Because of the very low levels of mosaicism present in the lung and heart of young animals it was not possible to determine if loss of Pms2 similarly suppressed expansion in these tissues (data not shown). However, comparison of repeat length distributions in one 8-month-old Pms2/ animal and its Pms2+/ littermate did reveal similar suppression of expansions in lung and kidney (Fig. 1B), in addition to heart and brain (Fig. 2A and B, see later). Although the degree of somatic mosaicism in the Pms2/ mice was lower than in their littermate controls, it was nonetheless readily detectable and biased toward expansion. In order to quantify the degree of modification of expansion dynamics we used single molecule PCR to determine precise repeat length distributions in the lung and kidney from an 8-month-old Pms2/ mouse and a Pms2+/ littermate control (Fig. 1C). These data revealed that repeat length distributions in the two animals were highly statistically significantly different from each other for both lung (P=0.0007, two-tailed MannWhitney U-test) and kidney (P=0.0038, two-tailed MannWhitney U-test). The median expansion rates in Pms2+/ and Pms2/ mice were +0.029 and +0.010 repeats per day in lung, and +0.053 and +0.028 repeats per day in kidney, respectively. Thus, Pms2 deficiency results in an
50% reduction in the rate of somatic expansion.
|
|
Pms2 deficiency increases the frequency of rare large somatic deletions of a CAG·CTG repeat tract
Whilst investigating the effect of Pms2 on the rate of triplet repeat expansion, we noted an apparent increase in the frequency of large deletions observed in Pms2-deficient animals (Fig. 1A and B). Large deletions (>20 repeats) are relatively rare, but nonetheless appeared to occur more frequently in Pms2-deficient animals. Thus, we used SP-PCR analysis with up to 200 template molecules per reaction to quantify the frequency of large (>20 repeats) length change mutations in Pms2+/ and Pms2/ animals in the lung, kidney, heart and brain (Fig. 2). Analysis of
32005500 molecules from each tissue allowed us to quantify the frequency of large contractions and large expansions in the brain and heart samples. A higher frequency of large deletions was indeed observed in tissues from homozygous null Pms2 mice (Table 1 and Fig. 2). The frequency of large deletions was
1.53.5-fold higher in the kidney, lung and heart of the Pms2/ mouse, when compared with its Pms2+/ littermate (P<0.05, Fisher's exact test). Although the absolute frequency of large deletions detected in the brain DNA of the Pms2 nullizygous mouse was not significantly increased, the length changes observed were larger in this animal than in its littermate control (P=0.01, two-tailed MannWhitney U-test). Thus, in the absence of Pms2 protein, the frequency of large deletions (>20 repeats) was increased, although these events only occurred in a small subset of cells (
1/100). These analyses also confirmed that there was a lower frequency of large expansions (>30 repeats) in the heart and brain of Pms2/ animals (Fig. 2B and Table 1).
|
Pms2 heterozygosity has no detectable effect on rates of CAG·CTG repeat expansion
The results described earlier revealed that complete deficiency of Pms2 significantly suppressed the rate of somatic expansion. Nonetheless, expansions were still observed and the pattern of expansions was indistinguishable from that observed in mice fully proficient for Pms2 at a younger age. These data indicate that Pms2 is required to generate high levels of mosaicism, but it is not essential for expansion per se. The amount of Pms2 might therefore be a rate-limiting component of the expansion pathway, and reduced levels of Pms2 activity might mediate reduced rates of expansion. The analyses described above revealed no obvious differences in the rate of expansion between Pms2+/+ and Pms2+/ mice (Fig. 1A and C). However, these animals were relatively young when tested and had not accumulated high levels of somatic mosaicism. Therefore, by analysis of repeat length variation in older animals we sought to determine if Pms2 heterozygotes manifest a haploinsufficiency phenotype. Repeat length variability of the Dmt-D transgene was determined by SP-PCR in DNA samples collected from two 24-month-old mice, one with a Pms2+/ background and the other with a Pms2+/+ background. Although high levels of mosaicism were detected in all the tissues analysed (heart, lung, brain and kidney), no obvious qualitative differences in the expansion profiles were observed (Fig. 3A). To search for a more subtle effect, we performed a detailed quantitative analysis of the degree of repeat length variation in the lung and kidney using single molecule SP-PCR (Fig. 3B). The median rate of expansion in the lung cells was essentially indistinguishable (+0.024 and +0.021 repeats per day in Pms2+/+ and Pms2+/ mice, respectively, P=0.54, two-tailed MannWhitney U-test). Surprisingly though, these data revealed that the median rate of expansion was actually slightly higher in the kidney cells of the Pms2+/ mouse (+0.095 repeats per day) relative to the Pms2+/+ littermate control (0.077 repeats per day). However, these repeat length distributions were also not statistically significantly different from each other (P=0.85 two-tailed MannWhitney U-test). The slightly higher rate of expansion observed in the kidney of the Pms2+/ mouse was probably mediated by the longer Dmt-D allele it inherited (196 repeats versus 176 repeats in the Pms2+/+ animal). Thus, Pms2 heterozygosity appeared to have no effect on the rate of somatic expansion. In order to confirm this result, we examined the repeat length distributions in an additional two pairs of Pms2+/+ and Pms2+/ littermate controls from which tissues were harvested at 13 months of age (Fig. 3C). Once again, no detectable differences were observed between Pms2+/+ and Pms2+/ animals.
