Skip Navigation


Human Molecular Genetics Advance Access originally published online on June 30, 2004
Human Molecular Genetics 2004 13(17):1919-1932; doi:10.1093/hmg/ddh193
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow All Versions of this Article:
13/17/1919    most recent
ddh193v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (30)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lillard-Wetherell, K.
Right arrow Articles by Groden, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lillard-Wetherell, K.
Right arrow Articles by Groden, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, Vol. 13, No. 17 © Oxford University Press 2004; all rights reserved

Association and regulation of the BLM helicase by the telomere proteins TRF1 and TRF2

Kate Lillard-Wetherell1, Amrita Machwe2, Gregory T. Langland1, Kelly A. Combs1, Gregory K. Behbehani1, Steven A. Schonberg3,4, James German5, John J. Turchi6, David K. Orren2 and Joanna Groden1,*

1Department of Molecular Genetics, Biochemistry and Microbiology, Howard Hughes Medical Institute, University of Cincinnati College of Medicine, Cincinnati, OH 45267, USA, 2Graduate Center for Toxicology, University of Kentucky, Lexington, KY 40536, USA, 3Department of Pediatrics, George Washington University School of Medicine, Washington DC 20052, USA, 4American Quest Laboratories, Inc., Chantilly, VA 20153, USA, 5Department of Pediatrics, Weill Medical College of Cornell University, New York, NY 10021, USA and 6Department of Biochemistry and Molecular Biology, Wright State University School of Medicine, Dayton, OH 45435, USA

Received April 28, 2004; Revised June 3, 2004; Accepted June 15, 2004


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
In addition to increased DNA-strand exchange, a cytogenetic feature of cells lacking the RecQ-like BLM helicase is a tendency for telomeres to associate. We also report additional cellular and biochemical evidence for the role of BLM in telomere maintenance. BLM co-localizes and complexes with the telomere repeat protein TRF2 in cells that employ the recombination-mediated mechanism of telomere lengthening known as ALT (alternative lengthening of telomeres). BLM co-localizes with TRF2 in foci actively synthesizing DNA during late S and G2/M; co-localization increases in late S and G2/M when ALT is thought to occur. Additionally, TRF1 and TRF2 interact directly with BLM and regulate BLM unwinding activity in vitro. Whereas TRF2 stimulates BLM unwinding of telomeric and non-telomeric substrates, TRF1 inhibits BLM unwinding of telomeric substrates only. Finally, TRF2 stimulates BLM unwinding with equimolar concentrations of TRF1, but not when TRF1 is added in molar excess. These data suggest a function for BLM in recombination-mediated telomere lengthening and support a model for the coordinated regulation of BLM activity at telomeres by TRF1 and TRF2.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Several proteins are important for telomere maintenance, including TRF1 and TRF2, both of which bind to duplex telomeric repeats via a MYB-binding domain within the C-terminus of each protein (1). TRF1 is vital for controlling telomere elongation by inhibiting telomerase at chromosome ends and perhaps by inhibiting C-strand synthesis (2). Furthermore, TRF1 promotes parallel pairing of duplexed telomeric tracts in vitro suggesting a role in packaging telomeres (3). TRF2 plays a key role in telomere maintenance and stability, as its alteration has profound effects on telomere length, the frequency of chromosome end-to-end fusions and cellular senescence (46). TRF2 is sufficient for the formation in vitro of a protective telomeric loop, or T-loop, in which the single-stranded 3' overhang is inserted into the antecedent duplexed telomere tracts (7,8). This loop structure is thought to sequester chromosomal ends in order to prevent DNA end-joining and the activation of DNA damage checkpoint signaling (4,7). Additionally, telomeric loops may be intermediates in recombination-mediated pathways of telomere lengthening (9). Clearly, TRF1 and TRF2 are central players in telomere elongation, protection and structure.

Telomerase is required for the primary mechanism of telomere length maintenance in mammalian cells and is expressed in embryonic tissues, germ cells and stem cells, but not in normal somatic cells with a finite lifespan (10,11). Telomeres can also be lengthened by telomerase-independent pathways, referred to as ALT (alternative lengthening of telomeres), that are mediated by recombination (1215). In Saccharomyces cerevisiae, two ALT-related pathways have been identified that require either Rad50 or Rad51 (16,17). Sgs1, the sole S. cerevisiae RecQ helicase, is required for RAD50-dependent recombination-mediated telomere lengthening (1820). In immortalized human cells that use ALT, RAD50 with associated factors NBS1 and MRE11, RAD51 and RAD52 co-localize with telomeric DNA, TRF1 and TRF2 in specialized ALT-associated promyelocytic leukemia (PML) nuclear bodies (APBs) (2124). APBs are enriched in cells during G2/M (23) and incorporate bromodeoxyuridine (BrdU) (24), suggesting that telomere synthesis occurs within APBs after most DNA replication is complete.

Somatic cells from persons with the inherited chromosome breakage syndrome, Bloom syndrome (BS), feature excessive chromosome breakage and intra- and interchromosomal homologous exchanges (25). The gene mutated in BS, BLM, encodes a RecQ-like ATP-dependent 3' to 5' helicase that presumably functions in some types of DNA transactions (26). As the absence of BLM is associated with excessive recombination (27), in vitro experiments have tested the ability of BLM to suppress recombination and/or resolve recombination intermediates. In vitro, BLM promotes branch migration of Holliday junctions, resolves D-loops and unwinds G-quadruplex DNA (2831). A function of BLM in maintaining telomeres is suggested by the latter, as D-loops and G-quadruplex structures are thought to be present at telomeres (7,32). In addition, co-localization of BLM with telomeres, TRF1 and TRF2 has been described in cells utilizing ALT (33,34) and a functional in vitro interaction with TRF2 was recently demonstrated (35). Intriguingly, Schawalder et al. (36) report a telomere-specific association domain at the N-terminus of the BLM protein. Primary cells from BS persons demonstrate a normal distribution of telomere length as compared with age-matched controls; however, some hyper-variability in telomere length has been noted for BS cells in culture (33,36).

In the present study, the function of BLM at telomeres was further investigated. We report an increase in the frequency of associations between chromosome ends in BS cells suggesting an inability to resolve telomere associations in the absence of BLM. Additionally, we find that BLM associates with TRF2 in immortalized cells using ALT but not in telomerase-positive cells, consistent with previous reports (34). BLM co-localizes with TRF2 in foci actively synthesizing DNA during late S and G2/M; co-localization is enriched during these phases of the cell cycle when ALT is thought to occur. Additionally, we report that TRF1 and TRF2 physically and functionally interact with BLM in vitro. TRF2 stimulates BLM unwinding of telomeric and non-telomeric substrates. Conversely, TRF1 inhibits BLM unwinding of telomeric substrates only. Finally, BLM helicase activity is stimulated by TRF2 with equimolar concentrations of TRF1, but not when TRF1 is present in molar excess. These experiments demonstrate that BLM is a component of a telomere associated complex in cells using ALT and suggest a unique mechanism for regulation of BLM helicase activity at telomeres by TRF1 and TRF2.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Cytogenetic evidence for telomere dysfunction in BS cells
Cytogenetic evaluation of BS cells reveals an excess of various chromatid lesions, including the quadriradial configuration (QR) signifying the hyper-recombination associated with BLM mutation (25). In addition, telomere associations (TAs) between homologous chromosome arms at metaphase are observed in BS cells by G-banding (Fig. 1A). TAs may also be found in cells from normal persons; although in cultured cells, TAs are most frequently found in cells defective in telomere maintenance, presumably due to recombination and end-joining between shortened telomeres (37,38). A clear (non-staining) area is generally present between associated telomeres in BS cells indicating that these TAs are not end-to-end fusions [Fig. 1A(b) and (c)]. When this clear area is lacking, the configuration becomes indistinguishable from a dicentric chromosome formed by end fusion [Fig. 1A(a)]. TAs are present in 0.57% of metaphases from BS blood lymphocytes in short-term culture as compared with 0.1% of non-BS controls, a statistically significant difference by chi-square analysis (P=0.05) (Table 1). TAs between homologous chromosome arms are also observed in metaphases prepared from immortalized BS fibroblast cells (GM08505) analyzed by fluorescence in situ hybridization (FISH) with sub-telomeric and telomeric repeat probes (Fig. 1B and C). Telomeric sequences are present at the junction of most TAs observed by FISH analysis (Fig. 1C). The latter observation demonstrates that TAs in BS cells do not occur exclusively as a result of end fusion between chromosomes lacking telomeric repeat DNA. These cytogenetic data suggest that TAs are elevated significantly in primary and transformed BS cells. This increase in TAs may be the result of increased telomere recombination or intertwined chromosome ends that remain unresolved in the absence of the BLM helicase.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 1. BS cells are characterized by increases in TAs of homologous chromosome arms. (A) TAs from three G-banded metaphases from phytohemagglutinin-stimulated BS lymphocytes in short-term culture are presented. (a) TA comprised of chromosome no. 11. (b) TA comprised of chromosome no. 12. (c) TA comprised of chromosome no. 14. (B) FISH analysis of metaphases prepared from BS fibroblasts (GM08505) with a chromosome arm-specific subtelomeric probes demonstrates a TA between q-arms of chromosome no. 14 (white arrow). (C) FISH analysis of metaphases prepared from BS fibroblasts (GM08505) with a telomeric repeat probe shows telomeric signals at the junction of a TA (white arrow).

