Skip Navigation


Human Molecular Genetics Advance Access originally published online on August 27, 2004
Human Molecular Genetics 2004 13(20):2385-2397; doi:10.1093/hmg/ddh278
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow All Versions of this Article:
13/20/2385    most recent
ddh278v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (23)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Demuth, I.
Right arrow Articles by Digweed, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Demuth, I.
Right arrow Articles by Digweed, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, Vol. 13, No. 20 © Oxford University Press 2004; all rights reserved

An inducible null mutant murine model of Nijmegen breakage syndrome proves the essential function of NBS1 in chromosomal stability and cell viability

Ilja Demuth1,{dagger}, Pierre-Olivier Frappart2, Gabriele Hildebrand1, Anna Melchers1, Stephan Lobitz1, Lars Stöckl1, Raymonda Varon1, Zdenko Herceg2, Karl Sperling1, Zhao-Qi Wang2 and Martin Digweed1,*

1Institut für Humangenetik, Charité Universitätsmedizin Berlin, Campus Virchow-Klinikum, Augustenburger Platz 1, 13353 Berlin, Germany and 2International Agency for Research on Cancer (IARC), 150 cours Albert Thomas, 69008 Lyon, France

Received July 6, 2004; Revised August 6, 2004; Accepted August 19, 2004


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
The human genetic disorder, Nijmegen breakage syndrome, is characterized by radiosensitivity, immunodeficiency, chromosomal instability and an increased risk for cancer of the lymphatic system. The NBS1 gene codes for a protein, nibrin, involved in the processing/repair of DNA double strand breaks and in cell cycle checkpoints. Most patients are homozygous for a founder mutation, a 5 bp deletion, which might not be a null mutation, as functionally relevant truncated nibrin proteins are observed, at least in vitro. In agreement with this hypothesis, null mutation of the homologous gene, Nbn, is lethal in mice. Here, we have used Cre recombinase/loxP technology to generate an inducible Nbn null mutation allowing the examination of DNA-repair and cell cycle-checkpoints in the complete absence of nibrin. Induction of Nbn null mutation leads to the loss of the G2/M checkpoint, increased chromosome damage, radiomimetic-sensitivity and cell death. In vivo, this particularly affects the lymphatic tissues, bone marrow, thymus and spleen, whereas liver, kidney and muscle are hardly affected. In vitro, null mutant murine fibroblasts can be rescued from cell death by transfer of human nibrin cDNA and, more significantly, by a cDNA carrying the 5 bp deletion. This demonstrates, for the first time, that the common human mutation is hypomorphic and that the expression of a truncated protein is sufficient to restore nibrin's vital cellular functions.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Nijmegen breakage syndrome (NBS, MIM 251260) is a rare autosomal recessive genetic disease belonging to a group of disorders termed chromosome instability syndromes. Patients affected by NBS have a range of symptoms including microcephaly, growth retardation, radiosensitivity, immunodeficiency and an increased cancer risk, particularly for B-cell lymphoma (1,2). The gene mutated in NBS was localized to chromosome 8q21 by linkage analysis in NBS families (3) and then identified by positional cloning (4). Over 90% of all NBS patients are homozygous for a 5 bp deletion (657{Delta}5) in exon 6 of the NBS1 gene.

Concurrent to the identification of the NBS1 gene through positional cloning, the functional human orthologue of the yeast gene, Xrs2, was identified as the same NBS1 gene (5). In yeast cells, the product of the Xrs2 gene is part of a complex together with Rad50 and Mre11. Experimental data from the yeast Saccharomyces cerevisiae implicate the Rad50 complex in double-strand break (DSB) repair by both non-homologous end joining (NHEJ) (6) and homologous recombination (HR) (7), the two major repair pathways for DNA DSBs. In mammalian cells, MRE11, RAD50 and the NBS1 gene product, nibrin or p95, interact to form a complex (M/R/N). Although the clinical radiosensitivity of NBS patients is reflected at the cellular level and obviously implies a defect in DNA repair, a deficiency in repairing DSBs has not been clearly demonstrated in appropriate assays (811).

In addition to its potential roles in DSB repair, nibrin has been implicated in two steps of the DNA damage signal transduction pathway. First, it has been shown that nibrin is phosphorylated by ATM (12,13), the gene mutated in Ataxia telangiectasia (AT) patients. Phosphorylated nibrin facilitates the ATM-mediated phosphorylation of further target molecules, such as CHK2, CHK1 and SMC1, involved in key steps of the cell cycle, including entry into mitosis (14,15). In addition, however, the M/R/N complex, including nibrin, is required for the activation of ATM itself in response to DNA damage (16). Thus, nibrin has roles both upstream and downstream of ATM in the DNA damage response.

The relevance of nibrin's various functions for the disease, NBS, has been difficult to analyse using patient cells as the 657{Delta}5 mutation and, most likely, nine other truncating mutations found in NBS1, are hypomorphic rather than null mutations. An N-terminal truncated protein of ~26 kDa is observed in cells from homozygous 657{Delta}5 patients. Furthermore, a 70 kDa C-terminal truncated protein is also observed in Epstien–Barr virus (EBV)-transformed NBS lymphoblastoid cells and immortalized NBS fibroblasts. It has not, however, been observed in primary patient cells. The p70 fragment is produced by alternative initiation of translation at a start codon upstream of the 5 bp deletion through which it is brought into frame (17). Similarly, truncated proteins have been observed for the 835{Delta}4 and 900{Delta}25 NBS1 mutations, although here produced presumably by initiation of translation at downstream in-frame start codons (17,18). If these truncated proteins are genuinely active in vivo, they could have a major impact on cellular and clinical phenotype. This has, however, not been demonstrated so far.