|
Given the substantial effects observed with Pms2 deficiency, we were surprised that we could not detect even a relatively subtle effect in the Pms2 heterozygotes. A possible explanation could be that although the Pms2 heterozygotes are 50% deficient at the gene level, feedback mechanisms may operate to increase transcription levels and/or mRNA/protein stability resulting in equivalent steady-state levels of Pms2 protein in both Pms2+/+ and Pms2+/ animals. To test this idea we determined Pms2 protein levels in Pms2+/+, Pms2+/ and Pms2/ cells. Western blot analysis of whole cell protein lysates, collected from cultured mouse embryonic fibroblasts, was performed (Fig. 4A) and Pms2 protein levels were quantified relative to ß-tubulin. As expected, the analysis revealed that whereas nullizygous mice lack Pms2, mice heterozygous for the Pms2 deletion showed a
50% reduction in the protein levels, relative to mice carrying two functional Pms2 alleles (P=0.001, t-test) (Fig. 4B). Thus, a 50% reduction in the steady-state protein levels in Pms2+/ mice does not lead to a detectable difference in the expansion rate relative to Pms2 wild-type mice. Indeed, these results once again highlight the remarkably deterministic nature of the expansion pathway in vivo.
|
| DISCUSSION |
|---|
|
|
|---|
Age-dependent, tissue-specific, expansion-biased somatic mosaicism is an integral part of the unusual genetic phenomena that characterize human disorders associated with the expansion of simple sequence repeats. In addition to posing a fascinating scientific question, somatic mosaicism also very likely contributes toward the tissue-specificity and progressive nature of the symptoms. As such, a thorough understanding of the molecular mechanisms that generate instability is of interest, not only in terms of the insights it may provide into basic biological processes, but also because it may have direct clinical relevance. Recently, the use of transgenic mouse models to understand the processes involved have started to yield important new insights. Most notably, several studies have revealed a critical role for the MMR MutS homologues Msh2 and Msh3, both of which are absolutely required to generate expansions (24,2931). We have shown here for the first time that a MutL homologue, Pms2, is similarly required to generate normal levels of expansion. In contrast to the essential role of Msh2 and Msh3 in the expansion pathway, Pms2 does not appear to be absolutely required. Expansions still accrue in Pms2-deficient mice and the overall pattern of expansion is not changed. Rather the absolute rate of expansion is reduced by
50%. These data suggest that Pms2 is, at least partially, redundant to some other protein activity in the expansion pathway. The predominant MutL homologue Mlh1 can partner either Pms2 to form MutL
, or Mlh3 to form MutLß, and both the complexes are able to mediate the MMR of insertion/deletion loops (13), the most likely intermediates in the expansion pathway. Thus, it is very likely that Pms2 is at least partially redundant to Mlh3 in generating expansions. The involvement of a MutL homologue in the expansion pathway has important consequences for understanding the molecular mechanisms involved. First, in contrast to predictions made using the replication slippage model, loss of function of the Pms2 protein does not result in an increase in the rate of expansion. In bacteria, mutS and mutL mutations cause an overall increase in the frequency of small length changes within trinucleotide repeat tracts (1618). Similarly, increased instability of short CAG·CTG repeats at both the DM1 and SBMA loci has been described in tumour samples from HNPCC families with MMR gene mutations (40). It remains possible that there is an increased frequency in the rate of non-repaired replication slippage errors in the Dmt-D repeat tract in Pms2-deficient mice. However, it is clear that non-repaired replication slippage errors do not contribute significantly to the expansions that accrue, as the rate of expansion in Pms2-deficient mice, in which the frequency of non-repaired replication slippage errors should be much higher, is actually considerably lower. Second, the involvement of a MutL homologue in the expansion pathway argues against additional models that invoke the MutS homologues alone. For instance, it has been hypothesized that stabilization of alternative secondary structures formed within repeat tracts by Msh2 (and presumably likewise by Msh3 and/or MutSß) could lead to expansion following DNA-repair synthesis (29,31). However, following DNA gap repair, loops and slipped-stranded-like structures would be trapped in a heteroduplex DNA molecule (31), and a second round of DNA replication and cell division would be required to complete the mutation process. Somatic mutations continue to accumulate in post-mitotic cells [as supported by the high levels of instability observed in adult mouse brains and other predominantly post-mitotic tissues (1922)]. Therefore, attractive as it is, such a mechanism could only account for somatic trinucleotide repeat mutations in proliferating tissues, and is unlikely to contribute to the continuous expansion of trinucleotide repeat sequences in post-mitotic cells. Similarly, mechanisms based on the SSA pathway for the repair of double-strand breaks (30), appear to be excluded as they are not dependent on MutL homologues (32). Thus, in contrast to previously proposed models (2931), the involvement of a MutL homologue in somatic expansion implies that it is a full MMR reaction that is required to generate expansions.