 

View this table:
[in this window]
[in a new window]
 
Table 1. Telomeric associations (TAs) in BS and non-BS lymphocytes
 
BLM and TRF2 co-localize and associate in telomerase-negative cells
To determine if BLM co-localizes with telomeres, dual immunostaining was performed with antibodies specific for BLM and TRF2. As the increased frequency of TAs in BS cells suggested a function for BLM in telomere recombination, telomerase-negative immortalized cells using ALT (Saos2) were compared with telomerase-positive immortalized cells (MCF7) and primary cells (WI-38). BLM co-localizes with TRF2 in Saos2 cells, but does not co-localize with TRF2 in either MCF7 or WI-38 cell lines (Fig. 2A). Co-localization of BLM and TRF2 was also observed in another cell line using ALT, VA13/2RA, and is absent in HeLa cells, a telomerase-positive cell line (data not shown). BLM and TRF2 additionally co-localize with PML in cells using ALT demonstrating that co-localization occurs within APBs (data not shown) in agreement with previous results (34). These observations demonstrate that co-localization of BLM and TRF2 is markedly enhanced in cells using ALT and further suggest a role for BLM in telomere recombination.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 2. BLM and TRF2 associate specifically in cells using ALT. (A) BLM and TRF2 co-localize in cells using ALT. Saos2 cells that use ALT (a–c), telomerase-positive MCF7 cells (d–f) and the telomerase-negative primary cell line WI-38 (g–i) were fixed and immunostained with anti-BLM rabbit antibody (FITC-labeled secondary antibody) and anti-TRF2 mouse monoclonal antibody (rhodamine-labeled secondary antibody). BLM foci (a, d and g) and TRF2 foci (b, e and h) are present in all cell lines analyzed. Merged images are shown in bottom panel (c, f and i). Negative controls are performed with mouse IgG (j) and rabbit IgG (k). (B) BLM and TRF2 co-localization is enriched in late S and G2/M. Cells using ALT (Saos2 and VA13/2RA) were blocked in G1/S and co-stained with BLM and TRF2 antibodies at 4 and 10 h post-release from block. Cells are in G1/early S and late S/G2/M at these time points, respectively, as determined by flow cytometry (see text and Supplementary Material). Co-localization was scored by analyzing digital photographs for co-localizing signal. The experiment was repeated three times for each cell line to obtain averages and standard deviations. (C) BLM and TRF2 co-localize with foci of DNA synthesis during late S and G2/M. VA13/2RA cells were synchronized in G1/S by aphidicolin block. Cells shown were pulse-labeled with BrdU at 10 h post-release from aphidicolin block, and subsequently fixed for immunostaining. Flow cytometry was used to confirm cell cycle stage as late S and G2/M (see Supplementary Material). Cells were fixed and immunostained with BrdU antibodies (b and e) (rhodamine-labeled secondary) and either BLM (a) or TRF2 (d) antibodies (FITC-labeled secondary). Negative controls are performed with rat IgG (g and h). (D) BLM and TRF2 associate in ALT cells. BLM was immunoprecipitated from 500 µg of nuclear extracts (NE) prepared from ALT cells (Saos2 and VA13/2RA) or telomerase-positive cells (MCF7 and HeLa). Immunoprecipitations were performed using goat polyclonal BLM antibody or normal goat IgG (negative control). Immunoprecipitated proteins were separated by SDS–PAGE and analyzed by western blot using an anti-TRF2 antibody.

 
BLM and TRF2 foci are enriched during G2/M and undergo DNA synthesis
Cells that use the ALT pathway are enriched with APBs in G2/M, suggesting that recombination-mediated telomere lengthening is cell cycle regulated (23). If BLM is involved in ALT, its association with TRF2 is predicted to increase as cells progress into G2/M. To test this, VA13/2RA and Saos2 cells were blocked at the G1/S boundary and analyzed at 4 and 10 h post-release to compare co-localization of BLM with TRF2 during G1/early S or late S/G2/M, respectively (Fig. 2B). Cell cycle distribution was confirmed by flow cytometry (Supplementary Material). BLM co-localizes with TRF2 throughout the cell cycle in both cell lines; however, the number of cells with overlapping foci increases ~2–3-fold as cells progress into late S and G2/M. During G1 and early S, foci in which BLM and TRF2 co-localize are present in 15% of VA13/2RA cells and 21% of Saos2 cells; during late S and G2/M, the number of cells with BLM/TRF2 foci increases to 38 and 54%, respectively. Co-localization of BLM with PML increases in a similar manner confirming that co-localization occurs in APBs (data not shown). Increased localization in APBs could be either due to translocation of BLM to APBs or due to an increase in the number of APBs during late S and G2/M.

Proteins implicated in ALT, including NBS1 and TRF1, co-localize with foci of BrdU-incorporation during late S and G2 (24). Because APBs are enriched during G2/M (23), it is probable that these foci represent centers of telomere lengthening in cells using ALT. Thus, immunofluorescence was used to determine whether BLM and TRF2 similarly co-localize with active centers of DNA incorporation during late S and G2/M. VA13/2RA cells (ALT) were blocked in G1/S and pulse-labeled with BrdU at 10 h post-release from block at which time cells were in late S and G2/M as determined by flow cytometry (Supplementary Material). Cells were evaluated with antibodies specific for BrdU as well as for BLM or TRF2. During late S and G2/M, both BLM and TRF2 immunostaining overlap with BrdU in distinct foci (Fig. 2C). In contrast, few distinct BrdU foci were distinguishable in telomerase-positive cells (MCF7) during G2/M; co-localization with BLM or TRF2 was not observed. Our results indicate that BLM, TRF2 and PML co-localize with sites of ongoing DNA synthesis in APBs during late S and G2/M. This suggests that BLM is involved in ALT-associated telomere lengthening that occurs after completion of most DNA synthesis.

BLM and TRF2 associate in vivo
Other proteins implicated in ALT, including the RAD50/MRE11/NBS1 complex, associate with telomere proteins in vivo (24,39). Immunoprecipitations were performed to determine whether BLM and TRF2 are components of the same telomere-specific protein complex. BLM immunoprecipitations from nuclear extracts prepared from cells using ALT (Saos2 and VA13/2RA) and telomerase (MCF7 and HeLa) were analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and western blot analysis using anti-TRF2 antibodies. TRF2 co-immunoprecipitates with BLM in nuclear extracts from cells using ALT but not from telomerase-positive cells (Fig. 2D). DNase treatment does not interfere with the association of BLM with TRF2, suggesting that the interaction is independent of DNA tethering (data not shown). These data confirm an in vivo, ALT-specific association between BLM and TRF2 and suggest these proteins may be part of a larger telomere-associated protein complex that facilitates and regulates ALT.

TRF1 and TRF2 interact with BLM in vitro
TRF1 and TRF2 induce the formation of divergent higher order DNA structures from telomere sequences in vitro (3,7,8,40). TRF2 is postulated to protect telomere ends within T-loops, and can promote formation of looped telomeric structures in vitro (7,8). Although TRF1 cannot mediate loop formation, it can promote bending of DNA and parallel pairing of telomere sequences (3,40). In addition to TRF2, BLM is reported to co-localize in vivo with TRF1 (33,34). Therefore, we tested whether there is a direct interaction between BLM and TRF1 in vitro using enzyme linked immunosorbent assay (ELISA). (Fig. 3A). BLM protein was bound to wells of microtiter plates, and after blocking, purified recombinant TRF1 was added in increasing concentrations. Bound TRF1 was detected using an anti-TRF1 antibody, HRP-conjugated secondary and colorimetric substrate. TRF1 bound to wells coated with BLM in a dose-dependent manner; DNase treatment did not interfere with this interaction. TRF1 did not bind significantly to wells coated with bovine serum albumin (BSA), indicating that TRF1 binding is mediated by specific interaction with BLM. To confirm these data, in vitro immunoprecipitations were performed with purified recombinant BLM protein and [35S]-labeled TRF1 made by in vitro transcription translation (IVTT) (Fig. 3B). Immunoprecipitations with anti-TRF1 antibody were analyzed by western blotting with anti-BLM antibody and by autoradiography to detect [35S]-labeled TRF1. In the absence of TRF1, no BLM is immunoprecipitated with the anti-TRF1 antibody. In contrast, a significant amount of BLM is immunoprecipitated when TRF1 is present in the reaction. These results demonstrate that BLM and TRF1 interact directly.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 3. BLM interacts with TRF1 and TRF2 directly. (A) Interaction between BLM and TRF1 detected by ELISA. BLM or BSA was pre-bound to individual wells of a microtiter plate. TRF1 was incubated in wells and binding to BLM or BSA was detected using anti-TRF1 antibody and a colorimetric substrate (read at OD 450 nm). Black bars represent average OD 450 nm for wells with BLM, and white bars represent values for wells with BSA at indicated concentrations. As a positive control for the antibody, TRF1 was coated directly onto the plate (gray bar). Additionally ‘no primary antibody’ and a ‘no secondary antibody’ reactions were performed as negative controls and for background correction. (B) BLM immunoprecipitates with TRF1 in vitro. Samples containing BLM and/or [35S]-labeled TRF1 were incubated, followed by addition of anti-TRF1 antibody and protein A sepharose beads. Immunoprecipitations were separated by SDS–PAGE and analyzed by western blot with anti-BLM antibody and autoradiography to visualize [35S]-labeled TRF1. The input lane represents ~25% of each protein added to the respective reactions. (C) Co-immunoprecipitation of BLM with TRF2 in vitro. Samples containing BLM and/or TRF2 were incubated, followed by addition of anti-TRF2 antibody and protein A sepharose beads. Supernatant and pellet represent unbound and bound proteins, respectively. Purified BLM and TRF2 were loaded on the gels as markers. Parallel gels were subjected to western blotting using anti-BLM antibody (top) and anti-TRF2 antibody (bottom). (D) Graphical representation of the BLM segments made by in vitro transcription and translation. BLM N spans amino acids 1–587, BLM Hel spans amino acids 588–1000 and BLM C spans amino acids 996–1417. The helicase domain is highlighted in light gray the RecQ C-terminal domain (RecQ) in dark gray, and RNaseD C-terminal (HRDC) domain and the nuclear localization signal (NLS) are labeled. (E) Mapping of the interaction between TRF1 and BLM in vitro. [35S]-labeled BLM segments (Fig. 1D) and [35S]-Labeled TRF1 were incubated together and immunoprecipitated using goat IgG (lane 5) or anti-TRF1 Ab (Lanes 6–8). Immunoprecipitations were separated by SDS–PAGE and analyzed by autoradiography. Individual proteins are as markers (lanes 1–4). (F) Mapping of the interaction between TRF2 and BLM in vitro. [35S]-Labeled BLM segments and purified TRF2 were incubated together and immunoprecipitated using mouse IgG (lane 4) or anti-TRF2 Ab (lanes 5–7). Immunoprecipitations were separated by SDS–PAGE and analyzed by autoradiography. Individual proteins are loaded as markers (lanes 1–3).