Clearly, the elucidation of the function of nibrin would be facilitated by the availability of null mutant cells. Chicken DT40 cells with complete absence of nibrin have been described, and their cellular phenotype recapitulates much of the NBS phenotype (19). However, in mice, null mutation of NBS1 leads to embryonic lethality (20,21) and only animals with hypomorphic mutations survive past early embryogenesis (22,23). In order to circumvent this lethality, we have generated, for the first time, mice with an inducible null mutation in the murine Nbn gene. In this system, Cre recombinase is used to delete exon 6 of the gene by recombination of flanking loxP sites. Homozygous disruption of Nbn can therefore be induced in cells in vitro by application of Cre recombinase, or in vivo by using transgenic Cre recombinase expressed from an inducible promoter (24).

Using these null mutant cells we have been able to show, first, that absence of nibrin leads to massive spontaneous chromosome damage, reflecting its role in DNA DSB-repair. Second, when challenged with a DSB inducing treatment, null mutant cells fail to arrest in G2 but proceed into mitosis. Thus, nibrin is required for the transmission of a signal from damaged DNA to at least this cell cycle checkpoint. Third, null mutant cells have a dramatically reduced survival both in vivo and in vitro, explaining the embryonic lethality of knock-out mice. Finally, the hypomorphic nature of the major human NBS1 mutation has been demonstrated by the ability of NBS1 cDNA carrying this mutation to promote survival of null mutant mouse cells in vitro.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Targeted inducible disruption of the Nbn gene in mice
A targeting vector, pTV-FLOX-Nbn, was constructed which, after HR in mouse ES cells, introduces a G418-resistance cassette into the intron 5 of the Nbn locus and replaces exon 6 with a loxP-flanked copy (Fig. 1). ES clones with correctly targeted Nbn alleles were identified by PCR and Southern blot (Fig. 2A). Correctly targeted ES cells were electroporated with a Cre recombinase expression vector, and the clones that had undergone recombination at loxP sites were identified. Clones in which recombination had deleted the neomycin-resistance cassette and one loxP site but left Nbn exon 6 flanked by loxP sites are denoted Nbnwt/lox-6 (Fig. 1). Clones in which Cre-mediated recombination had deleted both the neomycin-resistance cassette and exon 6 are termed Nbnwt/{Delta}6 (Fig. 1). Both Nbnwt/lox-6 and Nbnwt/{Delta}6 ES cell clones were microinjected into C57BL/6 blastocysts, chimeras were crossed with 129/Sv mice and heterozygous pups identified by PCR and Southern blot. Genotyping PCRs for these mice are shown in Figure 2B. In the experiments described here, the Nbnlox-6 allele was deleted to Nbn{Delta}6 in mice or murine fibroblasts in which the second Nbn allele was either wild-type or the previously described, embryonically lethal, exon 6 insertion mutation, Nbnins-6 (Fig. 1) (20).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 1. Targeting the murine Nbn locus. The relevant region of the Nbn locus is shown with filled boxes representing the Nbn exons. In the drawing of the targeting vector, pTV-FLOX-Nbn, the solid line represents mouse genomic sequence with Nbn exons drawn as filled boxes. Open boxes represent vector sequences with the selection markers in grey. loxP sites are denoted by triangles. The targeted locus in ES cells shows the integration of the G418-resistance cassette and loxP sites into the murine gene. The NheI recognition sites used for Southern blot analysis and the hybridization probe (SB) located in exon 5 are indicated. After Cre recombinase mediated deletion, three alleles are produced, of which two are shown here: Nbn{Delta}6, in which exon 6 is deleted; and Nbnlox-6, in which exon 6 is flanked by loxP-sites. The genomic structure of one further Nbn allele used in these studies is also shown, Nbnins-6, in which a neomycin-resistance cassette disrupts exon 6 (20).

 


View larger version (61K):
[in this window]
[in a new window]
 
Figure 2. Targeted disruption of the murine Nbn locus. (A) Confirmation of Nbn targeting in ES cells by Southern blotting. NheI-Restricted DNA from ES cell clones was hybridized to a 272 bp probe spanning exon 5. (B) PCR screening of DNA from mouse tail biopsies. The sizes of PCR products from the various alleles are indicated. (C) RT–PCR analysis of the Nbn{Delta}6 and Nbnlox-6 alleles. The product is 118 bp shorter corresponding to the size of the deleted exon 6. (D) Western blot analysis of nibrin expression. Nibrin was detected in immunoblotted cell lysates using a polyclonal antibody, which recognizes mouse and human nibrin. NBS+/+ cells are normal human fibroblasts. NBS–/– is an SV40-transformed patient cell line, GM7166VA7, which expresses a 70 kDa C-terminal nibrin fragment. In homozygous Nbnwt/lox-6 and heterozygous Nbnins-6/lox-6 fibroblasts, nibrin is normally expressed. After treatment of Nbnins-6/lox-6 cells in vitro with the Cre recombinase fusion protein, HTNC, the expression of nibrin is reduced by 70%, reflecting the proportion of cells deleted to Nbnins-6/{Delta}6.

