Skip Navigation


Human Molecular Genetics Advance Access originally published online on August 27, 2004
Human Molecular Genetics 2004 13(20):2361-2368; doi:10.1093/hmg/ddh273
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow All Versions of this Article:
13/20/2361    most recent
ddh273v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (46)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Capon, F.
Right arrow Articles by Trembath, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Capon, F.
Right arrow Articles by Trembath, R. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, Vol. 13, No. 20 © Oxford University Press 2004; all rights reserved

A synonymous SNP of the corneodesmosin gene leads to increased mRNA stability and demonstrates association with psoriasis across diverse ethnic groups

Francesca Capon1, Michael H. Allen2, Mahreen Ameen2, A. David Burden3, David Tillman3, Jonathan N. Barker2 and Richard C. Trembath1,*

1Department of Genetics, University of Leicester, Leicester LE1 7RH, UK, 2St John's Institute of Dermatology, King's College, London SE1 7EH, UK and 3Department of Dermatology, Western Infirmary, Glasgow G11 6NT, UK

Received April 5, 2004; Revised July 8, 2004; Accepted August 19, 2004


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Psoriasis is a chronic skin disorder with multifactorial aetiology. Genome-wide scans have provided unambiguous evidence for a major disease susceptibility locus on chromosome 6p21 (PSORS1). A minimal PSORS1 interval has been defined which encompasses three genes (HLA-C, HCR and CDSN) carrying psoriasis-associated SNPs. On the basis of this genetic evidence, we have undertaken an assessment of CDSN allele functional impact. A comparison of CDSN intragenic haplotypes showed that SNPs exclusive to disease-associated chromosomes are located in regions implicated in the stabilization of RNA transcripts. As CDSN is over-expressed in psoriatic lesions, we hypothesised that disease-associated intragenic SNPs may alter the rate of its mRNA decay. Here, we demonstrate that mRNAs transcribed from a CDSN risk haplotype present a 2-fold increase in stability, compared with those transcribed from a neutral haplotype (t-test P=0.004). Site-directed mutagenesis revealed that a single synonymous SNP (CDSN*971T) accounts for the observed increase in RNA stability. CDSN*971T maps to a RNA stability motif and UV cross-linking analysis demonstrated that the SNP affects the transcript affinity for a 39 kDa RNA binding protein. Association analyses show that haplotypes bearing CDSN*971T confer psoriasis susceptibility in a wide range of ethnic groups. These results demonstrate the effect of synonymous variation upon allele specific gene expression, a finding of relevance to future studies of the pathogenesis of common and complex traits.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Psoriasis is an inflammatory skin disorder characterized by disruption of keratinocyte terminal differentiation and premature desquamation of the stratum corneum (1). The disease is inherited as a multifactorial trait, with at least nine disease susceptibility loci (PSORS1-9) identified by independent genome-wide scans (2,3). Of these, the PSORS1 region on chromosome 6p21 may account for up to 50% of psoriasis familial clustering (2,3). Linkage disequilibrium (LD) based fine mapping of PSORS1 has highlighted a consensus minimal interval, spanning 200 kb of the major histocompatibility complex (MHC) class I region (47). Genetic analyses of the eight transcripts contained within the refined PSORS1 interval (reviewed in 8) have identified psoriasis-associated SNPs in the HLA-C (HLA-Cw6 allele), {alpha}-helix coiled coil rod homolog (HCR*WWCC) and corneodesmosin (CDSN*TTC) genes (912).

The CDSN gene encodes the only PSORS1 transcript to be specifically expressed in terminally differentiated keratinocytes (13,14). Its product, the adhesive protein corneodesmosin, localizes to the modified desmosomes that ensure the intercellular cohesion of keratinocytes (13,14). The serine and glycine rich terminal domains of corneodesmosin are essential for cell adhesion and are sequentially cleaved during the process of skin desquamation (13,14). Thus CDSN represents an attractive positional and biological candidate for psoriasis susceptibility.

Genetic analyses have identified a cluster of three intragenic CDSN haplotypes showing significant disease association in diverse ethnic groups (1518). These findings have been validated in both case–control (15,16,18) and family-based datasets (17), yet their interpretation remains controversial, due, at least in part, to the confounding effect of LD conservation across the MHC (8). In this context, CDSN associations have often been ascribed to LD with HLA-C alleles (16,18), which have been more frequently analysed as markers of disease risk (912).

We have previously generated a dense SNP map (1 SNP per 3.5 kb) of the PSORS1 interval that we used as a framework to derive ancestral risk haplotypes segregating in populations of north-European descent (7,17). The analysis of 59 SNPs spanning the 200 kb PSORS1 minimal interval identified two distinct association peaks mapping to the HLA-C and CDSN genomic regions (7). Haplotype analysis revealed a cluster of rare risk chromosomes likely to have originated from recombination events which had removed HCR*WWCC, whilst preserving HLA-Cw6 and CDSN*TTC on either side (7,17). The occurrence of these putative recombinant risk chromosomes was also confirmed in a psoriatic population of Indian descent (7,17). Altogether, these observations argue against the hypothesis that association at the CDSN locus is due only to LD with HLA-Cw6 and suggests that both HLA-C and CDSN alleles may contribute to psoriasis susceptibility.