 
Our in vivo experiments indicate that TRF2 and BLM associate in cells using ALT, but do not address whether this is a physical interaction. In order to test whether BLM and TRF2 interact directly, immunoprecipitations with purified recombinant BLM and TRF2 were performed (Fig. 3C). Immunoprecipitations with anti-TRF2 antibody were analyzed by western blotting with anti-BLM and anti-TRF2 antibodies. Both pellet and supernatant from each reaction were analyzed, representing bound and unbound protein, respectively. In the absence of TRF2, the majority of BLM protein remains in the supernatant. In contrast, a significant amount of BLM is immunoprecipitated when TRF2 is present in the reaction. These results demonstrate that BLM and TRF2 interact directly and confirm ELISA results previously published (35).

To identify the regions of BLM responsible for interaction with TRF1 and TRF2, three separate [35S]-labeled segments of BLM were synthesized by IVTT, representing the N-terminus, the helicase domain and the C-terminus (Fig. 3D). [35S]-Labeled TRF1 and BLM segments were incubated together, immunoprecipitated with anti-TRF1 antibody and analyzed by autoradiography (Fig. 3E). The BLM helicase segment co-immunoprecipitates with TRF1. No proteins were non-specifically immunoprecipitated with IgG or with anti-TRF1 when TRF1 was not added (data not shown). Likewise, BLM protein segments from IVTT and purified TRF2 were incubated together, immunoprecipitated with anti-TRF2 antibodies and analyzed by autoradiography (Fig. 3F). The BLM C-terminal segment and the BLM helicase segment co-immunoprecipitate with TRF2. The interaction of TRF2 with the BLM C-terminal segment appears to be more significant than its interaction with the helicase segment. No BLM segments were non-specifically immunoprecipitated with IgG or with anti-TRF2 when TRF2 was not added (data not shown). These results demonstrate direct interactions between BLM and TRF1 mediated by the BLM helicase domain, and between BLM and TRF2 mediated by the BLM C-terminus and helicase domains. Additionally, these data suggest that co-localization of BLM with TRF1 and TRF2 in APBs is due to their direct interactions.

BLM unwinds substrates that resemble native telomere conformations
Telomeric DNA isolated from cells demonstrates the existence of a 3'-overhang of the G-rich strand. To investigate a role for BLM in maintaining such a structure, we constructed a DNA duplex that resembles a native linearized telomere with a 3'-single-stranded region composed of five 5'-TTAGGG-3' repeats and a 38 bp duplexed region containing 23 bp of telomeric repeats for TRF1 and TRF2 binding (41) (Fig. 4A). BLM unwinds this substrate efficiently, reaching 60% unwinding of total substrate at the highest concentrations of BLM tested (Fig. 4B and E).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 4. BLM helicase unwinds telomere-like substrates. (A) Sequence and structure of the telomeric 3'-overhang substrate. Substrate has a 3'-overhang composed of five 5'-TTAGGG-3' repeats and a 38 bp duplex with 23 bp of duplexed telomeric repeats (highlighted by an unshaded box). (B) BLM unwinds the telomeric 3'-overhang structure. BLM (0, 1, 2, 4, 6, 8 and 10 nM; lanes 1–7) was incubated with the telomeric 3'-overhang substrate and the DNA products resolved by non-denaturing PAGE. Unwinding is evidenced by the conversion of duplexed substrate to faster migrating single-stranded oligo. Reaction with BLM, without addition of ATP is shown in lane 8. The migration of substrates are shown on the left by drawings. Quantitation is shown in (E). (C) Structure and sequence of the telomeric D-loop substrate formed by the annealing of an invading strand oligomer (highlighted in lightly shaded type) into the partial duplex or bubble substrate created by pairing the C-rich strand with the G-rich strand. Duplexed telomeric repeats, 21 bp, is found within the D-loop (highlighted by an unshaded box) and imperfect telomere repeats are found on both duplex arms (highlighted by shaded boxes). (D) BLM displaces the invading strand of the telomeric D-loop substrate. Reactions were performed with BLM (0, 0.12, 0.25, 0.62, 1.25, 2.5, 5 and 10 nM; lanes 1–8) as described in (B) Displacement of the invading strand (unwinding) is evidenced by the conversion of the D-loop to a faster migrating bubble substrate. Bubble substrate without the inserted strand was loaded as a marker (lane 9). The migration of substrates are shown on the left by drawings. Quantitation is shown in (E). (E) Quantitation of BLM unwinding of telomere substrates. Unwinding of 3'-overhang substrate (dotted line) was calculated by comparing the amount of single-stranded substrate produced to the total amount of the substrate in the reaction, with correction for any unannealed substrate in untreated controls. Unwinding of D-loop substrate (solid line) was calculated by comparing the amount of bubble substrate produced to the total amount of the substrate in the reaction, with correction for small amounts of unannealed bubble substrate in untreated controls. Percent unwinding is graphed as a function of BLM concentration. Data were generated from four independent experiments for each substrate.

 
In mammalian cells, telomeric 3'-overhangs may be folded back and inserted into the duplex telomeric sequences to form ‘T-loops’ in order to protect chromosome ends from degradation and end-joining (7,8). At the site of insertion, the single-stranded overhang displaces the G-rich strand of the duplex to form a D-loop structure that is stabilized by TRF2 binding. Additionally, telomere D-loops may be present as intermediates in recombination during ALT (9). T-Loops must be resolved in order for chromosome ends to be replicated, thus helicases to unwind these structures are likely essential for proper DNA replication. To investigate the role of BLM in telomere loop metabolism, a model substrate was created in vitro that approximates a D-loop (Fig. 4C). Our substrate was constructed by annealing partially complementary oligomers to form a duplex with bubble, then annealing a third oligomer complementary to the bubble. This substrate contains 21 bp of perfect telomeric repeats within the D-loop and imperfect telomeric repeat sequences on both duplex arms for TRF1 and TRF2 binding (41). DNase I footprinting analysis demonstrates that BLM protects a small area on the C-rich strand within the D-loop region near the point where the invading strand exits the duplex; this suggests that BLM binds specifically to the D-loop structure (Supplementary Material). Helicase assays demonstrate that BLM efficiently displaces the invading strand of the telomeric D-loop substrate and converts it to a ‘bubble-containing’ duplex (Fig. 4D and E). This displacement occurs in a dose-dependent manner and is nearly complete at a BLM concentration of 10 nM.

TRF1 and TRF2 oppositely regulate BLM activity on telomeric substrates
As both TRF1 and TRF2 interact directly with BLM, we tested whether these proteins affect BLM unwinding activity on telomeric substrates. Substrates were pre-incubated with varying amounts of TRF1 or TRF2, before starting the helicase reaction with a fixed concentration of BLM. In a dose-dependent manner, TRF2 stimulated BLM unwinding of the telomeric 3'-overhang at concentrations between 4 and 20 nM (Fig. 5A and C) and the telomere D-loop at concentrations between 2.5 and 10 nM (Fig. 5D and F). Conversely, TRF1 inhibited BLM unwinding of the telomeric 3'-overhang at concentrations between 6 and 60 nM (Fig. 5B and C) and the telomere D-loop at concentrations between 3 and 15 nM (Fig. 5E and F). When these experiments were performed utilizing the 3'–5'-helicase UvrD, TRF1 and TRF2 had no significant effect on unwinding (Supplementary Material). Thus, TRF1 and TRF2 effects on unwinding are not universally applicable to DNA helicases.