 
Crosses amongst Nbnwt/{Delta}6 heterozygotes did not yield Nbn{Delta}6/{Delta}6 mice (18 Nbnwt/wt:25 Nbnwt/{Delta}6:0 Nbn{Delta}6/{Delta}6 P= 0.0016 in the {chi}2-test) indicating that the deletion of exon 6 is embryonically lethal. Deletion of exon 6 is predicted to result in a frameshift at position 584 (serine-195) followed by 16 incorrect amino acids before termination of translation at a cryptic termination codon. The mRNA arising from the Nbn{Delta}6 allele was examined by RT–PCR (Fig. 2C) and sequenced to confirm the theoretically expected frameshift (data not shown). Therefore, cells expressing only the Nbn{Delta}6 allele have no authentic nibrin beyond amino acid 195.

As C-terminal nibrin fragments have been observed in NBS patient cells (17,18) and in the cells of viable Nbn knock-out mice (22,23), we looked for such products from the Nbn{Delta}6 allele. Examination of the upstream sequence of the exon 6-deleted allele indicates the possibility of an in-frame start codon at position 438, followed, however, by a stop codon at position 465. A second potential start codon at position 486 is similarly followed by a stop codon at position 535. Thus, the production of a C-terminal nibrin fragment by the mechanism of alternative upstream initiation, as from the human NBS1 657{Delta}5-mutation (17), can be excluded. However, downstream start codons are potentially available at positions 754, 880, 949 and 1078; these would allow translation of C-terminal fragments of 56, 52, 49 and 45 kDa, respectively.

Western blot analysis using lysates from mouse fibroblasts (Fig. 2D), however, did not confirm that such proteins are actually produced from the Nbnlox-6 or Nbn{Delta}6 alleles, even though they are normally transcribed (Fig. 2C). In contrast, the 78 kDa fragment translated from the hypomorphic Nbn allele constructed by Kang et al. (22) is readily detected in embryonic fibroblasts by western blot. As a control for effectivity, the nibrin-specific antibodies employed here were able to detect the 70 kDa C-terminal nibrin fragment in lysates of human NBS fibroblasts (Fig. 2D). Thus, the deletion of Nbn exon 6 does indeed represent a true null mutation. After treatment of Nbnins-6/lox-6 fibroblasts in vitro with HTNC, a Cre recombinase fusion protein, the majority of cells are deleted to the Nbnins-6/{Delta}6 genotype leading to a 70% reduction in the expression of nibrin (Fig. 2D).

Breeding amongst Nbnwt/lox-6 animals yielded Nbnlox-6/lox-6 mice indicating that the exon 6 flanked by loxP-sites remains fully functional. For experiments on induction of homozygosity in mouse fibroblasts in vitro, crosses were set up to produce Nbnwt/lox-6 and Nbnins-6/lox-6 mice. To examine the consequences of Nbn null mutation in vivo, mice were crossed with transgenic mice expressing Cre recombinase under the control of the interferon responsive promoter, Mx1 (24). For comparative purposes, both Nbnwt/lox-6 Tg-Mx1-Cre and Nbnins-6/lox-6 Tg-Mx1-Cre mice were produced. Genotyping PCRs for these mice are shown in Figure 2B.

Cre-mediated deletion through recombination at loxP sites is generally incomplete both in vitro and in vivo (2426); therefore, a semi-quantitative assay for estimating the extent of exon 6 deletion was developed. The assay is based on the simultaneous amplification of differently sized, fluorescently labelled PCR products from the three alleles, Nbnwt, Nbnlox-6 and Nbn{Delta}6. Under standardized conditions, the initial proportions of artificially mixed genomic DNAs were authentically reflected in the relative amounts of PCR products as measured by FluorImager analysis of polyacrylamide gels (Supplementary Material, Fig. S1).

Impaired survival of Nbn null mutant cells in vivo
Injection of Nbnwt/lox-6 Tg-Mx1-Cre mice and Nbnins-6/lox-6 Tg-Mx1-Cre mice with poly(I):poly(C) to mimic a viral infection, leads to interferon production and thus Cre recombinase expression in interferon-sensitive cells. DNA was extracted from the organs 15 days after induction of Cre recombinase, and the extent of exon 6 deletion was estimated using the semi-quantitative PCR assay described. Comparing deletion efficiencies in Nbnins-6/lox-6 mice with Nbnwt/lox-6 mice indicates the surviving fraction of Nbnins-6/{Delta}6 cells independently of tissue response to interferon. As shown in Figure 3, 93% of the cells recovered from the liver are deleted to heterozygosity in Nbnwt/lox-6 mice and 94% to homozygosity in Nbnins-6/lox-6 mice. In the kidney, deletion efficiency is also comparable in Nbnwt/lox-6 mice (43%) and Nbnins-6/lox-6 mice (40%).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 3. Recovery of the Nbn exon 6-deleted allele from mouse organs after in vivo expression of Cre recombinase. (A) Fluorogram of a representative semi-quantitative PCR analysis for deletion in the kidney of two Nbnwt/lox-6 mice and four Nbnins-6/lox-6 mice after Cre recombinase expression in vivo. The PCR products from the three detected alleles are indicated, the Nbnins-6 allele is not detected in this PCR. The area of each product signal as measured by the ImageQuant software is given under the fluorogram and reflects the Cre recombinase-mediated exon 6 deletion efficiency. (B) Recovery of the Nbn exon 6-deleted allele after Cre recombinase expression in vivo as measured by semi-quantitative PCR for eight organs in Nbnwt/lox-6 mice (white columns) and Nbnins-6/lox-6 mice (grey columns). The number of animals in each measurement is given above the columns.