To further explore this hypothesis, we have undertaken an investigation of the functional impact of CDSN alleles. CDSN is an extremely polymorphic gene, with a SNP density approaching 1 : 100 bp (17,19). Coding polymorphisms cause both synonymous and non-synonymous substitutions, as well as deletions of single amino-acids (Table 1; SNP identifiers are reported in Supplementary Material, Table S1). SNPs have also been identified within the putative gene promoter, the single intron and the UTR regions (Table 1). However, the alignment of CDSN common haplotypes (i.e. those accounting for >2% of patient chromosomes) shows that only three SNPs (highlighted in bold in Table 1) are unique to over-transmitted/disease-associated chromosomes. Indeed, the alleles at SNPs 9, 971 and 1675 are shared by risk haplotypes 1.11, 1.21 and 1.41, whereas they are not observed on the under-transmitted/neutral chromosomes designated as 1.52, 2.11 and 2.21 (Table 1). Although none of the these SNPs introduces an amino acid change, two (SNPs 971 and 1675) map to gene regions (i.e. the coding sequence and the 3'-UTR) where the occurrence of SNPs has previously been associated with abnormal RNA stability (20,21). As corneodesmosin is up-regulated in the skin lesions of psoriatic patients (22,23), we hypothesised that CDSN risk alleles may contribute to the gene over-expression by altering the rate of mRNA decay. Using a combination of transfection-based RNA stability assays, site-directed mutagenesis and UV cross-linking, we were able to show that the synonymous SNP CDSN*971T confers altered transcript stability through a diminished affinity for a cytoplasmic RNA binding protein.


View this table:
[in this window]
[in a new window]
 
Table 1. Alignment of CDSN common haplotypesa
 

    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
CDSN risk haplotype 1.21 shows altered RNA stability
In order to establish the impact of psoriasis-associated SNPs on CDSN transcript stability, we compared the decay rate of RNAs transcribed from haplotypes 1.21 (risk bearing) and 1.52 (neutral). To assess transcript stability, we transfected COS7 cell lines with the relevant cDNA clones and quantified CDSN mRNAs before and after incubation with an inhibitor of transcription (i.e. actinomycin D). Figure 1A shows the results that were obtained by semi-quantitative RT–PCR of CDSN transcripts, using the Neo RNA (which is also transcribed from the transfection vector) as an internal control. The analysis of two independent transfection experiments indicated that the relative stability of 1.21 transcripts was almost 2-fold greater than that of Neo mRNAs (1.95xNeo), whereas the relative stability of 1.52 transcripts was only 0.86xNeo (unpaired t-test two-tailed P=0.004). These results were confirmed by northern blot analysis of RNAs from two further transfection experiments (Fig. 1B).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 1. Risk haplotype 1.21 shows altered RNA stability. (A) Relative stability of 1.21 and 1.52 transcripts, as determined by semi-quantitative RT–PCR analysis of two independent transfection experiments. The basal CDSN/Neo value was set as 1 and the relative ratio after actinomycin treatment is shown. The rise in the CDSN/Neo ratio observed for construct 1.21 following actinomycin treatment demonstrates that the transcript is more stable than the Neo mRNA. (B) Northern blot analysis of two further transfection experiments. A representative blot is shown on the left, with – and + symbols, respectively, denoting RNAs extracted before and after treatment with Actinomycin D. T indicates RNA extracted from non-transfected cells. The mean CDSN/Neo values obtained following to densitometric analysis of the two blots are plotted on the right.

 
CDSN*971T is necessary and sufficient to confer altered mRNA stability
We next sought to identify the CDSN variant(s) accounting for the observed increase in 1.21 mRNA stability. Our constructs encompassed both the CDSN coding region and the 3'-UTR (nt 15–1986), so that the transfected 1.21 and 1.52 cDNAs were carrying divergent alleles at both nucleotides 971 and 1675 (nucleotide 9 maps to the 5'-UTR, hence it was not included in our constructs and could not have accounted for the altered RNA stability). To investigate the impact of these two SNPs, we used site-directed mutagenesis to modify the corresponding nucleotides in 1.21 cDNAs. Figure 2A shows the results that were obtained by semi-quantitative RT–PCR analysis of these modified transcripts. The relative stability of 1.21 mRNAs was not affected by the substitution of nucleotide 1675. In contrast, the mutagenesis of nucleotide 971 had a dramatic effect, reducing the relative mRNA stability by >50% (1.21 stability: 1.95xNeo; 971mut stability: 0.68xNeo; two-tailed P=0.0008). These results were confirmed by northern blot analysis of RNAs from two further independent transfection experiments (Fig. 2B). The 1.21 haplotypes carrying both the 971 and the 1675 substitution, did not display any further decrease in RNA stability (data not shown).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 2. CDSN*971T accounts for the increase in RNA stability. (A) Relative stability of 1.21 transcripts bearing mutations of nucleotides 971 and 1675, as determined by semi-quantitative RT–PCR analysis of two independent transfection experiments. The basal CDSN/Neo value was set as 1 and the relative ratio after actinomycin treatment is shown. The rise in the CDSN/Neo ratio observed for construct 1675mut, following actinomycin treatment, demonstrates that the transcript is more stable than the Neo mRNA. (B) Northern blot analysis of two further transfection experiments. A representative blot is shown on the left, with – and + symbols, respectively, denoting RNAs extracted before and after treatment with actinomycin D. The mean CDSN/Neo values obtained following densitometric analysis of the two blots are plotted on the right.