Thus, the emerging evidence indicates that somatic mosaicism arises via multiple small events, biased toward expansion, that accrue in a cell division independent mechanism requiring both MutS and MutL components of the MMR pathway. None of the previously proposed models can account for these observations. We therefore suggest an alternative model based on inappropriate DNA MMR (Fig. 5A). Briefly, we propose that the repeats are usually replicated faithfully in the form of standard duplex B-DNA (Fig. 5A-a), but that at some point during either the G0 or G1 stage of the cell cycle the duplex is melted (Fig. 5A-b). The repeat sequences then re-anneal out of register forming S-DNA structures where the predominant species are small mismatched loopouts of 13 repeat units (Fig. 5A-c). Subsequently, these small loopouts are recognized by the MutSß complex (Msh2 and Msh3) and recruit either the MutL
or MutLß complex (Fig. 5A-d) as part of an MMR reaction in which the loopouts are incorporated (Fig. 5A-e) and give rise to expansions (Fig. 5A-f). The expansion process could be reinitiated by the formation of new S-DNA structures allowing multiple mutations to accumulate in non-dividing cells. In this way cells could accumulate very large expansions as a result of frequent small gains.
|
This proposed mechanism makes several assumptions and testable predictions. First, the repeats adopt S-DNA structures. Although such structures have not yet been reported in vivo, these conformations form readily in vitro and are very stable (11). Their formation in vivo might be mediated by transcription or DNA breathing. The absence of a correlation between expression levels and somatic instability of a DM transgene argue against a direct role for transcription in mediating repeat length changes (25). Spontaneous DNA breathing of a linear DNA molecule at physiological temperatures would be unlikely to result in the production of a large enough melting domain to facilitate S-DNA formation. However, negative supercoiling can dramatically lower the melting threshold and facilitate large-scale opening of the duplex (41). Negative superhelical torsion can be generated by chromatin remodelling (42) and this presents a possible mechanism whereby S-DNA formation might be mediated in non-dividing cells. Second, the loopouts are recognized and repaired by the MutSß heterodimer (Msh2 and Msh3) complexed with MutL
or MutLß. This predicts that Mlh1 will be essential for expansion and that Mlh3 will be partially redundant to Pms2 in mediating expansions. The small loopouts of 13 repeat units (39 nt) hypothesized are commonly observed in S-DNA formed in vitro (43) and are within the range that can be processed by the MutSß complex (44). In the absence of a functional MMR pathway S-DNA structures may remain quiescent within the cell or even accumulate, consistent with the stabilization reported here and observed in Msh2- and Msh3-null animals (24,29). In theory, larger loopouts capable of forming intrastrand hairpins could also form. However, such large loopouts would be predicted to be resistant to processing by the MMR machinery and would result in larger length changes than are usually observed. Third, individual loopouts on opposite strands are repaired as separate events. If the excision domain (Fig. 5A-e) for one loopout incorporated the loopout on the opposite strand, then the net length change would be zero. The size of the excision domain in mammalian cells is not known. However, in vitro experiments using human nuclear extracts and nick-directed reconstitution of a MMR have revealed that the exonuclease typically removes an additional 60-230 bp DNA beyond the mismatch (45), thus defining the minimum size of the excision domain. Normal length alleles, although capable of forming S-DNA structures (11), would therefore be unlikely to repair opposing loops as separate events and would thus not be liable to expand via this mechanism. Moreover, longer expanded alleles are even more likely to form S-DNA structures with more distantly separated opposing loops and would be expected to show increased levels of instability. Thus, this model is consistent with both the size threshold observed for instability (3050 repeats) and the higher expansion rates of longer alleles. Fourth, the model assumes a bias toward incorporating the loopout in the repair reaction as opposed to deleting it. Given that this MMR reaction is not linked to S-phase replication, there are no strand discrimination signals. How MMR proceeds in the absence of a strand signal is currently unknown. However, it seems not unreasonable to assume that faced with the stark choice of incorporating the loopout or deleting it, the system may be biased toward incorporating potentially important DNA. Nonetheless, the bias may be relatively subtle, because even if small deletions are frequent, slightly more frequent expansions will eventually result in all cells acquiring expansions. This is consistent with the relatively frequent small deletions present in vivo in young mice that are lost in older animals (19). Fifth, the model predicts the involvement of other MMR-associated activities, including an, as yet unidentified, endonuclease activity, an exonuclease [possibly exonuclease I (46) and/or polymerase
/
(47)], a DNA polymerase [most likely DNA polymerase
(48)] and a DNA ligase. Sixth, the model predicts that repeats could continue to expand in non-dividing cells. Although there is considerable circumstantial in vivo evidence that this occurs (8,19,22,25), and no direct association with cell division rates and cell turnover in vitro (26), it has not yet been definitively demonstrated that the repeats do continue to expand in non-diving cells. Of course, there is no reason why this mechanism could not also operate in dividing cells. Because male Pms2-deficient mice are infertile (36), we have not determined the role of Pms2 in mediating germline expansions. However, given that Msh2 mediates expansions in both the soma and spermatogonia in a comparable manner (30,49), it is probable that Pms2 is similarly involved in the germline expansion pathway.