View larger version (57K):
[in this window]
[in a new window]
 
Figure 5. Effects of TRF1 and TRF2 on BLM unwinding of telomere substrates. (A) TRF2 stimulates unwinding of telomeric 3'-overhang substrate by BLM. TRF2 (0, 4, 8, 20 and 40 nM; lanes 1–5) was pre-incubated with DNA substrate followed by addition of BLM (4 nM). Control reaction with TRF2 alone is shown in lane 6. Quantitation is shown in (C). (B) TRF1 inhibits unwinding of telomeric 3'-overhang substrate by BLM. As with TRF2, TRF1 (0, 6, 12, 24 and 60 nM; lanes 1–5) was pre-incubated with DNA substrate followed by addition of BLM (6 nM). Control reaction with TRF1 alone is shown in lane 6. Quantitation is shown in (C). (C) BLM unwinding in the presence of TRF1 (dotted line) and TRF2 (solid line) derived from data shown in (A) and (B), quantitated as described in Figure 4E. (D) TRF2 stimulates disruption of telomeric D-loop by BLM. Reactions with TRF2 (0, 1.25, 2.5, 5, 10 and 15 nM; lanes 2–7) and BLM (1 nM) were performed in the same manner as telomeric 3'-overhang. Control reaction with TRF2 alone is shown in lane 8. Quantitation is shown in (F). (E) TRF1 inhibits disruption of telomeric D-loop by BLM. Reactions with TRF1 (0, 3, 6 and 15 nM; lanes 2–5) and BLM (1 nM) were performed in the same manner as telomeric 3'-overhang substrate. Quantitation is shown in (F). (F) BLM unwinding in the presence of TRF1 (dotted line) and TRF2 (solid line) derived from data shown in (D) and (E), quantitated as described in Figure 4E.

 
TRF2 but not TRF1 affects BLM unwinding of a non-telomeric 3'-overhang
We next set out to determine whether the regulation of BLM unwinding activity by TRF1 and TRF2 was related to their ability to stably bind DNA-containing telomeric repeats. A non-telomeric 3'-overhang substrate with a 38 bp duplexed region was generated, which is the same length and structure as the telomeric 3'-overhang substrate (Fig. 4A), but without telomeric repeats. BLM unwinds the 3'-overhang substrate in a dose-dependent manner at concentrations between 1 and 10 nM (Fig. 6A). The non-telomeric and telomeric 3'-overhang substrates are unwound with similar efficiency, reaching near 60% unwinding of total substrate at the highest concentrations of BLM tested (Fig. 6B). Gel shift assays confirmed that TRF1 and TRF2 bind stably to the telomeric substrate, but not to non-telomeric substrate (Supplementary Material). We next tested the ability of BLM to unwind the non-telomeric 3'-overhang substrate in the presence of TRF1 and TRF2. When TRF2 is added to helicase reactions with non-telomeric substrate, TRF2 (at concentrations between 4 and 40 nM) stimulates BLM unwinding of this substrate (Fig. 6C and E). In contrast, TRF1 (at concentrations between 6 and 60 nM) has no affect on BLM unwinding of this substrate (Fig. 6D and E). These results indicate that TRF1 inhibition of BLM unwinding on telomeric substrate is due to specific binding to telomere repeat sequences. On the other hand, TRF2 stimulation of BLM unwinding is not specific for telomeric substrates, suggesting that stable binding to DNA is not required for this stimulatory effect.




View larger version (56K):
[in this window]
[in a new window]
 
Figure 6. Effects of TRF1 and TRF2 on BLM unwinding of non-telomeric substrate. (A) BLM unwinds the non-telomeric 3'-overhang substrate. Reactions were performed with BLM (0, 1, 2, 4, 6, 8 and 10 nM; lanes 1–7) as described in Figure 4B. Reaction with BLM, without addition of ATP is shown in lane 8. The migration of substrates are shown on the left by drawings. (B) BLM unwinding of non-telomeric 3'-overhang substrate, calculated as described in Figure 4E. Unwinding of non-telomeric 3'-overhang is represented by a solid line. Unwinding of the telomeric 3'-overhang is shown for comparison (data derived from Fig. 4B), represented by a dashed line. (C) TRF2 stimulates unwinding of non-telomeric substrate by BLM. TRF2 (0, 4, 8, 20 and 40 nM; lanes 1–5) was pre-incubated with DNA substrate followed by addition of BLM (4 nM). Reactions with TRF2 only and no protein are shown in lanes 6 and 7, respectively. (D) TRF1 has no effect on unwinding of non-telomeric substrate by BLM. TRF1 (0, 6, 12, 24 and 60 nM; lanes 1–5) was pre-incubated with DNA substrate followed by addition of BLM (6 nM). Reactions with TRF1 only and no protein are shown in lanes 6 and 7, respectively. (E) BLM unwinding in the presence of TRF1 (dotted line) and TRF2 (solid line) derived from data shown in (C) and (D), quantitated as described in Figure 4E.

 
Effects of TRF1 and TRF2 in combination on BLM helicase activity vary with relative concentrations
Our results indicate that singly, TRF1 and TRF2 act in opposition to one another to regulate BLM helicase activity on telomere substrates. To address the mechanism coordinating BLM activity, we performed helicase assays using the telomeric 3'-overhang substrate with both TRF1 and TRF2 in varying molar ratios (Fig. 7). When equimolar concentrations of TRF1 and TRF2 (4 nM each) are pre-incubated with the substrate, TRF2 stimulates BLM unwinding. TRF2 stimulates BLM unwinding when it is present in excess of TRF1. However, when TRF1 is present in excess of TRF2, the stimulatory effect of TRF2 on BLM unwinding is inhibited. These data argue that regulation of BLM unwinding by TRF1 and TRF2 is dependent on the relative molar ratio of these proteins at the telomere.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 7. Effects of combined TRF1 and TRF2 on BLM unwinding of telomeric substrate. Helicase assays were performed using the telomeric 3'overhang substrate. TRF1 and/or TRF2 was pre-incubated with DNA substrate followed by addition of BLM (4 nM fixed). Reaction are as follows: lane 1: BLM only; lane 2: BLM and TRF2 (4 nM); lane 3: BLM and TRF1 (4 nM); lane 4: BLM, TRF1 (4 nM) and TRF2 (4 nM); lane 5: BLM, TRF1 (4 nM) and TRF2 (8 nM); lane 6: BLM, TRF1 (4 nM) and TRF2 (12 nM); lane 7: BLM, TRF2 (4 nM) and TRF1 (8 nM); lane 8: BLM, TRF2 (4 nM) and TRF1 (12 nM); lane 9: no protein control. Percent unwinding is calculated as described in Materials and Methods; graph bars represent average percent unwinding and error bars represent standard deviation for three separate experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
BS cells are characterized by high frequencies of SCE and QRs. In addition to these well-documented chromosomal abnormalities, we show that cells lacking BLM have elevated levels of TAs. A clear, non-staining area is generally present between associated telomeres visualized by G-banding, indicating that TAs are not end-to-end fusions, but more likely represent unresolved recombination events or entanglements between telomeres in BS cells. This observation stimulated our investigation of the role of BLM in telomere maintenance, particuarly in cells that utilize recombinant pathways for telomere lengthening, termed ALT.

We report that BLM and TRF2 co-localize in ALT-associated PML bodies (APBs) and can be co-immunoprecipitated from cells using ALT, but not from telomerase-positive cells. Association of BLM with TRF2 has been reported by other groups (34,35); however, our work is the first to demonstrate co-immunoprecipitation of endogenous BLM with TRF2 specifically from cells using ALT. Further, we have pinpointed the timing of this association during the cell cycle. Co-localization of BLM with TRF2 and PML increases to a maximum during late S and G2/M, consistent with the reported enrichment of APBs during G2/M when ALT is thought to occur (23,24). Furthermore, BLM and TRF2 co-localize with foci of DNA synthesis during late S and G2/M. These data clarify the spatial and temporal association between BLM and telomere synthesis in cells using ALT, not established in previous experiments, and suggest that BLM has a role in the ALT mechanism for telomere lengthening. In this regard, the role of BLM in ALT likely parallels that of its RecQ homolog Sgs1 during RAD50-dependent recombination-mediated telomere lengthening in S. cerevisiae (1820).

The co-localization of BLM with TRF1 and TRF2, reported here and elsewhere (33,34), prompted us to examine whether these proteins interact directly, and the effects of such interactions on BLM activity. We find that BLM interacts directly with TRF2 in vitro in agreement with a previous report (35). Our experiments have mapped this interaction primarily to the BLM C-terminus and secondarily to the helicase domain. Interestingly, TRF2 interacts with another RecQ helicase, WRN, through a portion of the WRN helicase and RecQ C-terminal domains, protein regions conserved between BLM and WRN (35). Additionally, we report that TRF2 stimulates BLM unwinding of two telomere substrates in vitro, a 3'-overhang and a telomere D-loop structure. TRF2 also stimulates BLM unwinding of a non-telomeric substrate, suggesting that physical interaction between BLM and TRF2 primarily mediates this stimulatory effect. Importantly, TRF2 binds stably to both of our telomere substrates indicating that stable DNA binding, although not required, does not hinder the ability of TRF2 to stimulate BLM activity. This result is significant as TRF2 is bound to telomeric DNA in vivo. Additionally, we find that TRF2 stimulates BLM unwinding of substrates with a short duplex (21 bp; telomeric D-loop), as well as a long duplex (38 bp; 3'-overhang substrates), suggesting that TRF2 stimulates BLM enzymatic activity and processivity. A dual mechanism of stimulation by TRF2 may be required to promote BLM unwinding of long telomeric DNA tracts, such as those found in cells using ALT. These findings contrast with those of Opresko et al. (35) who reports that TRF2 stimulates BLM unwinding of short duplexes (22 bp) that do not bind TRF2, but does not stimulate BLM unwinding of long duplexes (34 bp) that bind TRF2. Our substrates were designed to approximate more closely native telomere conformations and are distinct from the forked substrates used by Opresko et al.; therefore, substrate composition and structure may be a critical factor for analyzing TRF2 stimulation of BLM activity.