 
In order to assess whether RNAs transcribed from haplotypes bearing CDSN*971T present an increase in their steady-state levels in vivo, we examined the endogenous CDSN mRNAs from the non-tumorigenic HaCaT keratinocyte cell line. Figure 3 shows the results of semi-quantitative PCR carried out on HaCaT genomic DNA and cDNA. The cell line is heterozygous for SNP 971 and both alleles are transcribed as shown by HaeIII restriction analysis. Densitometric analysis of duplicated experiments revealed that haplotypes bearing 971T account for only 17% of CDSN genomic DNA, but represent 36% of the cDNA [the deviation from the 1 : 1 allele ratio in genomic DNA is due to the co-existence of several chromosome populations within the cell line (24)].



View larger version (36K):
[in this window]
[in a new window]
 
Figure 3. Semi-quantitative RT–PCR analysis of HaCaT endogenous CDSN transcripts. cDNAs bearing CDSN*971T were identified by HaeIII restriction of RT–PCR products. 1, restriction control; 2 and 3, HaCaT cDNA; 4 and 5, HaCaT genomic DNA; 6, RT.

 
CDSN*971T decreases the affinity for a cytoplasmic RNA binding protein
To explore the mechanisms whereby CDSN*971T influences RNA decay, we compared the sequence surrounding the SNP with that of known stability determinants lying within coding regions (25). The alignment illustrated in Figure 4A shows that the sequence immediately upstream SNP971 closely matches the consensus for the mRNA stability/instability motifs that overlap the binding sites for cytoplasmic RNA binding proteins (25). To assess whether CDSN*971T affects the interaction with any such protein, we carried out UV cross-linking analysis to compare the efficiency with which cytoplasmic HaCaT proteins bind to RNA probes carrying different SNP971 alleles. Figure 4B shows that both CDSN alleles bind a cytoplasmic protein with an approximate molecular weight of 39kDa. Figure 4C illustrates an autoradiograph representative of two independent competition assays where increasing amounts of either unlabelled probe were added to the UV cross-linking reaction containing labelled 971T RNAs. These experiments showed that unlabelled RNAs carrying allele 971C compete with the radioactive probe more efficiently than those carrying allele 971T (Fig. 4C). The same results were obtained in two further competition assays where 971C RNA was used as the labelled probe (data not shown). Taken together, these observations suggest that allele 971T has a diminished affinity for the 39 kDa RNA-binding protein.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 4. CDSN*971T affects the interaction with a RNA binding protein. (A) Alignment of CDSN nucleotides 960–973 with the sequences of previously characterized mRNA stability/instability motifs. Horizontal arrows indicate the localization of the cytoplasmic protein binding sites which overlap with the stability motifs. The grey vertical arrow indicates the position of nucleotide 971. (B) UV cross-linking analysis of RNA probes carrying either 971T or 971C alleles. The figures above the lane indicate amounts (µg) of cytoplasmic cell extract that were incubated with the probe. (C) UV cross-linking competition assay using unlabelled RNA probes carrying either 971C or 971T alleles. The figures above the lanes indicate the fold excess of unlabelled probe. (D) The results obtained following densitometric analysis of two independent experiment are plotted on the right, with the intensity of the complex in the first lane (no competitor added) set as 1.

 
CDSN*971T displays highly significant disease association on diverse HLA-C backgrounds
As SNP971 does not introduce any amino acid substitution, it has not been investigated as extensively as CDSN non-conservative variants. To characterize the association at this locus, we have, therefore examined a dataset including 171 cases and 90 controls. {chi}2 analysis confirmed that CDSN*971T is significantly associated with psoriasis (P=5.3x10–6), yielding an odd ratio of 2.52 (95% CI: 1.68<OR<3.78). To investigate the relationship between CDSN*971T and HLA-Cw6 associations, we reviewed published studies of CDSN and HLA-C alleles. As shown in Table 2, CDSN*971T can be found on ancestral MHC chromosomes that carry non-Cw6 HLA-C alleles.