In addition to decreasing the rate of expansion, Pms2 deficiency also increases the frequency of large, albeit rare, deletions. In contrast to the multiple small mutations that give rise to the predominant expansions, these large deletions appear to be mediated via a single rare event. Such large deletions might be mediated by the accumulation of multiple non-repaired small loopouts to form large MMR-refractory hairpins processed via an alternative pathway that results in large deletions (Fig. 5B). An MMR independent activity resulting in the deletion of large DNA loops in human cells has been described recently (50).
Given the significant role we have revealed for Pms2 in the expansion pathway and the observations that Pms2 levels appear to be rate limiting, we were slightly surprised that were unable to detect a haploinsufficiency phenotype for repeat expansion in Pms2+/ mice. This result was particularly surprising as we were able to demonstrate that levels of Pms2 protein were indeed reduced in Pms2 heterozygous animals. A possible explanation for this result is that the amount of Mlh1 in normal cells is rate limiting with regard to the formation of MutLß complexes. With 50% lower levels of Pms2 in the cell, more Mlh1 would be available to form active MutLß complexes, thus compensating for the decreased amount of MutL
in loopout repair. Such an effect would be analogous to the situation proposed regarding the relative amounts of MutS
and MutSß in normal cells and those deficient for Msh6 (24,44,51). However, it would also be necessary to postulate that the absolute amount of Mlh3 is also rate limiting and the increased MutLß activity is unable to fully compensate for Pms2 deficiency, accounting for the observed decrease in expansion rate in Pms2-null cells.
In summary, we have established that the Pms2 gene is a major component of the expansion pathway. Pms2 is thus an excellent candidate modifier gene for both the expansion pathway and consequently of disease severity in patients, and may also be a target for therapeutic intervention in the repeat expansion disorders.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Mouse breeding and genotyping
The Pms2-null allele generated by Baker et al. (36) was obtained on a mixed 129Sv/C57Bl6 background. It was backcrossed onto an FVB/N background for five generations and subsequently crossed with Dmt-D transgenic mice (39) also maintained on a FVB/N background. Genotyping for Pms2 and Dmt-D was performed as previously described (36,39). All mice analysed were hemizygous for the Dmt-D transgene and the progenitor allele length inherited by each mouse was determined by the analyses of tail DNA collected at weaning.
SP-PCR analysis
DNA purification, SP-PCR amplifications and PCR product electrophoretic analyses were performed as described previously (26). SP-PCR was performed using oligonucleotide primers DM-C and DM-BR (4), or DM-C and mDmtD-GR (5'AAAGGCAGGCATGGTTAGATTGAC3').
Establishment of cultured mouse embryonic fibroblasts
Primary mouse embryonic fibroblast cultures were isolated from 14-day-old Dmt-D positive mouse embryos. Briefly, the head and the liver were removed from each embryo and the remainder digested with 3 ml of pre-warmed trypsinEDTA solution for 10 min in a humidified 5% CO2 incubator at 37°C. To disassociate the cells the embryo bodies were transferred into a 5 ml syringe and passed through an 18-gauge needle into a 25 cm2 tissue culture flask. The digestion was continued for 2030 min and then stopped by the addition of 20 ml of pre-warmed culture medium The contents of the flask were transferred into a 50 ml conical tube and large pieces of tissue allowed to settle for 2 min. The dissociated cell-containing supernatant was transferred to a clean tube and the cells collected by centrifugation at 200g for 5 min. Dissociated cells were resuspended in 5 ml of fresh medium and plated on a 25 cm2 tissue culture flask and transferred to an incubator at 37°C with 5% CO2. The remaining large pieces of tissue were further digested by adding 5 ml of fresh trypsinEDTA and continuing the incubation for an additional 2030 min. Dissociated cells from the secondary digest were collected as described and plated together with previously dissociated cells. Adherent mouse embryonic fibroblasts thus derived were maintained in culture using standard cell culture techniques and DMEM medium supplemented with 10% (v/v) fetal calf serum, non-essential amino acids, 0.1 mM ß-mercaptoethanol, 100 U ml1 penicillin and 100 µg ml1 streptomycin.