 
In contrast, in bone marrow, only 50% of recovered cells are deleted in Nbnins-6/lox-6 mice when compared with 100% in Nbnwt/lox-6 mice (P<0.009 in Student's t-test). This is a clear indication that in proliferative tissues, such as bone marrow, the homozygous mutant cells have a strong growth disadvantage and are quite rapidly lost. Even more striking is the effect in the thymus. The interferon mediated deletion efficiency is extremely high in this organ, practically 100% of Nbnwt/lox-6 cells are deleted to Nbnwt/{Delta}6 whereas <20% of cells in the thymus of Nbnins-6/lox-6 mice are Nbnins-6/{Delta}6 (P<0.0005 in Student's t-test). In spleen, the pattern is similar, with 76% of cells deleted in Nbnwt/lox-6 mice, but only 50% in Nbnins-6/lox-6 mice (P<0.004 in Student's t-test).

Increased spontaneous and DSB-induced chromosome breakage in Nbn null mutant lymphocytes
Lymphocytes isolated from the spleens of Nbnins-6/lox-6 mice after in vivo deletion by poly(I):poly(C) injection show increased chromosomal instability in comparison with similarly treated Nbnwt/lox-6 mice. Figure 4A shows two representative metaphase spreads from Nbnins-6/lox-6 lymphocytes after deletion to Nbnins-6/{Delta}6 in vivo. In Figure 4B the quantification of aberrant mitotic cells and damage per cell are shown for two mice of each genotype. This increased spontaneous chromosome breakage reflects the essential role of nibrin in maintaining genomic integrity in dividing cells and suggests that the specific loss of Nbnins-6/{Delta}6 cells can be attributed to their genomic instability.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 4. Chromosomal breakage in mouse lymphocytes deleted to homozygosity in vivo. (A) Two metaphase spreads showing spontaneously occurring chromosome breaks and translocations (arrows) in Nbnins-6/lox-6 mice after deletion to Nbnins-6/{Delta}6 in vivo. (B) Quantification of spontaneous chromosome breakage in spleen lymphocytes from two Nbnwt/lox-6 mice (white columns) and two Nbnins-6/lox-6 mice (grey columns) after deletion to heterozygosity or homozygosity in vivo. The deletion efficiency and the number of metaphases scored are given below the columns.

 
The sensitivity of null mutant lymphocytes in vitro was examined by applying the HTNC Cre recombinase fusion protein to the cells, before stimulation and cultivation. As shown in Figure 5A, null mutant splenic lymphocytes have a high spontaneous chromosome breakage rate; on average, 25% of the mitotic cells are aberrant, 8-fold higher than the rate in cells from the same spleens not induced to homozygosity by HTNC. Examination of chromosomal breakage in spleen lymphocytes from wild-type mice confirmed that the damage is not merely due to HTNC-treatment (data not shown).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 5. Chromosomal breakage in mouse lymphocytes deleted to homozygosity in vitro. (A) Lymphocytes isolated from the spleens of two Nbnins-6/lox-6 mice (labelled 1 and 2) were treated with HTNC (grey columns), or mock-treated (white columns), before LPS and concanavalin A stimulation of T- and B-lymphocytes. Coded slides were scored. The number of metaphases examined is given below the columns. (B) Chromosome breakage induced by the radiomimetic bleomycin. HTNC (grey columns), or mock-treated (white columns), lymphocytes from an Nbnins-6/lox-6 mouse [labelled 2 in (A)] were treated with bleomycin at the indicated concentrations for 3 h before chromosome preparation. The number of metaphases examined is given below the columns.

 
Treatment of null mutant lymphocytes in vitro with the radiomimetic bleomycin, further increased the rate of chromosome breakage. Interestingly, the proportion of aberrant Nbnins-6/{Delta}6 mitotic cells, in contrast to Nbnwt/{Delta}6 cells, increases only slightly with the bleomycin doses employed here (Fig. 5B). However, the damage per mitotic cell is clearly increased in the homozygous cells in a dose-dependent manner. These findings are compatible with a G2/M checkpoint defect that renders null mutant cells insensitive to the presence of damaged DNA. This was then examined more thoroughly.