View this table:
[in this window]
[in a new window]
 
Table 2. CDSN haplotypes bearing CDSN*971T are associated with psoriasis on the background of distinct MHC ancestral chromosomesa
 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Associations between CDSN alleles and psoriasis susceptibility have been repeatedly described (reviewed in 8), however, their interpretation has been compounded by the high polymorphism content of the gene (i.e. different SNPs have often been examined by different groups) and the proximity to HLA-Cw6. We have previously generated genetic data indicating that CDSN association may not be secondary to LD with HLA-Cw6 (7,17). Here, we provide the first evidence for a functional impact of a psoriasis-associated CDSN allele. Using transfection based stability assays and site-directed mutagenesis, we were able to show that CDSN*971T confers abnormal RNA stability to CDSN transcripts. We also observed differential over-expression of haplotypes bearing CDSN*971T in the spontaneously immortalized HaCaT keratinocyte cell line. Despite having a destabilized karyotype that generates variant cell populations (24), HaCaT lines closely resemble normal keratinocytes in their growth and differentiation characteristics (24,26), so that they are widely used as model system for the study of this cell type. Conversely, the amount of skin that is sampled in biopsy procedures would not allow an analysis of CDSN transcripts, given the low expression levels of the gene in normal keratinocytes (22,23).

The sequence immediately upstream of SNP971 closely matches the consensus for the stability/instability motifs, which overlap with the binding sites for cytoplasmic proteins involved in RNA metabolism (25). Our UV cross-linking analysis indicated that the CDSN*971T affects the rate of RNA decay by decreasing the affinity for a 39 kDa cytoplasmic protein. This effect is reminiscent of that obtained through the disruption of the PAI-2 mRNA instability motif, which results in a significant increase in transcript stability (25).

A recent study has shown that up to 50% of human genes with coding SNPs can present allelic variation in gene expression (27). In this context, the alteration of RNA instability motifs may well prove to be a more general phenomenon than previously thought.

We have previously generated evidence indicating that association at CDSN may not be accounted for by LD with HLA-Cw6. Our review of recent CDSN genetic studies provides further support for this observation, as it shows that HLA-C alleles other than Cw6 are found on psoriasis-associated chromosomes bearing CDSN*971T. Remarkably, CDSN haplotypes carrying CDSN*971T have been found to be associated with psoriasis in a very diverse range of populations (1518,28). Indeed, a retrospective analysis of the published literature shows that negative association findings have only been obtained (12,29) when the number of SNP that were typed was not sufficient to differentiate risk haplotypes. Such a degree of consistency is uncommon in the study of complex traits and suggests a key role of CDSN variation in the pathogenesis of psoriasis.

Our investigation was limited to the gene coding region and 3'-UTR, so that we cannot exclude the possibility that regulatory SNPs other than CDSN*971T may also contribute to corneodesmosin up-regulation in patients' skin. Likewise, amino acid substitutions encoded by non-synonymous SNPs might also participate to the disease pathogenesis, once the protein has been translated. Thus, our results add to the type of genetic variation underlying common diseases and warrant further investigations of CDSN role in the molecular pathogenesis of psoriasis.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Generation of constructs
The constructs used for transfection-based assays encompassed both the CDSN coding region and the 3'-UTR (nucleotide 15–1986). Primers Eco-CDf (GAATTCATGGGCTCGTCTCGGGCAC) and Not-CDr (GCGGCCGCGGCGTCAGAGGTGCTCTGAG) were used to amplify CDSN haplotypes 1.21 and 1.52 from the cDNA of an heterozygous individual (the skin biopsy used as a RNA source was obtained with patient's informed consent). The resulting 1.21 and 1.52 PCR products were then cloned into a pCI-Neo mammalian expression vector (Promega). Constructs with substitutions at nucleotides 971 and/or 1675 were generated by using the QuikChange site directed mutagenesis kit (Stratagene) to modify the sequence of 1.21 clones. Constructs used for in vitro transcription were generated by amplifying a 300 bp portion of the CDSN gene (nucleotide 831–1131; primers Eco-831F: GAATTCTGTAGCAATGGTGGCCTTCC and Not-831R: GCGGCCGCCACTGGCTGGAACGCAATGG) from the same heterozygous individual and by cloning the resulting PCR products in a pCI-Neo vector. The accuracy of all cloning and mutagenesis procedures was verified by direct sequencing of constructs.

RNA stability assay
Cell cultures and transfection experiments.
COS7 cells were grown in Dulbecco's modified Eagle's medium (DMEM), (Gibco), supplemented with 10% fetal calf serum (FCS) (Gibco), 50 U/ml penicillin and 50 µg/ml streptomycin (Gibco). Cells were transfected with CDSN constructs, using the FuGENE6 Reagent (Roche) at a reagent to DNA ratio of 3 : 1. Forty-eight hours after transfection, 5 µg/ml actinomycin D (Sigma) was added to the medium, and cells were grown for further 24 h, before being harvested. All transfection experiments were carried out in quadruplicate.