This work also demonstrates a direct interaction between BLM and TRF1, mediated specifically by the BLM helicase domain. In contrast to TRF2, we find that TRF1 inhibits BLM unwinding of two types of telomeric substrates, but does not affect BLM unwinding of a non-telomeric substrate. These data suggest that TRF1 binding to telomeric DNA is necessary for its inhibition of BLM helicase activity. One possibility is that TRF1 binding to telomeric substrate makes the DNA more difficult to unwind; however, TRF1 does not inhibit unwinding of telomeric substrates by the UvrD helicase. Taken together, these results suggest that TRF1 binding to both BLM and telomeric DNA might sterically hinder the ability of BLM to unwind telomeric substrates. Although co-localization of BLM and TRF1 has been reported by others (33,34), we were unable to confirm this in vivo association by immunoprecipitation owing to lack of suitable TRF1 antibodies for western blotting.

Our data demonstrate that TRF2 stimulates BLM unwinding in the presence of an equimolar concentration of TRF1, and suggest that TRF2 is the dominant regulator of BLM activity. However, the stimulatory effect of TRF2 on BLM unwinding is blocked when TRF1 is present in excess. Without TRF2 stimulation, BLM may be unable to traverse and unwind efficiently long, GC-rich telomeric tracts found in cells using ALT. Therefore, regulation of BLM activity at the telomere may be dependent on the relative concentrations of TRF1 and TRF2. It remains to be determined how TRF1 and TRF2 function to coordinate BLM activity in cells using ALT. One mechanism is suggested by the recent finding that poly(ADP)-ribosylation of TRF1 by tankyrase directs ubiquitin-dependent degradation of TRF1 and telomere lengthening (42,43). Degradation of TRF1 would then relieve TRF1-mediated inhibition and allow stimulation of BLM by TRF2 during telomere lengthening when BLM activity might be required.

Although the exact function of BLM at telomeres is unknown, the biochemical attributes of BLM suggest that it functions to regulate D-loop formation following strand invasion and/or resolve recombinant or entangled telomeres in cells using ALT. BLM may additionally resolve G-quadruplex structures (29) that may occur in G-rich telomeric DNA; persistence of these structures would disrupt telomere lengthening and integrity. Importantly, our data do not exclude a function for BLM at telomeres in telomerase-positive or non-immortalized cells. In fact, the increased frequency of TAs in primary and telomerase-positive, immortalized BS cultures suggest a role for BLM in resolving recombination events at telomeres in non-ALT cells. The low frequency of such events in non-ALT cells would make the association of BLM with telomeres difficult to detect using current methodologies. Nevertheless, our findings demonstrate an association of BLM with ALT and suggest that TRF1 and TRF2 play key roles in regulating BLM activity on telomeric structures.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Cell lines
Two immortalized and telomerase-negative human cell lines, Saos2 and WI-38-VA13/2RA, two immortalized and telomerase-positive human cell lines, MCF7 and HeLa, and one non-immortalized primary cell line of diploid human fibroblasts, WI-38, were obtained from ATCC (21). The SV40-transformed BS fibroblast cell line GM08505 was obtained from the Coriell Cell Repository. MCF7 and Saos2 cells were cultured in Dulbecco's modified Eagle's medium (Gibco-BRL) containing 10% heat-inactivated fetal bovine serum (FBS) (Hyclone), and GM08505, WI-38 and WI-38-VA13/2RA in minimal essential media (Gibco-BRL) containing 10% FBS; all cell lines were grown at 37°C and in 5% CO2. Lymphoblasts were isolated from whole blood using standard separation methods, and were maintained in Roswell Park Memorial Institute (RPMI) 1640 media containing 20% FBS.

Cytogenetics
Metaphase spreads were prepared from phytohemagglutinin-stimulated lymphoblasts according to standard procedure and were analyzed by Giemsa staining. Telomeric fluorescence in situ hybridization (FISH) was performed to analyze telomeric associations in BS cells as follows. Prior to hybridization, metaphase spreads prepared on glass slides were fixed in 4% paraformaldehyde, treated with 1 mg/ml pepsin in 20 mM glycine (pH 2) and dehydrated in a serial ethanol series (70, 90 and 100%). FISH mixture [10 mM Tris, 70% formamide, 0.5% blocking agent (Roche), 0.5 µg/ml biotin-labeled (CCCTAA)3 probe] was applied to the slide, heated to 80°C for 3 min and hybridized overnight in a wet chamber at room temperature. Excess hybridization mixture was removed by washing twice in 70% formamide in 10 mM Tris–HCl (pH 7.2) and Tris-buffered saline (TBS) with 0.1% Tween-20, and slides were then blocked for 30 min in PBG [phosphate-buffered saline (PBS) with 0.2% fish gelatin (Sigma) and 0.5% BSA]. Slides were incubated for 30 min at 37°C in fluorescein avidin D (Vector Laboratories) diluted 1 : 100 in PBG followed by three washes at 45°C in PBS with 0.1% Tween-20. Slides were next incubated for 30 min at 37°C with FITC-conjugated anti-avidin antibody (Vector Laboratories) diluted 1 : 100 in PBG followed by three washes at 45°C in PBS with 0.1% Tween-20. DAPI was added to final wash to stain DNA. Slides were mounted in Flouromount and coverslips were sealed with nail polish. Subtelomeric FISH was performed as indicated by manufacturer (Cytocell). Images were captured on a Hamamatsu digital camera using QED imaging software.

Cell cycle synchronization, BrdU pulse-labeling and flow cytometry
Cells were blocked at G1/S by aphidicolin treatment for 16–18 h (Sigma, cat. A0781) (1 µg/ml). Cells were released by removal of the aphidicolin-containing media and fixed at indicated time points post-release for either immunofluorescence (1 : 1 methanol–acetone fixative) or flow cytometry (70% ethanol). BrdU pulse-labeling was performed as reported by Wu et al. (24). Cell cycle analyses were performed on propidium iodide-labeled cells using a Coulter Epics XL flow cytometer.

Immunostaining
The rabbit anti-BLM antibody was generated, purified and used for immunofluorescence as described by Yankiwiski et al. (33). An anti-PML monoclonal antibody (Santa Cruz, cat. PG-M3), an anti-TRF2 monoclonal antibody (Oncogene, cat. OP129) and a rat monoclonal anti-BrdU antibody (Accurate Scientific, cat. OBT0030) were used for immunofluorescence. Secondary antibodies included FITC-conjugated donkey anti-rabbit, FITC-conjugated goat anti-mouse, rhodamine-conjugated goat anti-mouse and rhodamine-conjugated donkey anti-rat (Jackson ImmunoResearch Laboratories). Fluorescence microscopy was performed using an Axioplan 2 Zeiss microscope. Images were captured on a Hamamatsu digital camera using QED imaging software.

In vivo protein co-immunoprecipitations
In vivo immunoprecipitations from nuclear extracts using goat anti-BLM antibodies (Santa Cruz, cat. sc-7789 and 7790) were performed as previously described (44). Monoclonal anti-TRF2 antibodies (Oncogene, cat. OP129) were used for western blot analysis. Nuclear extracts were treated with DNase I (10 µg/ml) prior to immunoprecipitation. 50–100 µg of nuclear extract was loaded for input lanes on each gel. Immunoprecipitations were confirmed by re-probing western blots with anti-MLH1 antibodies (PharMingen, cat. 13271A) and anti-BLM antibodies (Novus, cat. NB 100-161).

Protein expression and purification
pYES-BLM expression vector (pJK1) was provided by I. Hickson (University of Oxford, Oxford, UK) (45). For expression and purification, pJK1 was transfected into the S. cerevisiae strain JEL1 provided by J. Wang (Harvard University, Cambridge, MA, USA) (46). Yeast were inoculated into –Ura DO+minimal base containing 2% glucose (Clontech, cat. 8607-1, 8602-1) and grown to an OD600 of 0.6 in an orbital shaker at 30°C. Yeast were pelleted and resuspended in an equal volume of –Ura DO+minimal base containing 2% galactose (Clontech, cat. 8607-1, 8611-1) and grown for an additional 20–24 h. Yeast were resuspended in cold Buffer A (50 mM KPO4 pH 7.0, 500 mM KCl, 10% glycerol and 1 : 500 mammalian protease inhibitors (Sigma, cat. P-834) at a volume of 35 ml/l of culture and lysed using a french press cell. Yeast lysates were bound to a charged NiNTA resin (Novagen, cat. 69670) in 1x binding buffer (Buffer A+50 mM imidazole) at 4°C for at least 2 h. Resin was applied to the column and washed with 1x binding buffer at least five times. BLM was eluted with 500 mM imidazole and dialyzed into Buffer Z [60 mM Tris–HCl pH 7.5, 100 mM KCl, 1 mM EDTA, 1 mM dithiothreietol (DTT) and 10% glycerol] for 4 h at 4°C. Small aliquots were frozen and stored at –80°C. Purity was confirmed by Coomassie and silver stain (Supplementary Material). UvrD helicase was provided by S. Matson (University of North Carolina, Chapel Hill, NC, USA).