The G2/M checkpoint is deficient in Nbn null mutant fibroblasts
The mitotic index in Nbn null mutant fibroblasts after a DNA damaging treatment was determined by FACS analysis. Nbnins-6/lox-6 and Nbnwt/lox-6 cells were treated with HTNC to induce deletion to Nbnins-6/{Delta}6 and Nbnwt/{Delta}6, respectively. After 48 h, aliquots of the cells were exposed for 2 h to increasing concentrations of bleomycin, fixed in ethanol and then stained with a mitosis-specific antibody directed against phosphorylated Histone H3, a Cy2-conjugated secondary antibody and counter-stained with propidium iodide for DNA content. Treatment of the heterozygous, Nbnwt/{Delta}6, cells with bleomycin for 2 h leads to a dramatic inhibition of mitosis in comparison with mock-treated cells (Fig. 6). This inhibition is much less pronounced in Nbnins-6/{Delta}6 cells. At a bleomycin dose leading to 90% inhibition of mitosis in heterozygous cells, mitosis in the homozygous cells is still at 60% of untreated cells. This finding indicates that nibrin is indeed required for the G2/M checkpoint responding to damaged DNA.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 6. The DNA damage induced G2/M checkpoint in Nbn null mutant cells. (A) Fibroblasts with the HTNC-induced Genotypes given were treated with bleomycin for 2 h and examined by flow cytometry after staining with an antibody specific for mitotic cells, phosphorylated Histone H3, and a Cy2-conjugated secondary antibody. Cells were counterstained with propidium iodide for DNA content. The dot-plots show one representative experiment for each Genotype. For each sample 100 000 cells were counted, but for clarity only 20 000 events are shown in the dot-plots. Mitotic cells have G2-DNA content but are Cy2-positive and are detected as the population enclosed by a circle. The mitotic index (mitotic cells/total counted events) is given. (B) The graph shows the collected results of three independent experiments for Nbnwt/{Delta}6 and Nbnins-6/{Delta}6 cells as relative mitotic index after treatment with bleomycin. Deletion efficiency after HTNC treatment was 72–77% in these experiments.

 
Impaired survival of Nbn null mutant fibroblasts in vitro
In an attempt to isolate individual Nbnins-6/{Delta}6 clones, spontaneously transformed dermal fibroblasts from Nbnins-6/lox-6 mice were plated at low density 20 days after treatment in vitro with HTNC. Of 80 clones analysed, all were Nbnins-6/lox-6 and none were Nbnins-6/{Delta}6, even though at the time of cloning, 20% of the cells were Nbnins-6/{Delta}6according to the semi-quantitative PCR assay (data not shown). This suggested that Nbnins-6/{Delta}6 fibroblasts are specifically lost in culture, just as in vivo. Examination of the proportion of cells surviving with time after an HTNC treatment using the semi-quantitative PCR analysis confirmed this finding. As a control, Nbnwt/lox-6 cells, which are heterozygous after Cre-mediated deletion, were also examined. Shortly after HTNC treatment, 60–70% of the treated cells were deleted from Nbnwt/lox-6 to Nbnwt/{Delta}6 or from Nbnins-6/lox-6 to Nbnins-6/{Delta}6 (Fig. 7). However, during cultivation there was specific loss of the Nbn{Delta}6 allele in DNA extracted from the HTNC-treated Nbnins-6/lox-6 cells, reflecting loss of Nbnins-6/{Delta}6 cells from this population. In contrast, cells with this allele were stable in the HTNC-treated Nbnwt/lox-6 culture. After 40 days (approximately 20 passages), 73% of the original Nbnwt/lox-6 cells were Nbnwt/{Delta}6. Of the HTNC-treated Nbnins-6/lox-6 cells, only 6% were Nbnins-6/{Delta}6 after 40 days in culture (Fig. 7). Thus, over 90% of the homozygous null mutant Nbn cells were lost in competition with the undeleted Nbnins-6/lox-6 cells during proliferation in vitro.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 7. Survival of Nbnwt/{Delta}6 and Nbnins-6/{Delta}6 cells after deletion in vitro. Fibroblasts with the genotypes given in the figure were treated with HTNC and returned to culture. At various time points, DNA was isolated from the cultures and subjected to semi-quantitative PCR to establish the proportion of the Nbn{Delta}6 allele, and thus the proportion of Nbnins-6/{Delta}6 homozygous cells or Nbnwt/{Delta}6 heterozygous cells (stacked grey columns) and undeleted cells (stacked white columns).

 
Rescue of viability in Nbn null mutant fibroblasts by human NBS1 cDNA
In order to verify and extend the earlier mentioned findings, Nbnins-6/lox-6 fibroblasts were transduced with the wild-type human NBS1 cDNA before treatment with HTNC in an attempt to rescue them from cell death. The retroviral vector, pLXIN, was used to transfer the full-length human wild-type nibrin cDNA (27) or a cDNA, which carries the common human NBS1 mutation, 657{Delta}5. PCR with appropriate primers and immunoblots for human nibrin confirmed that the cells were successfully transduced (Supplementary Material, Fig. S2). The cells were then treated with HTNC and regularly genotyped during cultivation for up to 40 days. The initial deletion efficiency measured after 24 h was, again, 70–80%. After 40 days, in the culture transduced with LXIN,<10% of the original Nbnins-6/{Delta}6 cells survived. In the culture transduced with LXIN-NBS1, >90% of the cells were still Nbnins-6/{Delta}6, indicating that expression of wild-type human nibrin was sufficient to rescue these fibroblasts from the lethal effects of their endogenous Nbn mutations (Fig. 8). Furthermore, cells transduced with a cDNA containing the 657{Delta}5 mutation were also rescued: at 10 days after Cre treatment, 100%, and at 20 days, 60% of the originally deleted cells were still Nbnins-6/{Delta}6 (P<0.004 and P<0.003, respectively, in comparison with LXIN-transduced cells). Even after 40 days of cultivation, >40% of the cells transduced with 657{Delta}5 cDNA and deleted to Nbnins-6/{Delta}6 were still alive and could clearly compete with the remaining heterozygous cells.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 8. Quantification of surviving Nbnins-6/{Delta}6 cells in Nbnins-6/lox-6 transductants. Fibroblasts transduced with the cDNAs given above the graphs were treated with HTNC and returned to culture. At various time points, DNA was isolated from the cultures and subjected to semi-quantitative PCR to establish the proportion of the Nbn{Delta}6 allele, and thus the proportion of Nbnins-6/{Delta}6 homozygous cells. The graphs show the results and standard deviation of three experiments up to day 20; in one experiment, the cells were cultivated for a total of 40 days.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Nibrin is essential for cell viability and the major NBS1 mutation, 657{Delta}5, is hypomorphic
The lethality of Nbn mutations in the mouse was, at first, surprising, considering that patients with NBS1 mutations live, albeit with life-threatening deficiencies in their lymphoreticular system. The mouse embryos generated in those experiments died between days 3.5 and 7.5 pc owing to enhanced apoptosis and degeneration of the inner cell mass (20,21). As disruptions of RAD50 and MRE11 in the mouse also lead to embryonic lethality (28,29), the M/R/N complex clearly has an essential function in embryonic stem cell proliferation and early embryo development. A possible explanation for the viability of individuals with mutations in the human NBS1 gene was suggested by the finding that the major mutation, 657{Delta}5, can lead to an alternative initiation of translation and production of a 70 kDa C-terminal nibrin protein fragment (17).