Quantification of transcripts.
The RNeasy mini kit (Qiagen) was used to extract total RNA from transfected cells, before and after incubation with actinomycin D. Semi-quantitative RT–PCR was used to analyse two of the four sets of paired RNAs that were obtained for each transfected construct. Following to DNase I (Invitrogen) treatment and reverse transcription, serial cDNA dilutions were amplified for 23 cycles using Eco-CDf (see earlier-mentioned sequence) and CD2p2 (GGTTTAGTATTCCGCGGTAAG) primers. Neo-F (CTGGGCACAACAGACAATCG) and Neo-R (AAGGCGATAGAAGGCGATGC) primers were used to amplify the neomycin cDNA, which was utilized as an internal control. Following to electrophoresis on a 2% agarose gel, images were acquired on a Gene Genius Bio-Imaging System (Syngene) and PCR products were quantified using the Image J software (available at http://rsb.info.nih.gov/ij). The third and fourth sets of paired RNAs were quantified by northern blot analysis. Filters prepared according to standard protocols were sequentially probed with CDSN and Neo PCR products, respectively, obtained using the Eco-CDf/CD2p2 (1.21 and 1.52 alleles share the same sequence along the amplified genomic segment) and Neo-F/Neo-R primer pairs. Following autoradiography on a Cyclone Phosphor Screen (Packard), images were acquired and analysed using a Cyclone Storage Phosphor System (Packard).

Analysis of HaCaT endogenous CDSN transcripts
HaCaT cells were grown in DMEM, supplemented with 10% FCS, 50 U/ml penicillin and 50 µg/ml streptomycin. Following to RNA extraction, 3 µg of total RNA was reverse transcribed and the 3'-UTR of CDSN was amplified using the CD2p9 (GCATGCCTTGGGCACAAACAAGC) and Not-CDr (see earlier-mentioned sequence) primers. RT–PCR product was digested with HaeIII, in order to identify the G allele of SNP1675, which defines all haplotypes bearing CDSN*971T.

UV cross-linking analysis
In-vitro transcription.
In order to generate DNA templates for in vitro transcription, the pCI-Neo vectors containing the 831–1131 region of alleles 1.21 and 1.51 were linearized by NotI restriction. Labelled probes and unlabelled RNA competitors were then obtained by using the Riboprobe in vitro Transcription System (Promega) to incorporate [{alpha}-32P]rUTP (Amersham) and rUTP, respectively. Following phenol/chloroform purification, labelled probes and unlabelled competitors were, respectively, quantified by Cherenkov scintillation and ethidium bromide staining of agarose/formaldehyde gels.

Preparation of cytoplasmic cell extracts.
HaCaT cells harvested at 90% confluence, washed in PBS and incubated for 5 min with 75 µl per 106 cells cytoplasm extraction buffer (10 mM HEPES pH 7.1; 3 mM MgCl; 14 mM KCl; 0.2% Nonidet P-40; 1 mM DTT; 0.5 mM PMSF; 1xRoche Complete Mini Proteinase Inhibitor Cocktail). Following 1 min centrifugation at 1000 G, the supernatant was collected and the protein content was determined using the Biorad Protein Assay (Biorad).

UV-cross-linking.
Cytoplasmic extracts were incubated with 5 µg/µl heparin for 10 min at room temperature, prior to the addition of 2 pmol (3x105 cpm) of labelled probe. For competition assays, 15–60 pmol of unlabelled probe (7.5–30-fold excess) were also added. After 30 min incubation at room temperature, samples were UV cross-linked for 15 min in a UVC 500 crosslinker (Amersham), digested with 200 µg/ml RNase A (Roche) for 20 min at 37°C, and separated on a 10% SDS–PAGE gel. Labelled RNA protein complexes were detected and quantified, using a Cyclone Phosphor Storage System.

Association analysis
One hundred and seventy one UK patients were sampled from a psoriasis family cohort that has been described elsewhere (7). Samples from 90 unrelated healthy controls were obtained from the DNA bank of the Tissue Typing lab, Guys Hospital, UK. Ethical approval and informed consent were obtained from all patients and controls included in this study. Samples were genotyped for the CDSN*971 SNP by hybridization of allele specific oligonucleotides (sequences of probes and PCR primers are reported in Supplementary Material Table S2), as described elsewhere (7). {chi}2 values and odd ratio 95% confidence intervals were computed using the SISA software available at http://home.clara.net/sisa/twoby2.htm.


    SUPPLEMENTARY MATERIAL
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Supplementary Material is available at HMG Online.


    ACKNOWLEDGEMENTS
 
We wish to acknowledge the continued support of the many families affected by psoriasis. We are grateful to Dr Paul Hobby for his helpful comments. F.C. wishes to thank Drs Cristina Tufarelli and Talat Nasim for their expert advice. This research was funded by a Wellcome Trust Travelling Research Fellowship to F.C., a Wellcome Trust Grant to R.C.T. and J.N.B. (056713/Z/99/Z), and a Medical Research Council (MRC) UK Cooperative Group Grant.