High titer baculoviral stocks containing constructs for His-tagged TRF1 and TRF2 were provided by T. de Lange (The Rockefeller University). Insect cells (Sf9 strain) were infected with TRF2 baculovirus (multiplicity of infection of 5–10) and harvested after 48–72 h. After lysis by sonication in buffer containing 20 mM Tris (pH 8.0), 500 mM NaCl, 5 µM imidazole, 0.5% Nonidet P-40 (NP-40), 10% glycerol, and 5 mM ß-mercaptoethanol, lysates were clarified by centrifugation and the supernatants mixed in batch with NiNTA resin (Qiagen). The resin was washed extensively in the same buffer without NP-40. Finally, TRF2 eluted with buffer containing 300 mM imidazole, and stored at –80°C. TRF1 was expressed and purified as previously described (2). Protein purity was confirmed by Coomassie and silver stain (Supplementary Material).

Expression constructs, in vitro transcription and translation (IVTT), and interaction site mapping by in vitro immunoprecipitation
IVTT was performed according to manufacturer instructions (Promega) with [35S]-methionine (Amersham). BLM–pET constructs used for IVTT (pET30A–BLM-C, pET24D–BLM-N, and pET24D–BLM-H) were generated and characterized as previously described (44). A template for IVTT synthesis of TRF1 was generated by polymerase chain reaction (PCR) with a 5' primer with a T7 promoter site. IVTT-generated proteins were verified for size by western analysis. In vitro immunoprecipitations with [35S]-methionine-labeled BLM segments were performed as previously described (44) using goat anti-TRF1 antibody (Santa Cruz, cat. sc-6165) and mouse anti-TRF2 antibody (Oncogene, cat. OP129). Normal goat IgG and normal mouse IgG were used as negative controls in the respective experiments.

In vitro immunoprecipitation of full-length proteins
Purified BLM (500 ng) and/or TRF2 (450 ng) were incubated in binding buffer (40 mM Tris pH 8.0, 4 mM MgCl2, 0.1 mg/ml BSA, 5 mM DTT and 0.1% Nonidet-P40) for 1 h at 4°C, followed by an additional 1 h incubation with 2 µg of anti-TRF2 mouse monoclonal antibody (Oncogene, cat. OP129). Equilibrated protein A–sepharose suspension was added to each sample, followed by incubation at 4°C for 1 h. Protein A–sepharose beads were collected by centrifugation and the supernatants removed for SDS–PAGE. After the pellet was washed three times with binding buffer, bound proteins were eluted by boiling the beads in binding buffer plus 2% SDS, 10% glycerol, 0.1% bromophenol blue (0.1%), and 350 mM ß-mercaptoethanol for 5 min. Proteins in the supernatant and pellet were separated by SDS–PAGE and detected by western blotting using rabbit anti-TRF2 (Santa Cruz, cat. Sc-9143), rabbit anti-BLM (Novus Biologicals, cat. NB100-161) and donkey anti-rabbit-HRP conjugated antibodies followed by ECL detection (Amersham Pharmacia). In vitro immunoprecipitation with goat anti-TRF1 antibody (Santa Cruz, cat. sc-6165) was performed as mentioned earlier, utilizing purified BLM (500 ng) and [35S]-labeled TRF1 made by IVTT (20 µl of a 50 µl IVTT reaction). BLM was detected by western blotting as described earlier. The portion of the SDS–PAGE gel containing the [35S]-labeled TRF1 was dried and analyzed by autoradiography.

ELISA assay for detecting TRF1–BLM interaction
This assay was performed using standard techniques (35,47) with the following modifications. Briefly, purified recombinant BLM was diluted to 2.5 ng/µl in carbonate binding-buffer (0.016 M Na2CO3, 0.034 M NaHCO3 pH 9.6). An aliquot of 50 µl (125 ng) was added to individual wells of a 96-well microtiter plate and allowed to bind overnight at 4°C. In the same manner, BSA was bound to wells as a negative control, and TRF1 (0.25 ng/µl) was bound as a positive control. Plates were washed three times with PBST (PBS with 0.5% Tween-20) and blocked in blocking buffer (PBS with 0.5% Tween-20 and 3% BSA) for 2 h at 30°C. Plates were washed once more in blocking buffer prior to addition of TRF1 (varying concentrations 0.25 to 1.5 ng/µl) diluted in binding buffer (50 mM Tris–HCl pH 7.4, 5 mM MgCl2, 5 mM ATP, 100 µg/ml BSA, 50 NaCl). TRF1 was incubated in plates for 1 h at 30°C. Where indicated, 10 U DNase I (Roche, cat. 766 785) were added to wells with TRF1. Plates were vigorously washed with wash buffer five times to remove unbound TRF1 from wells. TRF1 (bound fraction) was detected using anti-TRF1 antibody (Santa Cruz, cat. sc-6165) which was diluted 1 : 1000 in blocking buffer and incubated at room temperature for 1 h. Unbound primary antibody was removed by three washes with wash buffer. Horseradish peroxidase-conjugated rabbit anti-goat antibody (Calbiochem, cat. 4015014) diluted 1 : 10 000 was added to each well and incubated at room temperature for 1 h. Unbound secondary antibody was removed by three washes with wash buffer. Excess liquid was removed completely by tapping plates upside down before addition of 50 µl TACS-sapphire detection reagent (Trevigen). After incubation for 10 min in the dark, reactions were stopped by equal volume of 0.2 N HCl. Absorbance was read at 490 nm and all values were corrected based on background found in reactions containing no primary and secondary antibody.

DNA substrates
Telomeric D-loop substrate was prepared by a two-step method as described previously (48). Oligonucleotides were purchased from Integrated DNA Technologies (Coralville, IA, USA) and Operon (Alameda, CA, USA). Oligonucleotides (sequences in 5'–3' orientation) used to generate the D-loop-like substrate were the partially complementary G80BUB21 (AGCTCCTAGGGTTACAAGCTTCACTAGGGTTGTCCAGTCACAGTCAGAGTCACAGTCCTACACATGTAGGGTTGATCAGC) and C80 (GCTGATCAACCCTACATGTGTAGGTAACCCTAACCCTAACCCTAAGGACAACCCTAGTGAAGCTTGTAACCCTAGGAGCT), as well as the A15G21 invading strand (AAAAAAAAAAAAAAATTAGGGTTAGGGTTAGGGTTA). Either C80 or G80BUB21 was radiolabeled at its 5'-terminus with [{gamma}-32P]ATP and T4 polynucleotide kinase prior to annealing. The telomeric 3'-overhang substrate was created by annealing two oligomers, a 38 mer (T38: 5'-CCCTAACCCTAACCCTAACCCTAGAGGGAAAGGAAGAA-3') and a 68 mer (T68: 5'-TTCTTCCTTTCCCTCTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-3'). The non-telomeric 3'-overhang substrate was created by annealing a 38 mer (NT38: 5'-ATGAGAAGCAGCCGTATCAGGAAGAGGGAAAGGAAGAA-3') to a 68 mer (NT68: 5'-TTCTTCCTTTCCCTCTTCCTGATACGGCTGCTTCTCATCTACAACGTGATCCGTCATGGTTCGGAGTG-3'). Before annealing, T38 and NT38 oligonucleotides were radiolabeled at its 5'-terminus with [{gamma}-32P]ATP and T4 polynucleotide kinase using standard methods. Oligos were annealed by heating to 95°C for 3 min and slow cooling to 25°C. Annealed substrates were purified from a 4% agarose gel followed by ethanol precipitation.

Helicase assays
DNA substrate (3.5 fmol) was incubated with BLM in helicase buffer (final 1x buffer concentration of 20 mM Tris–HCl pH 7.5, 2 mM MgCl2, 0.1 mg/ml BSA and 1 mM DTT) in 50 µl volume for 15 min at 37°C in the presence of ATP (2 mM). In reactions with both BLM and TRF1 or TRF2, substrate was first incubated either with TRF1 or TRF2 for 5 min on ice followed by addition of BLM and an additional incubation at 37°C for 15 min in 50 µl of helicase buffer. Reactions were stopped with one-sixth volume of helicase stop dye (30% glycerol, 50 mM EDTA, 0.9% SDS, 0.25% bromophenol blue and 0.25% xylene cyanol). The DNA products were separated on non-denaturing polyacrylamide (8 or 12%) gels and analyzed using a Storm 860 Phosphorimager and ImageQuant software. For telomeric D-loop substrate, unwinding was assessed by conversion of D-loop to bubble substrate caused by the displacement of the invading strand. For telomeric and non-telomeric 3' overhang substrates, unwinding was assessed by conversion of duplexed substrate to single-stranded oligo. For each reaction, percentage unwinding was determined by comparing the amount of bubble substrate or single-strand oligo produced to the total amount of substrate (D-loop plus bubble or duplexed substrate) in the reaction, after correcting for small amounts of (unannealed) substrate in untreated controls.