Protein sample preparation and western blotting
Protein was extracted from cultured mouse embryonic fibroblasts using EBC lysis buffer [50 mM TrisHCl, 120 mM NaCl, 0.5% (v/v) NP-40] containing protease inhibitors (protease inhibitor cocktail for mammalian tissues, Sigma, cat. no. P8340). Aliquots of 100 µg of whole cell protein lysate were resolved by electrophoresis through a NuPAGE 412% BisTris Gel (Invitrogen, cat. no. NP0321) and electroblotted onto Millipore Immobilon-P membranes (Millipore, cat. no. IPVH00010) at 30 V for 2 h in an XCellII Blot Module (Novex, cat. no. EI9051) in NuPAGE Transfer Buffer (Invitrogen, cat. no. NP0006-1). The membranes were blocked for two hours at room temperature in 5% (w/v) dried milk in TBST (20 mM TrisHCl pH 7.6, 137 mM NaCl, 0.06% (v/v) Tween-20), then incubated overnight at 4°C in primary antibody. The membranes were washed four times for 15 min each in TBST, incubated for 1 h in secondary antibody at room temperature, and washed three times for 15 min each in TBST at room temperature. Antibody binding was visualized using SuperSignal West Pico Chemiluminescent Substrate (Pierce, cat. no. 34080). Pms2 was detected using 1 µg ml1 mouse anti-Pms2 monoclonal antibody (BD PharMingen, cat. no. 556415) and 8 ng ml1 goat anti-mouse IgG HRP-conjugated antibody (Jackson Laboratories, cat. no. 115-035-003) diluted 1:50 000. ß-Tubulin was detected using a 0.5 µg ml1 rabbit anti-ß-tubulin polyclonal antibody (Santa Cruz Biotechnology, cat. no. sc9104) and 16 ng ml1 goat anti-rabbit IgG HRP-conjugated antibody (Santa Cruz Biotechnology, cat. no. sc-2004). Densitometric analysis of protein levels was performed using Kodak Digital Science 1D software using exposures in the linear range of signal intensity.
| ACKNOWLEDGEMENTS |
|---|
We would like to thank Michael Liskay and Sean Baker for providing the Pms2-deficient mice. We are also very grateful to Peggy F. Shelbourne and the Dynamic Mutation Group at the University of Glasgow for helpful discussion during the course of this work, and to the Biological Services for excellent animal care and assistance with colony maintenance. We would also like to acknowledge the Lister Institute (UK), Muscular Dystrophy Association (USA), the Medical Research Council (UK) and the Association Française Contre Les Myopathies (France) for financial support. M.G.P. was supported by awards from the Fundação para a Ciência e Tecnologia and Fundação Calouste Gulbenkian (Portugal).
| FOOTNOTES |
|---|
* To whom correspondence should be addressed. Tel: +44 1413306213; Fax: +44 1413306871; Email: d.monckton{at}bio.gla.ac.uk
| REFERENCES |
|---|
|
|
|---|
-
Richards, R.I. (2001) Dynamic mutations: a decade of unstable expanded repeats in human genetic disease. Hum. Mol. Genet., 10, 21872194.
[Abstract/Free Full Text] - Wong, L.-J.C., Ashizawa, T., Monckton, D.G., Caskey, C.T. and Richards, C.S. (1995) Somatic heterogeneity of the CTG repeat in myotonic dystrophy is age and size dependent. Am. J. Hum. Genet., 56, 114122.[Web of Science][Medline]
-
Martorell, L., Monckton, D.G., Gamez, J., Johnson, K.J., Gich, I., Lopez de Munain, A. and Baiget, M. (1998) Progression of somatic CTG repeat length heterogeneity in the blood cells of myotonic dystrophy patients. Hum. Mol. Genet., 7, 307312.
[Abstract/Free Full Text] - Monckton, D.G., Wong, L.-J.C., Ashizawa, T. and Caskey, C.T. (1995) Somatic mosaicism, germline expansions, germline reversions and intergenerational reductions in myotonic dystrophy males: small pool PCR analyses. Hum. Mol. Genet., 4, 18.[Medline]
-
Anvret, M., Ahlberg, G., Grandell, U., Hedberg, B., Johnson, K. and Edstrom, L. (1993) Larger expansions of the CTG repeat in muscle compared to lymphocytes from patients with myotonic dystrophy. Hum. Mol. Genet., 2, 13971400.
[Abstract/Free Full Text] -
Ashizawa, T., Dubel, J.R. and Harati, Y. (1993) Somatic instability of CTG repeat in myotonic dystrophy. Neurology, 43, 26742678.
[Abstract/Free Full Text] - Thornton, C.A., Johnson, K.J. and Moxley, R.T. (1994) Myotonic dystrophy patients have larger CTG expansions in skeletal muscle than in leukocytes. Ann. Neurol., 35, 104107.[CrossRef][Web of Science][Medline]
-
Kennedy, L., Evans, E., Chen, C.M., Craven, L., Detloff, P.J., Ennis, M. and Shelbourne, P.F. (2003) Dramatic tissue-specific mutation length increases are an early molecular event in Huntington disease pathogenesis. Hum. Mol. Genet., 12, 33593367.
[Abstract/Free Full Text] - Richards, R.I. and Sutherland, G.R. (1994) Simple DNA is not replicated simply. Nat. Genet., 6, 114116.[CrossRef][Web of Science][Medline]
- Gacy, A.M., Goellner, G., Juranic, N., Macura, S. and McMurray, C.T. (1995) Trinucleotide repeats that expand in human disease form hairpin structures in vitro. Cell, 81, 533540.[CrossRef][Web of Science][Medline]
- Pearson, C.E. and Sinden, R.R. (1996) Alternative structures in duplex DNA formed within the trinucleotide repeats of the myotonic dystrophy and fragile X loci. Biochemistry, 35, 50415053.[CrossRef][Medline]
-
Pearson, C.E., Ewel, A., Acharya, S., Fishel, R.A. and Sinden, R.R. (1997) Human MSH2 binds to trinucleotide repeat DNA structures associated with neurodegenerative diseases. Hum. Mol. Genet., 6, 11171123.