    FOOTNOTES
 
* To whom correspondence should be addressed at: Department of Genetics, Adrian Building, University of Leicester, University Road, Leicester LE1 7RH, UK. Tel: +44 1162522269; Fax: +44 1162523378; Email: rtrembat{at}hgmp.mrc.ac.uk


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 

  1. Barker, J.N. (1998) Pathogenesis of psoriasis. J. Dermatol., 25, 778–781.[Medline]

  2. Bowcock, A.M. and Cookson, W.O. (2004) The genetics of psoriasis, psoriatic arthritis and atopic dermatitis. Hum. Mol. Genet., 13 (Suppl. 1), R43–R55.[Abstract/Free Full Text]

  3. The International Psoriasis Genetics Study Consortium (T.I.P.G.) (2003) Assessing linkage to 14 candidate susceptibility loci in a cohort of 942 affected sib pairs. Am. J. Hum. Genet., 73, 430–437.[CrossRef][Medline]

  4. Balendran, N., Clough, R.L., Arguello, J.R., Barber, R., Veal, C., Jones, A.B., Rosbotham, J.L., Little, A.M., Madrigal, A., Barker, J.N. et al. (1999) Characterization of the major susceptibility region for psoriasis at chromosome 6p21.3. J. Invest. Dermatol., 113, 322–328.[CrossRef][Web of Science][Medline]

  5. Oka, A., Tamiya, G., Tomizawa, M., Ota, M., Katsuyama, Y., Makino, S., Shiina, T., Yoshitome, M., Iizuka, M., Sasao, Y. et al. (1999) Association analysis using refined microsatellite markers localizes a susceptibility locus for psoriasis vulgaris within a 111 kb segment telomeric to the HLA-C gene. Hum. Mol. Genet., 8, 2165–2170.[Abstract/Free Full Text]

  6. Nair, R.P., Stuart, P., Henseler, T., Jenisch, S., Chia, N.V., Westphal, E., Schork, N.J., Kim, J., Lim, H.W., Christophers, E. et al. (2000) Localization of psoriasis-susceptibility locus PSORS1 to a 60-kb interval telomeric to HLA-C. Am. J. Hum. Genet., 66, 1833–1844.[CrossRef][Web of Science][Medline]

  7. Veal, C.D., Capon, F., Allen, M.H., Heath, E.K., Evans, J.C., Jones, A., Patel, S., Burden, D., Tillman, D., Barker, J.N. et al. (2002) Family-based analysis using a dense single-nucleotide polymorphism-based map defines genetic variation at PSORS1, the major psoriasis-susceptibility locus. Am. J. Hum. Genet., 71, 554–564.[CrossRef][Web of Science][Medline]

  8. Capon, F., Munro, M., Barker, J. and Trembath, R. (2002) Searching for the major histocompatibility complex psoriasis susceptibility gene. J. Invest. Dermatol., 118, 745–751.[CrossRef][Web of Science][Medline]

  9. Mallon, E., Newson, R. and Bunker, C.B. (1999) HLA-Cw6 and the genetic predisposition to psoriasis: a meta-analysis of published serologic studies. J. Invest. Dermatol., 113, 693–695.[CrossRef][Web of Science][Medline]

  10. Allen, M.H., Veal, C., Faassen, A., Powis, S.H., Vaughan, R.W., Trembath, R.C. and Barker, J.N. (1999) A non-HLA gene within the MHC in psoriasis. Lancet, 353, 1589–1590.[CrossRef][Web of Science][Medline]

  11. Asumalahti, K., Laitinen, T., Itkonen-Vatjus, R., Lokki, M.L., Suomela, S., Snellman, E., Saarialho-Kere, U. and Kere, J. (2000) A candidate gene for psoriasis near HLA-C, HCR (Pg8), is highly polymorphic with a disease-associated susceptibility allele. Hum. Mol. Genet., 9, 1533–1542.[Abstract/Free Full Text]

  12. Asumalahti, K., Veal, C., Laitinen, T., Suomela, S., Allen, M., Elomaa, O., Moser, M., de Cid, R., Ripatti, S., Vorechovsky, I. et al. (2002) Coding haplotype analysis supports HCR as the putative susceptibility gene for psoriasis at the MHC PSORS1 locus. Hum. Mol. Genet., 11, 589–597.[Abstract/Free Full Text]

  13. Jonca, N., Guerrin, M., Hadjiolova, K., Caubet, C., Gallinaro, H., Simon, M. and Serre, G. (2002) Corneodesmosin, a component of epidermal corneocyte desmosomes, displays homophilic adhesive properties. J. Biol. Chem., 277, 5024–5029.[Abstract/Free Full Text]

  14. Simon, M., Jonca, N., Guerrin, M., Haftek, M., Bernard, D., Caubet, C., Egelrud, T., Schmidt, R. and Serre, G. (2001) Refined characterization of corneodesmosin proteolysis during terminal differentiation of human epidermis and its relationship to desquamation. J. Biol. Chem., 276, 20292–20299.[Abstract/Free Full Text]

  15. Orru, S., Giuressi, E., Casula, M., Loizedda, A., Murru, R., Mulargia, M., Masala, M.V., Cerimele, D., Zucca, M., Aste, N. et al. (2002) Psoriasis is associated with a SNP haplotype of the corneodesmosin gene (CDSN). Tissue Antigens, 60, 292–298.[CrossRef][Web of Science][Medline]

  16. Hui, J., Oka, A., Tamiya, G., Tomizawa, M., Kulski, J.K., Penhale, W.J., Tay, G.K., Iizuka, M., Ozawa, A. and Inoko, H. (2002) Corneodesmosin DNA polymorphisms in MHC haplotypes and Japanese patients with psoriasis. Tissue Antigens, 60, 77–83.[CrossRef][Web of Science][Medline]