In agreement with this hypothesis, mice with targeted Nbn alleles producing similar C-terminal nibrin proteins of 75 or 80 kDa also survive (22,23). All of these nibrin fragments contain the region that interacts with MRE11 (30,31) and the serines, which are phosphorylated by ATM in response to ionizing irradiation (12,13). They do not, however, contain the BRCT and FHA domains that are required for nibrin phosphorylation by ATM, the formation of nuclear foci after IR (5,32) and, indeed, correct nuclear localization of the M/R/N complex (5).

Thus, although the C-terminal nibrin fragments might be able to bind MRE11, and thus associate with RAD50, this function suffices for cellular survival but not radioresistance. Using an inducible disruption of the Nbn gene to create a null mutant has allowed us to test this hypothesis. Cre recombinase-mediated deletion of Nbn exon 6 in a cell that has an inactivating null mutation in the remaining Nbn allele leads to death in vitro and in vivo, recapitulating the lethality in mouse ES cells and early mouse embryos reported previously. Transduction of inducible knock-out cells with a retrovirus expressing wild-type human nibrin before induction of homozygosity completely complemented their null mutations. Furthermore, transduction with a cDNA containing the major human mutation, 657{Delta}5, which produces a 70 kDa C-terminal nibrin fragment, also rescued cells from death in culture. As the N-terminal truncated human nibrin fragment theoretically expressed from this allele (amino acids 1–219) is practically identical to the N-terminal truncated mouse nibrin fragment already expressed from the targeted alleles in these cells (amino acids 1–195 from Nbn{Delta}6 and 1–203 from Nbnins-6), survival must be attributed to the C-terminal fragment. These results support the notion that NBS patients survive owing to the expression, possibly only during embryonic development, of this nibrin protein fragment.

The functions of nibrin in cell survival and radioresistance can be evidently separated by the inducible mouse model presented here. Spontaneous chromosomal instability is characteristic for NBS; however, the level of aberrant mitotic cells seen, at least in stimulated lymphocytes, is variable, ranging from 10 to 45% of cells (2,33). Unchallenged null mutant splenic lymphocytes isolated after induction of homozygosity in vivo or in vitro show a high level of spontaneous chromosome breakage: >20% of mitotic cells are chromosomally aberrant. In contrast, embryonic fibroblasts from a viable mouse model with a hypomorphic mutation leading to expression of an 80 kDa C-terminal nibrin fragment have no increased spontaneous chromosomal instability, although they do show increased breakage in comparison with wild-type cells after IR (23). Again, this implies that the p70 nibrin fragment is able to carry out some of the cellular functions of full-length nibrin in DNA-repair and/or cell cycle checkpoints.

Complete lack of nibrin, on the other hand, leads to cell death, at least during competition with heterozygous cells in vitro. Poor proliferation has been described for embryonic fibroblasts isolated from a mouse model in which a 75 kDa C-terminal nibrin fragment is produced (22). Indeed, after six passages these cells ceased to grow. In another vertebrate system, chicken DT40 cells, null mutation of the NBS1 homologue also leads to a loss of cell proliferation (19). These findings presumably reflect the accumulation of mutations with each cell cycle.

Of the organs examined after in vivo induction of homozygosity, there was no detrimental effect on cell survival in non-proliferating tissues such as liver, kidney and muscle even though nibrin is clearly expressed in these tissues (4,34). There was, however, a dramatic effect in the bone marrow: 50% of null mutant cells were lost in this tissue. This can clearly be correlated with the mitotic activity of haematopoietic stem cells and lymphocyte progenitors in this organ, which are likely to be particularly sensitive to the effects of mutation accumulation. In this respect, haematopoietic stem cells resemble embryonic stem cells during early embryogenesis, which are also particularly sensitive to nibrin null mutation (20,22).