[Abstract/Free Full Text] -
Peltomaki, P. (2001) Deficient DNA mismatch repair: a common etiologic factor for colon cancer. Hum. Mol. Genet., 10, 735740.
[Abstract/Free Full Text] -
Jaworski, A., Rosche, W.A., Gellibolian, R., Kang, S.M., Shimizu, M., Bowater, R.P., Sinden, R.R. and Wells, R.D. (1995) Mismatch repair in Escherichia coli enhances instability of (CTG)(n) triplet repeats from human hereditary diseases. Proc. Natl Acad. Sci. USA, 92, 1101911023.
[Abstract/Free Full Text] - Schumacher, S., Fuchs, R.P. and Bichara, M. (1998) Expansion of CTG repeats from human disease genes is dependent upon replication mechanisms in Escherichia coli: the effect of long patch mismatch repair revisited. J. Mol. Biol., 279, 11011110.[CrossRef][Web of Science][Medline]
- Schmidt, K.H., Abbott, C.M. and Leach, D.R. (2000) Two opposing effects of mismatch repair on CTG repeat instability in Escherichia coli. Mol. Microbiol., 35, 463471.[CrossRef][Web of Science][Medline]
- Parniewski, P., Jaworski, A., Wells, R.D. and Bowater, R.P. (2000) Length of CTG·CAG repeats determines the influence of mismatch repair on genetic instability. J. Mol. Biol., 299, 865874.[CrossRef][Web of Science][Medline]
-
Schweitzer, J.K. and Livingston, D.M. (1997) Destabilization of CAG trinucleotide repeat tracts by mismatch repair mutations in yeast. Hum. Mol. Genet., 6, 349355.
[Abstract/Free Full Text] -
Fortune, M.T., Vassilopoulos, C., Coolbaugh, M.I., Siciliano, M.J. and Monckton, D.G. (2000) Dramatic, expansion-biased, age-dependent, tissue-specific somatic mosaicism in a transgenic mouse model of triplet repeat instability. Hum. Mol. Genet., 9, 439445.
[Abstract/Free Full Text] -
Seznec, H., Lia-Baldini, A.S., Duros, C., Fouquet, C., Lacroix, C., Hofmann-Radvanyi, H., Junien, C. and Gourdon, G. (2000) Transgenic mice carrying large human genomic sequences with expanded CTG repeat mimic closely the DM CTG repeat intergenerational and somatic instability. Hum. Mol. Genet., 9, 11851194.
[Abstract/Free Full Text] - Mangiarini, L., Sathasivam, K., Mahal, A., Mott, R., Seller, M. and Bates, G.P. (1997) Instability of highly expanded CAG repeats in mice transgenic for the Huntington's disease mutation. Nat. Genet., 15, 197200.[CrossRef][Web of Science][Medline]
-
Kennedy, L. and Shelbourne, P.F. (2000) Dramatic mutation instability in HD mouse striatum: does polyglutamine load contribute to cell-specific vulnerability in Huntington's disease? Hum. Mol. Genet., 9, 25392544.
[Abstract/Free Full Text] -
Lorenzetti, D., Watase, K., Xu, B., Matzuk, M.M., Orr, H.T. and Zoghbi, H.Y. (2000) Repeat instability and motor incoordination in mice with a targeted expanded CAG repeat in the Sca1 locus. Hum. Mol. Genet., 9, 779785.
[Abstract/Free Full Text] -
van Den Broek, W.J., Nelen, M.R., Wansink, D.G., Coerwinkel, M.M., te Riele, H., Groenen, P.J. and Wieringa, B. (2002) Somatic expansion behaviour of the (CTG)(n) repeat in myotonic dystrophy knock-in mice is differentially affected by Msh3 and Msh6 mismatch-repair proteins. Hum. Mol. Genet., 11, 191198.
[Abstract/Free Full Text] -
Lia, A.S., Seznec, H., Hofmann Radvanyi, H., Radvanyi, F., Duros, C., Saquet, C., Blanche, M., Junien, C. and Gourdon, G. (1998) Somatic instability of the CTG repeat in mice transgenic for the myotonic dystrophy region is age dependent but not correlated to the relative intertissue transcription levels and proliferative capacities. Hum. Mol. Genet., 7, 12851291.
[Abstract/Free Full Text] -
Gomes-Pereira, M., Fortune, M.T. and Monckton, D.G. (2001) Mouse tissue culture models of unstable triplet repeats: in vitro selection for larger alleles, mutational expansion bias and tissue specificity, but no association with cell division rates. Hum. Mol. Genet., 10, 845854.