  17. Capon, F., Toal, I.K., Evans, J.C., Allen, M.H., Patel, S., Tillman, D., Burden, D., Barker, J.N. and Trembath, R.C. (2003) Haplotype analysis of distantly related populations implicates corneodesmosin in psoriasis susceptibility. J. Med. Genet., 40, 447–452.[Free Full Text]

  18. Romphruk, A.V., Oka, A., Romphruk, A., Tomizawa, M., Choonhakarn, C., Naruse, T.K., Puapairoj, C., Tamiya, G., Leelayuwat, C. and Inoko, H. (2003) Corneodesmosin gene: no evidence for PSORS 1 gene in North-eastern Thai psoriasis patients. Tissue Antigens, 62, 217–224.[CrossRef][Web of Science][Medline]

  19. Guerrin, M., Vincent, C., Simon, M., Tazi Ahnini, R., Fort, M. and Serre, G. (2001) Identification of six novel polymorphisms in the human corneodesmosin gene. Tissue Antigens, 57, 32–38.[CrossRef][Web of Science][Medline]

  20. Di Paola, R., Frittitta, L., Miscio, G., Bozzali, M., Baratta, R., Centra, M., Spampinato, D., Santagati, M.G., Ercolino, T., Cisternino, C. et al. (2002) A variation in 3' UTR of hPTP1B increases specific gene expression and associates with insulin resistance. Am. J. Hum. Genet., 70, 806–812.[CrossRef][Web of Science][Medline]

  21. Duan, J., Wainwright, M.S., Comeron, J.M., Saitou, N., Sanders, A.R., Gelernter, J. and Gejman, P.V. (2003) Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor. Hum. Mol. Genet., 12, 205–216.[Abstract/Free Full Text]

  22. Haftek, M., Simon, M., Kanitakis, J., Marechal, S., Claudy, A., Serre, G. and Schmitt, D. (1997) Expression of corneodesmosin in the granular layer and stratum corneum of normal and diseased epidermis. Br. J. Dermatol., 137, 864–873.[CrossRef][Web of Science][Medline]

  23. Allen, M., Ishida-Yamamoto, A., McGrath, J., Davison, S., Iizuka, H., Simon, M., Guerrin, M., Hayday, A., Vaughan, R., Serre, G. et al. (2001) Corneodesmosin expression in psoriasis vulgaris differs from normal skin and other inflammatory skin disorders. Lab. Invest., 81, 969–976.[Web of Science][Medline]

  24. Boukamp, P., Petrussevska, R.T., Breitkreutz, D., Hornung, J., Markham, A. and Fusenig, N.E. (1988) Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. J. Cell Biol., 106, 761–771.[Abstract/Free Full Text]

  25. Tierney, M.J. and Medcalf, R.L. (2001) Plasminogen activator inhibitor type 2 contains mRNA instability elements within exon 4 of the coding region. Sequence homology to coding region instability determinants in other mRNAs. J. Biol. Chem., 276, 13675–13684.[Abstract/Free Full Text]

  26. Breitkreutz, D., Schoop, V.M., Mirancea, N., Baur, M., Stark, H.J. and Fusenig, N.E. (1998) Epidermal differentiation and basement membrane formation by HaCaT cells in surface transplants. Eur. J. Cell Biol., 75, 273–286.[Web of Science][Medline]

  27. Lo, H.S., Wang, Z., Hu, Y., Yang, H.H., Gere, S., Buetow, K.H. and Lee, M.P. (2003) Allelic variation in gene expression is common in the human genome. Genome Res., 13, 1855–1862.[Abstract/Free Full Text]

  28. Schmitt-Egenolf, M., Windemuth, C., Hennies, H.C., Albis-Camps, M., von Engelhardt, B., Wienker, T., Reis, A., Traupe, H. and Blasczyk, R. (2001) Comparative association analysis reveals that corneodesmosin is more closely associated with psoriasis than HLA-Cw*0602-B*5701 in German families. Tissue Antigens, 57, 440–446.[CrossRef][Web of Science][Medline]

  29. Gonzalez, S., Martinez-Borra, J., Del Rio, J.S., Santos-Juanes, J., Lopez-Vazquez, A., Blanco-Gelaz, M. and Lopez-Larrea, C. (2000) The OTF3 gene polymorphism confers susceptibility to psoriasis independent of the association of HLA-Cw*0602. J. Invest. Dermatol., 115, 824–828.[CrossRef][Web of Science][Medline]

  30. Ishihara, M., Yamagata, N., Ohno, S., Naruse, T., Ando, A., Kawata, H., Ozawa, A., Ohkido, M., Mizuki, N., Shiina, T. et al. (1996) Genetic polymorphisms in the keratin-like S gene within the human major histocompatibility complex and association analysis on the susceptibility to psoriasis vulgaris. Tissue Antigens, 48, 182–186.[Web of Science][Medline]