Even more striking than bone marrow is the effect in the thymus. Few null mutant cells survive in this organ, suggesting that T-cell specific processes, such as T-cell receptor gene rearrangement, may be nibrin-dependent with abortive gene rearrangement leading to cell death. In a hypomorphic Nbn mouse model, greatly reduced thymus cellularity and a 5-fold reduction in mature CD4+ thymocytes were observed (22). Thus, the effects of null mutation and a hypomorphic mutation are essentially identical, and the truncated nibrin protein is unable to carry out the processes required for T-cell maturation, particularly T-cell receptor gene rearrangement.

A significant deficiency of nibrin null mutant cells was also found in the spleen after induction of homozygosity in vivo. As the spleen is a major reservoir for lymphocytes, the reduced recovery of homozygous cells from this organ may merely reflect their prior loss in the bone marrow. However, the process of isotype class switching in B-lymphocytes might, if nibrin were in fact involved, also contribute to the loss of Nbn null mutant cells in the spleen. Indeed, Nbn expression is particularly high in adult spleen (34,35) with an expression pattern closely resembling that of DNA-PKcs (36), an enzyme involved in NHEJ during V(D)J recombination.

The role of nibrin in DNA repair is more relevant to the disease, NBS, than its role in the G2/M checkpoint
Nibrin is clearly a protein essential for viability of proliferating cells. Cell death can be ascribed to the accumulation of massive chromosomal damage even in the absence of exogenous DNA-damaging agents. As expression of a C-terminal nibrin fragment is sufficient to ensure cellular viability, individuals with hypomorphic mutations in the human NBS1 gene survive, but are radiosensitive and cancer-prone. The relative importance of the cell cycle checkpoints and DNA repair activities of nibrin for the features of the disease have been previously addressed (9,37). A comparison of the null mutant cells described here with patient cells may help clarify this issue.

Even in the absence of exogenous DNA damaging agents, DSBs are accumulated in the cell during DNA replication and must be repaired before entry into mitosis. Analysis of SV40 transformed NBS LB1 fibroblasts, which express relatively large amounts of p70 (comparable to SV40 transformed GM7166VA7 fibroblasts; Fig. 2D) demonstrated that these cells arrest normally in response to DNA damage (38). Similarly, EBV immortalized NBS B cells, which also express truncated nibrin (17), have a functional G2/M checkpoint (38,39). This would suggest that the p70 protein fragment in patient cells is able to sustain this aspect of nibrin function. However, the p70 fragment is not phosphorylated by ATM (data not shown), presumably because the FHA/BRCT domains required for ATM-mediated phosphorylation (32) are not present. Thus, it is unlikely that the sustained G2/M checkpoint observed in patient cells is due to activity of p70 downstream of ATM.

Co-immunoprecipitation experiments have demonstrated that the p70 nibrin fragment is able to form a complex with MRE11 and RAD50 (17); this faulty complex may be sufficient to function in activating ATM. Indeed, activation of ATM does occur, although at a considerably reduced rate (16), in EBV immortalized NBS B cells and in GM7166VA7 NBS fibroblasts, which also express p70 (Fig. 2D) (40). In the complete absence of nibrin, as in the null mutant murine cells presented here, ATM is not activated by DNA damage incurred earlier in the cell cycle and, subsequently, the G2/M checkpoint is not triggered. As could be expected from this, in comparison with wild-type cells, further mutagenic attack in null mutants leads to an increase in chromosome breaks per cell rather than an increase in the proportion of damaged cells (Fig. 5B).

The ability of the 657{Delta}5 mutant cDNA to promote cell survival of null mutant cells in vitro stems most likely from residual activation of ATM by a partially functioning M/R/N complex, and thus maintenance of the G2/M checkpoint. The radiosensitivity of NBS patients would consequently be attributable more specifically to nibrin function(s) in DSB repair rather than in the control of this cell cycle checkpoint.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Nbn-Targeting vector
The targeting vector shown in Figure 1 was generated by ligating Nbn sequences amplified from mouse 129/Sv genomic DNA into the vector, pTV-Flox (a gift from Dr Dieter Rietmacher). Murine Nbn exon primers were used to amplify the 8 kb sequence encompassing Nbn exons 3–6 and 6–8 by long-range PCR using a high-fidelity polymerase (Expand Long Template System, Roche); the PCR products were then sequenced and the derived intronic sequences were used for designing primers to amplify fragments for the targeting vector.

A 2.4 kb fragment containing 750 bp of Nbn intron 5, the entire exon 6, intron 6, exon 7 and 81 bp of intron 7 was amplified with the primers: gctggctatgtgaagactac (forward) and BamHI-cccttgtagactctttggta (reverse). After digestion of this fragment with BamHI and XbaI (located in intron 5) the resulting 2.2 kb sequence was ligated into BamHI–XbaI-cleaved pT7T3 (Pharmacia). An unique AvaI restriction site in Nbn intron 6 was used to insert a 42 bp AvaI-flanked oligonucleotide containing a loxP sequence. A fragment containing Nbn exon 6, intron 6 and exon 7, with flanking intronic sequences was excised using BamHI and HpaI (located in intron 5) and ligated into the pTV-Flox vector at BamHI and HpaI sites. A second, 4 kb PCR product containing most of Nbn intron 5, was generated using the primers: NotI–aatgtaaggacaatgaatga (forward) and tgttttctttcatgtcgccc (reverse). This product was cut with NotI and XbaI (located in intron 5) and ligated into the prepared targeting vector at NotI/XbaI sites. The targeting vector was sequenced to verify the integrity of the Nbn coding sequences and splice junctions.