    SUPPLEMENTARY MATERIAL
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Supplementary Material is available at HMG Online.


    ACKNOWLEDGEMENTS
 
We thank Drs Titia de Lange, Ian Hickson, Eric Knudsen, Richard Kolodner, Andrew Lowy, Steve Matson, Yolanda Sanchez and James Wang for experimental reagents, and Dr George Babcock and Sandy Schwemberger for help in flow cytometry experiments. We also thank Jonathon Henning and Alison Best for laboratory assistance, and Drs Kathy Heppner Goss and Carolyn Price for insightful discussion during manuscript preparation. J.G. is an Investigator with the Howard Hughes Medical Institute. This work was supported by the National Institutes of Health (G.L.) CA59268-06A1, the Center for Environmental Genetics (J.G.) ES06096, the Ellison Medical Foundation (D.O.) NS-008900 and the Albert J. Ryan Foundation (K.L.-W.).


    FOOTNOTES
 
* To whom correspondence should be addressed at: Department of Molecular Genetics, Biochemistry and Microbiology, Howard Hughes Medical Institute, University of Cincinnati College of Medicine, 231 Albert Sabin Way, Cincinnati, OH 45267-0524, USA. Tel: +1 5135580088; Email: joanna.groden{at}uc.edu


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 

  1. Broccoli, D., Smogorzewska, A., Chong, L. and de Lange, T. (1997) Human telomeres contain two distinct Myb-related proteins, TRF1 and TRF2. Nat. Genet., 17, 231–235.[CrossRef][Web of Science][Medline]

  2. Smucker, E.J. and Turchi, J.J. (2001) TRF1 inhibits telomere C-strand DNA synthesis in vitro. Biochemistry, 40, 2426–2432.[CrossRef][Medline]

  3. Griffith, J., Bianchi, A. and de Lange, T. (1998) TRF1 promotes parallel pairing of telomeric tracts in vitro. J. Mol. Biol., 278, 79–88.[CrossRef][Web of Science][Medline]

  4. Karlseder, J., Smogorzewska, A. and de Lange, T. (2002) Senescence induced by altered telomere state, not telomere loss. Science, 295, 2446–2449.[Abstract/Free Full Text]

  5. Karlseder, J., Broccoli, D., Dai, Y., Hardy, S. and de Lange, T. (1999) p53- and ATM-dependent apoptosis induced by telomeres lacking TRF2. Science, 283, 1321–1325.[Abstract/Free Full Text]

  6. Smogorzewska, A., van Steensel, B., Bianchi, A., Oelmann, S., Schaefer, M.R., Schnapp, G. and de Lange, T. (2000) Control of human telomere length by TRF1 and TRF2. Mol. Cell. Biol., 20, 1659–1668.[Abstract/Free Full Text]

  7. Griffith, J.D., Comeau, L., Rosenfield, S., Stansel, R.M., Bianchi, A., Moss, H. and de Lange. T. (1999) Mammalian telomeres end in a large duplex loop. Cell, 97, 503–514.[CrossRef][Web of Science][Medline]

  8. Stansel, R.M., de Lange, T. and Griffith, J.D. (2001) T-loop assembly in vitro involves binding of TRF2 near the 3' telomeric overhang. EMBO J., 20, 5532–5540.[CrossRef][Web of Science][Medline]

  9. Lundblad, V. (2002) Telomere maintenance without telomerase. Oncogene, 21, 522–531.[CrossRef][Web of Science][Medline]

  10. Wright, W.E., Piatyszek, M.A., Rainey, W.E., Byrd, W. and Shay, J.W. (1996) Telomerase activity in human germline and embryonic tissues and cells. Dev. Genet., 18, 173–179.[CrossRef][Web of Science][Medline]

  11. Shay, J.W. and Wright, W.E. (1996) Telomerase activity in human cancer. Curr. Opin. Oncol., 8, 66–71.[Medline]

  12. Dunham, M.A., Neumann, A.A., Fasching, C.L. and Reddel, R.R. (2000) Telomere maintenance by recombination in human cells. Nat. Genet., 26, 447–450.[CrossRef][Web of Science][Medline]

  13. Lundblad, V. and Blackburn, E.H. (1993) An alternative pathway for yeast telomere maintenance rescues est1-senescence. Cell, 73, 347–360.[CrossRef][Web of Science][Medline]

  14. Bryan, T.M., Englezou, A., Gupta, J., Bacchetti, S. and Reddel, R.R. (1995) Telomere elongation in immortal human cells without detectable telomerase activity. EMBO J., 14, 4240–4248.[Web of Science][Medline]

  15. Bryan, T.M., Englezou, A., Dalla-Pozza, L., Dunham, M.A. and Reddel, R.R. (1997) Evidence for an alternative mechanism for maintaining telomere length in human tumors and tumor-derived cell lines. Nat. Med., 3, 1271–1274.[CrossRef][Web of Science][Medline]

  16. Teng, S.C. and Zakian, V.A. (1999) Telomere–telomere recombination is an efficient bypass pathway for telomere maintenance in Saccharomyces cerevisiae. Mol. Cell. Biol., 19, 8083–8093.[Abstract/Free Full Text]

  17. Le, S., Moore, J.K., Haber, J.E. and Greider, C.W. (1999) RAD50 and RAD51 define two pathways that collaborate to maintain telomeres in the absence of telomerase. Genetics, 152, 143–152.[Abstract/Free Full Text]

  18. Cohen, H. and Sinclair, D.A. (2001) Recombination-mediated lengthening of terminal telomeric repeats requires the Sgs1 DNA helicase. Proc. Natl Acad. Sci. USA, 98, 3174–3179.[Abstract/Free Full Text]

  19. Johnson, F.B., Marciniak, R.A., McVey, M., Stewart, S.A., Hahn, W.C. and Guarente, L. (2001) The Saccharomyces cerevisiae WRN homolog Sgs1p participates in telomere maintenance in cells lacking telomerase. EMBO J., 20, 905–913.[CrossRef][Web of Science][Medline]

  20. Huang, P., Pryde, F.E., Lester, D., Maddison, R.L., Borts, R.H., Hickson, I.D. and Louis, E.J. (2001) SGS1 is required for telomere elongation in the absence of telomerase. Curr. Biol., 11, 125–129.[CrossRef][Web of Science][Medline]

  21. Yeager, T.R., Neumann, A.A., Englezou, A., Huschtscha, L.I., Noble, J.R. and Reddel, R.R. (1999) Telomerase-negative immortalized human cells contain a novel type of promyelocytic leukemia (PML) body. Cancer Res., 59, 4175–4179.[Abstract/Free Full Text]

  22. Kass-Eisler, A. and Greider, C.W. (2000) Recombination in telomere-length maintenance. Trends Biochem. Sci., 25, 200–204.[CrossRef][Web of Science][Medline]

  23. Grobelny, J.V., Godwin, A.K. and Broccoli, D. (2000) ALT-associated PML bodies are present in viable cells and are enriched in cells in the G(2)/M phase of the cell cycle. J. Cell Sci., 113, 4577–4585.[Abstract]

  24. Wu, G., Lee, W.H. and Chen, P.L. (2000) NBS1 and TRF1 colocalize at promyelocytic leukemia bodies during late S/G2 phases in immortalized telomerase-negative cells. Implication of NBS1 in alternative lengthening of telomeres. J. Biol. Chem., 275, 30618–30622.[Abstract/Free Full Text]

  25. German, J. (1993) Bloom syndrome: a mendelian prototype of somatic mutational disease. Medicine (Baltimore), 72, 393–406.[Medline]

  26. Ellis, N.A., Groden, J., Ye, T.Z., Straughen, J., Lennon, D.J., Ciocci, S., Proytcheva, M. and German, J. (1995) The Bloom's syndrome gene product is homologous to RecQ helicases. Cell, 83, 655–666.[CrossRef][Web of Science][Medline]

  27. German, J., Schonberg, J., Louie, E. and Chaganti, R.S. (1977) Bloom's syndrome. IV. Sister-chromatid exchanges in lymphocytes. Am. J. Hum. Genet., 29, 248–255.[Web of Science][Medline]

  28. Karow, J.K., Constantinou, A., Li, J.L., West, S.C. and Hickson, I.D. (2000) The Bloom's syndrome gene product promotes branch migration of Holliday junctions. Proc. Natl Acad. Sci. USA, 97, 6504–6508.[Abstract/Free Full Text]

  29. Sun, H., Karow, J.K., Hickson, I.D. and Maizels. N. (1998) The Bloom's syndrome helicase unwinds G4 DNA. J. Biol. Chem., 273, 27587–27592.[Abstract/Free Full Text]

  30. van Brabant, A.J., Ye, T., Sanz, M., German, J., Ellis, N.A. and Holloman, W.K. (2000) Binding and melting of D-loops by the Bloom syndrome helicase. Biochemistry, 39, 14617–14625.[CrossRef][Medline]

  31. Mohaghegh, P., Karow, J.K., Brosh, R.M. Jr, Bohr, V.A. and Hickson, I.D. (2001) The Bloom's and Werner's syndrome proteins are DNA structure-specific helicases. Nucl. Acids Res., 29, 2843–2849.[Abstract/Free Full Text]

  32. Acevedo, O.L., Dickinson, L.A., Macke, T.J. and Thomas, C.A., Jr (1991) The coherence of synthetic telomeres. Nucl. Acids Res., 19, 3409–3419.[Abstract/Free Full Text]

  33. Yankiwski, V., Marciniak, R.A., Guarente, L. and Neff, N.F. (2000) Nuclear structure in normal and Bloom syndrome cells. Proc. Natl Acad. Sci. USA, 97, 5214–5219.[Abstract/Free Full Text]

  34. Stavropoulos, D.J., Bradshaw, P.S., Li, X., Pasic, I., Truong, K., Ikura, M., Ungrin, M. and Meyn, M.S. (2002) The Bloom syndrome helicase BLM interacts with TRF2 in ALT cells and promotes telomeric DNA synthesis. Hum. Mol. Genet., 11, 3135–3144.[Abstract/Free Full Text]

  35. Opresko, P.L., Von Kobbe, C., Laine, J.P., Harrigan, J., Hickson, I.D. and Bohr, V.A. (2002) Telomere binding protein TRF2 binds to and stimulates the Werner and Bloom syndrome helicases. J. Biol. Chem., 43, 41110–41119.