  31. Jenisch, S., Westphal, E., Nair, R.P., Stuart, P., Voorhees, J.J., Christophers, E., Kronke, M., Elder, J.T. and Henseler, T. (1999) Linkage disequilibrium analysis of familial psoriasis: identification of multiple disease-associated MHC haplotypes. Tissue Antigens, 53, 135–146.[CrossRef][Web of Science][Medline]

  32. Degli-Esposti, M.A., Leelayuwat, C., Daly, L.N., Carcassi, C., Contu, L., Versluis, L.F., Tilanus, M.G. and Dawkins, R.L. (1995) Updated characterization of ancestral haplotypes using the Fourth Asia-Oceania Histocompatibility Workshop panel. Hum. Immunol., 44, 12–18.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
O. B. Rickman, P. K. Vohra, B. Sanyal, J. A. Vrana, M.-C. Aubry, D. A. Wigle, and C. F. Thomas Jr.
Analysis of ErbB Receptors in Pulmonary Carcinoid Tumors
Clin. Cancer Res., May 15, 2009; 15(10): 3315 - 3324.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
E. Fitzpatrick, M.P. Johnson, T.D. Dyer, S. Forrest, K. Elliott, J. Blangero, S.P. Brennecke, and E.K. Moses
Genetic association of the activin A receptor gene (ACVR2A) and pre-eclampsia
Mol. Hum. Reprod., March 1, 2009; 15(3): 195 - 204.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Matsumoto, Y. Zhou, S. Matsuo, H. Nakanishi, K. Hirose, H. Oura, S. Arase, A. Ishida-Yamamoto, Y. Bando, K. Izumi, et al.
Targeted deletion of the murine corneodesmosin gene delineates its essential role in skin and hair physiology
PNAS, May 6, 2008; 105(18): 6720 - 6724.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
S.-M. Brand-Herrmann
Where Do We Go for Atherothrombotic Disease Genetics?
Stroke, April 1, 2008; 39(4): 1070 - 1075.
[Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. F. Lehnerdt, P. Franz, A. Zaqoul, K. J. Schmitz, S. Grehl, S. Lang, K. W. Schmid, W. Siffert, K. Jahnke, and U. H. Frey
Overall and Relapse-Free Survival in Oropharyngeal and Hypopharyngeal Squamous Cell Carcinoma Are Associated with Genotypes of T393C Polymorphism of the GNAS1 Gene
Clin. Cancer Res., March 15, 2008; 14(6): 1753 - 1758.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Ghoussaini, V. Vatin, C. Lecoeur, V. Abkevich, A. Younus, C. Samson, C. Wachter, B. Heude, M. Tauber, P. Tounian, et al.
Genetic Study of the Melanin-Concentrating Hormone Receptor 2 in Childhood and Adulthood Severe Obesity
J. Clin. Endocrinol. Metab., November 1, 2007; 92(11): 4403 - 4409.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Z. E. Sauna, C. Kimchi-Sarfaty, S. V. Ambudkar, and M. M. Gottesman
Silent Polymorphisms Speak: How They Affect Pharmacogenomics and the Treatment of Cancer
Cancer Res., October 15, 2007; 67(20): 9609 - 9612.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. S. Braun, M. Kretzler, T. Heider, J. Floege, L. B. Holzman, W. Kriz, and M. J. Moeller
Differentially Spliced Isoforms of FAT1 Are Asymmetrically Distributed within Migrating Cells
J. Biol. Chem., August 3, 2007; 282(31): 22823 - 22833.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
Y. Tanaka, H. Hirata, Z. Chen, N. Kikuno, K. Kawamoto, S. Majid, T. Tokizane, S. Urakami, H. Shiina, K. Nakajima, et al.
Polymorphisms of Catechol-O-Methyltransferase in Men with Renal Cell Cancer
Cancer Epidemiol. Biomarkers Prev., January 1, 2007; 16(1): 92 - 97.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
J. L. Parmley, J. V. Chamary, and L. D. Hurst
Evidence for Purifying Selection Against Synonymous Mutations in Mammalian Exonic Splicing Enhancers
Mol. Biol. Evol., February 1, 2006; 23(2): 301 - 309.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. A. Shabalina, A. Y. Ogurtsov, and N. A. Spiridonov
A periodic pattern of mRNA secondary structure created by the genetic code.
Nucleic Acids Res., January 1, 2006; 34(8): 2428 - 2437.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
U. H. Frey, H. Alakus, J. Wohlschlaeger, K. J. Schmitz, G. Winde, H. G. van Calker, K.-H. Jockel, W. Siffert, and K. W. Schmid
GNAS1 T393C Polymorphism and Survival in Patients with Sporadic Colorectal Cancer
Clin. Cancer Res., July 15, 2005; 11(14): 5071 - 5077.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
C. Butt, P. Rahman, F. Siannis, V. T. Farewell, and D. D. Gladman
Corneodesmosin polymorphisms in psoriatic arthritis
Rheumatology, May 1, 2005; 44(5): 684 - 685.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow All Versions of this Article:
13/20/2361    most recent
ddh273v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (46)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Capon, F.
Right arrow Articles by Trembath, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Capon, F.
Right arrow Articles by Trembath, R. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?