[Abstract/Free Full Text] - Modrich, P. (1991) Mechanisms and biological effects of mismatch repair. Annu. Rev. Genet., 25, 229253.[CrossRef][Web of Science][Medline]
- Umar, A., Buermeyer, A.B., Simon, J.A., Thomas, D.C., Clark, A.B., Liskay, R.M. and Kunkel, T.A. (1996) Requirement for PCNA in DNA mismatch repair at a step preceding DNA resynthesis. Cell, 87, 6573.[CrossRef][Web of Science][Medline]
- Manley, K., Shirley, T.L., Flaherty, L. and Messer, A. (1999) Msh2 deficiency prevents in vivo somatic instability of the CAG repeat in Huntington disease transgenic mice. Nat. Genet., 23, 471473.[CrossRef][Web of Science][Medline]
- Savouret, C., Brisson, E., Essers, J., Kanaar, R., Pastink, A., te Riele, H., Junien, C. and Gourdon, G. (2003) CTG repeat instability and size variation timing in DNA repair-deficient mice. EMBO J., 22, 22642273.[CrossRef][Web of Science][Medline]
- Kovtun, I.V. and McMurray, C.T. (2001) Trinucleotide expansion in haploid germ cells by gap repair. Nat. Genet., 27, 407411.[CrossRef][Web of Science][Medline]
-
Sugawara, N., Paques, F., Colaiacovo, M. and Haber, J.E. (1997) Role of Saccharomyces cerevisiae Msh2 and Msh3 repair proteins in double-strand break-induced recombination. Proc. Natl Acad. Sci. USA, 94, 92143219.
[Abstract/Free Full Text] - De Rosa, M., Fasano, C., Panariello, L., Scarano, M.I., Belli, G., Iannelli, A., Ciciliano, F. and Izzo, P. (2000) Evidence for a recessive inheritance of Turcot's syndrome caused by compound heterozygous mutations within the PMS2 gene. Oncogene, 19, 17191723.[CrossRef][Web of Science][Medline]
- Miyaki, M., Nishio, J., Konishi, M., Kikuchi-Yanoshita, R., Tanaka, K., Muraoka, M., Nagato, M., Chong, J.M., Koike, M., Terada, T., et al. (1997) Drastic genetic instability of tumors and normal tissues in Turcot syndrome. Oncogene, 15, 28772881.[CrossRef][Web of Science][Medline]
- Nicolaides, N.C., Papadopoulos, N., Liu, B., Wei, Y.F., Carter, K.C., Ruben, S.M., Rosen, C.A., Haseltine, W.A., Fleischmann, R.D., Fraser, C.M. et al. (1994) Mutations of two PMS homologues in hereditary nonpolyposis colon cancer. Nature, 371, 7580.[CrossRef][Medline]
- Baker, S., Bronner, C.E., Zhang, L., Plug, A.W., Robatzek, M., Warren, G., Elliott, E.A., Yu, J., Ashley, T., Arnheim, N. et al. (1995) Male mice defective in the DNA mismatch repair gene PMS2 exhibit abnormal chromosome synapsis in meiosis. Cell, 82, 309319.[CrossRef][Web of Science][Medline]
- Prolla, T.A., Baker, S.M., Harris, A.C., Tsao, J.L., Yao, X., Bronner, C.E., Zheng, B., Gordon, M., Reneker, J., Arnheim, N. et al. (1998) Tumour susceptibility and spontaneous mutation in mice deficient in Mlh1, Pms1 and Pms2 DNA mismatch repair. Nat. Genet., 18, 276279.[CrossRef][Web of Science][Medline]
-
Narayanan, L., Fritzell, J.A., Baker, S.M., Liskay, R.M. and Glazer, P.M. (1997) Elevated levels of mutation in multiple tissues of mice deficient in the DNA mismatch repair gene Pms2. Proc. Natl Acad. Sci. USA, 94, 31223127.
[Abstract/Free Full Text] - Monckton, D.G., Coolbaugh, M.I., Ashizawa, K., Siciliano, M.J. and Caskey, C.T. (1997) Hypermutable myotonic dystrophy CTG repeats in transgenic mice. Nat. Genet., 15, 193196.[CrossRef][Web of Science][Medline]
- Wooster, R., Cletonjansen, A.M., Collins, N., Mangion, J., Cornelis, R.S., Cooper, C.S., Gusterson, B.A., Ponder, B.A.J., Vondeimling, A., Wiestler, O.D. et al. (1994) Instability of short tandem repeats (microsatellites) in human cancers. Nat. Genet., 6, 152156.[CrossRef][Web of Science][Medline]
- Lilley, D.M. (1988) DNA opens upsupercoiling and heavy breathing. Trends Genet., 4, 111114.[CrossRef][Web of Science][Medline]
- Havas, K., Flaus, A., Phelan, M., Kingston, R., Wade, P.A., Lilley, D.M. and Owen-Hughes, T. (2000) Generation of superhelical torsion by ATP-dependent chromatin remodeling activities. Cell, 103, 11331142.[CrossRef][Web of Science][Medline]
-
Pearson, C.E., Wang, Y.H., Griffith, J.D. and Sinden, R.R. (1998) Structural analysis of slipped-strand DNA (S-DNA) formed in (CTG)n·(CAG)n repeats from the myotonic dystrophy locus. Nucl. Acids Res., 26, 816823.