  36. Schawalder, J., Paric, E. and Neff, N.F. (2003) Telomere and ribosomal DNA repeats are chromosomal targets of the Bloom syndrome DNA helicase. BMC Cell Biol., 4, 15.[CrossRef][Medline]

  37. Blasco, M.A., Lee, H.W., Hande, M.P., Samper, E., Lansdorp, P.M., DePinho, R.A. and Greider, C.W. (1997) Telomere shortening and tumor formation by mouse cells lacking telomerase RNA. Cell, 91, 25–34.[CrossRef][Web of Science][Medline]

  38. MacEachern, E. and Iyer, B. (2001) Short telomeres in yeast are highly recombinogenic. Mol. Cell., 7, 695–704.[CrossRef][Web of Science][Medline]

  39. Zhu, X.D., Kuster, B., Mann, M., Petrini, J.H. and Lange, T. (2000) Cell-cycle-regulated association of RAD50/MRE11/NBS1 with TRF2 and human telomeres. Nat. Genet., 25, 347–352.[CrossRef][Web of Science][Medline]

  40. Bianchi, A., Smith, S., Chong, L., Elias, P. and de Lange, T. (1997) TRF1 is a dimer and bends telomeric DNA. EMBO J., 16, 1785–1794.[CrossRef][Web of Science][Medline]

  41. Bianchi, A., Stansel, R.M., Fairall, L., Griffith, J.D., Rhodes, D. and de Lange, T. (1999) TRF1 binds a bipartite telomeric site with extreme spatial flexibility. EMBO J., 18, 5735–5744.[CrossRef][Web of Science][Medline]

  42. Smith, S. and de Lange, T. (2000) Tankyrase promotes telomere elongation in human cells. Curr. Biol., 10, 1299–1302.[CrossRef][Web of Science][Medline]

  43. Chang, W., Dynek, J.N. and Smith, S. (2003) TRF1 is degraded by ubiquitin-mediated proteolysis after release from telomeres. Genes Dev., 17, 1328–1333.[Abstract/Free Full Text]

  44. Langland, G., Kordich, J., Creaney, J., Goss, K.H., Lillard-Wetherell, K., Bebenek, K., Kunkel, T.A. and Groden, J. (2001) The Bloom's syndrome protein (BLM) interacts with MLH1 but is not required for DNA mismatch repair. J. Biol. Chem., 276, 30031–30035.[Abstract/Free Full Text]

  45. Karow, J.K., Chakraverty, R.K. and Hickson, I.D. (1997) The Bloom's syndrome gene product is a 3'–5' DNA helicase. J. Biol. Chem., 272, 30611–30614.[Abstract/Free Full Text]

  46. Austin, C.A., Marsh, K.L., Wasserman, R.A., Willmore, E., Sayer, P.J., Wang, J.C. and Fisher, L.M. (1995) Expression, domain structure, and enzymatic properties of an active recombinant human DNA topoisomerase II beta. J. Biol. Chem., 270, 15739–15746.[Abstract/Free Full Text]

  47. Brosh, R.M., Jr, Li, J.L., Kenny, M.K., Karow, J.K., Cooper, M.P., Kureekattil, R.P., Hickson, I.D. and Bohr, V.A. (2000) Replication protein A physically interacts with the Bloom's syndrome protein and stimulates its helicase activity. J. Biol. Chem., 275, 23500–23508.[Abstract/Free Full Text]

  48. Orren, D.K., Theodore, S. and Machwe, A. (2002) The Werner syndrome helicase/exonuclease (WRN) disrupts and degrades D-loops in vitro. Biochemistry, 41, 13483–13488.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. Bhattacharyya, J. Keirsey, B. Russell, J. Kavecansky, K. Lillard-Wetherell, K. Tahmaseb, J. J. Turchi, and J. Groden
Telomerase-associated Protein 1, HSP90, and Topoisomerase II{alpha} Associate Directly with the BLM Helicase in Immortalized Cells Using ALT and Modulate Its Helicase Activity Using Telomeric DNA Substrates
J. Biol. Chem., May 29, 2009; 284(22): 14966 - 14977.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
Q. Fan, F. Zhang, B. Barrett, K. Ren, and P. R. Andreassen
A role for monoubiquitinated FANCD2 at telomeres in ALT cells
Nucleic Acids Res., April 1, 2009; 37(6): 1740 - 1754.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
N. Selak, C. Z. Bachrati, I. Shevelev, T. Dietschy, B. van Loon, A. Jacob, U. Hubscher, J. D. Hoheisel, I. D. Hickson, and I. Stagljar
The Bloom's syndrome helicase (BLM) interacts physically and functionally with p12, the smallest subunit of human DNA polymerase {delta}
Nucleic Acids Res., September 1, 2008; 36(16): 5166 - 5179.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
R. M. Brosh Jr and V. A. Bohr
Human premature aging, DNA repair and RecQ helicases
Nucleic Acids Res., December 3, 2007; 35(22): 7527 - 7544.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
V. A. Rao, C. Conti, J. Guirouilh-Barbat, A. Nakamura, Z.-H. Miao, S. L. Davies, B. Sacca, I. D. Hickson, A. Bensimon, and Y. Pommier
Endogenous {gamma}-H2AX-ATM-Chk2 Checkpoint Activation in Bloom's Syndrome Helicase Deficient Cells Is Related to DNA Replication Arrested Forks
Mol. Cancer Res., July 1, 2007; 5(7): 713 - 724.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Fouche, A. J. Cesare, S. Willcox, S. Ozgur, S. A. Compton, and J. D. Griffith
The Basic Domain of TRF2 Directs Binding to DNA Junctions Irrespective of the Presence of TTAGGG Repeats
J. Biol. Chem., December 8, 2006; 281(49): 37486 - 37495.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
N. Fouche, S. Ozgur, D. Roy, and J. D. Griffith
Replication fork regression in repetitive DNAs
Nucleic Acids Res., November 6, 2006; 34(20): 6044 - 6050.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
T. Sekiguchi, T. Hayano, M. Yanagida, N. Takahashi, and T. Nishimoto
NOP132 is required for proper nucleolus localization of DEAD-box RNA helicase DDX47
Nucleic Acids Res., September 11, 2006; 34(16): 4593 - 4608.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. P. Killoran and J. L. Keck
Sit down, relax and unwind: structural insights into RecQ helicase mechanisms
Nucleic Acids Res., September 10, 2006; 34(15): 4098 - 4105.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. S. O'Connor, A. Safari, H. Xin, D. Liu, and Z. Songyang
A critical role for TPP1 and TIN2 interaction in high-order telomeric complex assembly
PNAS, August 8, 2006; 103(32): 11874 - 11879.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Azam, J. Y. Lee, V. Abraham, R. Chanoux, K. A. Schoenly, and F. B. Johnson
Evidence that the S.cerevisiae Sgs1 protein facilitates recombinational repair of telomeres during senescence
Nucleic Acids Res., January 20, 2006; 34(2): 506 - 516.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Muftuoglu, H. K. Wong, S. Z. Imam, D. M. Wilson III, V. A. Bohr, and P. L. Opresko
Telomere Repeat Binding Factor 2 Interacts with Base Excision Repair Proteins and Stimulates DNA Synthesis by DNA Polymerase {beta}
Cancer Res., January 1, 2006; 66(1): 113 - 124.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. L. Opresko, P. A. Mason, E. R. Podell, M. Lei, I. D. Hickson, T. R. Cech, and V. A. Bohr
POT1 Stimulates RecQ Helicases WRN and BLM to Unwind Telomeric DNA Substrates
J. Biol. Chem., September 16, 2005; 280(37): 32069 - 32080.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Lillard-Wetherell, K. A. Combs, and J. Groden
BLM Helicase Complements Disrupted Type II Telomere Lengthening in Telomerase-Negative sgs1 Yeast
Cancer Res., July 1, 2005; 65(13): 5520 - 5522.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow All Versions of this Article:
13/17/1919    most recent
ddh193v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (30)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lillard-Wetherell, K.
Right arrow Articles by Groden, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lillard-Wetherell, K.
Right arrow Articles by Groden, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?