[Abstract/Free Full Text] -
Genschel, J., Littman, S.J., Drummond, J.T. and Modrich, P. (1998) Isolation of MutSbeta from human cells and comparison of the mismatch repair specificities of MutSbeta and MutSalpha. J. Biol. Chem., 273, 1989519901.
[Abstract/Free Full Text] - Genschel, J. and Modrich, P. (2003) Mechanism of 5'-directed excision in human mismatch repair. Mol. Cell, 12, 10771086.[CrossRef][Web of Science][Medline]
-
Genschel, J., Bazemore, L.R. and Modrich, P. (2002) Human exonuclease I is required for 5' and 3' mismatch repair. J. Biol. Chem., 277, 1330213311.
[Abstract/Free Full Text] -
Wang, H. and Hays, J.B. (2002) Mismatch repair in human nuclear extracts. Time courses and ATP requirements for kinetically distinguishable steps leading to tightly controlled 5' to 3' and aphidicolin-sensitive 3' to 5' mispair-provoked excision. J. Biol. Chem., 277, 2614326148.
[Abstract/Free Full Text] -
Longley, M.J., Pierce, A.J. and Modrich, P. (1997) DNA polymerase delta is required for human mismatch repair in vitro. J. Biol. Chem., 272, 1091710921.
[Abstract/Free Full Text] -
Savouret, C., Garcia-Cordier, C., Megret, J., te Riele, H., Junien, C. and Gourdon, G. (2004) MSH2-dependent germinal CTG repeat expansions are produced continuously in spermatogonia from DM1 transgenic mice. Mol. Cell. Biol., 24, 629637.
[Abstract/Free Full Text] -
McCulloch, S.D., Gu, L. and Li, G.M. (2003) Nick-dependent and -independent processing of large DNA loops in human cells. J. Biol. Chem., 278, 5080350809.
[Abstract/Free Full Text] -
de Wind, N., Dekker, M., Claij, N., Jansen, L., van Klink, Y., Radman, M., Riggins, G., van der Valk, M., van't Wout, K. and te Riele, H. (1999) HNPCC-like cancer predisposition in mice through simultaneous loss of Msh3 and Msh6 mismatch-repair protein functions. Nat. Genet., 23, 359362.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
G.-F. Richard, A. Kerrest, and B. Dujon Comparative Genomics and Molecular Dynamics of DNA Repeats in Eukaryotes Microbiol. Mol. Biol. Rev., December 1, 2008; 72(4): 686 - 727. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. De Temmerman, S. Seneca, A. Van Steirteghem, P. Haentjens, J. Van der Elst, I. Liebaers, and K.D. Sermon CTG repeat instability in a human embryonic stem cell line carrying the myotonic dystrophy type 1 mutation Mol. Hum. Reprod., July 1, 2008; 14(7): 405 - 412. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Entezam and K. Usdin ATR protects the genome against CGG{middle dot}CCG-repeat expansion in Fragile X premutation mice Nucleic Acids Res., February 11, 2008; 36(3): 1050 - 1056. [Abstract] [Full Text] [PDF] |
||||
![]() |
V C Wheeler, F Persichetti, S M McNeil, J S Mysore, S S Mysore, M E MacDonald, R H Myers, J F Gusella, N S Wexler, and The US Venezuela Collaborative Research Group Factors associated with HD CAG repeat instability in Huntington disease J. Med. Genet., November 1, 2007; 44(11): 695 - 701. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Lin and J. H. Wilson Transcription-Induced CAG Repeat Contraction in Human Cells Is Mediated in Part by Transcription-Coupled Nucleotide Excision Repair Mol. Cell. Biol., September 1, 2007; 27(17): 6209 - 6217. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lloret, E. Dragileva, A. Teed, J. Espinola, E. Fossale, T. Gillis, E. Lopez, R. H. Myers, M. E. MacDonald, and V. C. Wheeler Genetic background modifies nuclear mutant huntingtin accumulation and HD CAG repeat instability in Huntington's disease knock-in mice Hum. Mol. Genet., June 15, 2006; 15(12): 2015 - 2024. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Pelletier, B. T. Farrell, J. J. Miret, and R. S. Lahue Mechanistic features of CAG*CTG repeat contractions in cultured cells revealed by a novel genetic assay Nucleic Acids Res., September 30, 2005; 33(17): 5667 - 5676. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. K. Nag, M. Fasullo, Z. Dong, and A. Tronnes Inverted repeat-stimulated sister-chromatid exchange events are RAD1-independent but reduced in a msh2 mutant Nucleic Acids Res., September 15, 2005; 33(16): 5243 - 5249. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Wells, R. Dere, M. L. Hebert, M. Napierala, and L. S. Son Advances in mechanisms of genetic instability related to hereditary neurological diseases Nucleic Acids Res., July 8, 2005; 33(12): 3785 - 3798. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