Embryonic stem cell electroporation and blastocyst injection
The targeting vector was linearized with NotI and then electroporated into E14.1 ES cells. After selection with 0.2 mg/ml G-418 and 2 µM gancyclovir, targeted ES clones were preliminarily identified by PCR using primers located in the neomycin resistance gene cassette and in intron 7 of Nbn. Analysis of 600 clones yielded 12 clones, with HR in the Nbn gene. Targeting was verified by Southern blot analysis after NheI digestion and hybridization with a sequence from exon 5 as a probe (Fig. 2A). One ES clone was electroporated with pMC-Cre, a Cre recombinase expression vector, plated at low density and 28 G418-sensitive clones were isolated and characterized. Two clones were identified that had undergone recombination removing the neomycin-resistance cassette and one loxP site, but leaving Nbn exon 6 flanked by loxP sites (Nbnwt/lox-6). Eleven clones had both the neomycin-resistance cassette and exon 6 deleted leaving just one intact loxP site (Nbnwt/{Delta}6). Both the Nbnwt/lox-6 and Nbnwt/{Delta}6 ES cell clones were microinjected into C57Bl/6 blastocysts and implanted into pseudopregnant recipients. Chimeras were mated with 129/Sv mice and germline transmission was verified by PCR analysis and Southern blot as detailed earlier.

Mouse genotyping
The Nbn alleles with variations in exon 6 were routinely distinguished by PCR analysis on DNA isolated from tail biopsies of mice using the following primer pairs for Nbnwt, Nbnlox-6 and Nbn{Delta}6 alleles: forward primer, gctggctatgtgaagactac, located in intron 5; and reverse primer, aatacagtgactcctggagg, located in intron 6. Product sizes: Nbnwt, 1148 bp; Nbnlox-6, 877 bp; Nbn{Delta}6, 299 bp (Fig. 2B). For the Nbnins-6 allele, the primers were: forward primer, cctgcttgccgaatatcatg, located in the G418-resistance cassette inserted into exon 6; and reverse primer, ctactcccatacacagacag, located in intron 6, the specific product is 411 bp.

Mouse breeding and induction of Nbn-homozygosity in vivo
To induce Nbn null mutation in vivo, Nbnlox-6/{Delta}6 and Nbnwt/ins-6 mice were crossed with Tg-Mx1-Cre mice, which express Cre recombinase under the control of the interferon responsive promoter, Mx1 (24). Mice were identified by PCR genotyping of DNA isolated from tail biopsies and further crossed to produce the target animals: Nbn{Delta}6/lox-6-Tg-Mx1-Cre, Nbnwt/lox-6-Tg-Mx1-Cre and Nbnins-6/lox-6-Tg-Mx1-Cre.

Cre expression was induced in transgenic Mx1-Cre mice in vivo by intraperitoneal injection of the interferon inducer, poly(I):poly(C) (Amersham-Pharmacia). Each mouse received three 250 µl injections of a 2 mg/ml solution of poly(I):poly(C) in water every 48 h. Mice were analysed 15 days after the first injection. Organs were removed from mice after cervical dislocation and portions processed for DNA isolation and quantification of exon 6 deletion.

Semi-quantitative PCR for the estimation of Cre recombinase-mediated Nbn exon 6 deletion
Primers were selected which amplify similarly sized products from the three alleles: Nbnwt, Nbn{Delta}6 and Nbnlox-6. The two forward primers are, ataagacagtcaccac, located in intron 5 of the Nbn gene 5' to the first loxP site and gcttggctcaagtagtactg located in intron 5 downstream to the first loxP site but 5' to exon 6. The reverse fluorescein-labelled primer is cctccaggagtcactgtatt located 3' to the second loxP site. The sizes of the amplified products are: Nbnwt, 515 bp; Nbn{Delta}6, 601 bp; Nbnlox-6, 554 bp. Undenatured PCR products were separated on native 12% polyacrylamide gels, which were then analysed in the ‘vistra FluorImager SI’ (Amersham Life Science) using bandpass emission filter 530 DF 30 and ImageQuaNT software (Molecular Dynamics, version 5.2).

The linearity of response was tested by amplifying Nbnlox-6/{Delta}6 genomic DNA under standard conditions for 24–28 cycles. All further semi-quantitative PCRs were conducted with 27 cycles. The accuracy and variance of the semi-quantitative PCR measurements were determined by amplifying artificial mixtures of Nbnwt/wt and Nbnlox-6/lox-6 or Nbnlox-6/{Delta}6 and Nbnlox-6/lox-6 genomic DNAs. The measured ratios of Nbnlox-6, Nbnwt and Nbn{Delta}6 alleles were compared with the actual ratios of genomic DNA in the mixtures (Supplementary Material, Fig. S1).

Induction of Nbn-homozygosity in fibroblasts in vitro
Crosses were set up between Nbnlox-6/lox-6 and Nbnwt/ins-6 mice (20) to produce Nbnlox-6/ins-6 and Nbnwt/lox-6 mice for deletion of exon 6, and generation of homozygosity, by treatment of fibroblasts and lymphocytes in vitro with Cre recombinase. Dermal fibroblasts were isolated from ear biopsies of Nbnlox-6/ins-6, Nbnlox-6/wtand wild-type mice and grown in Dulbeccos's modified Eagle's medium (DMEM) with 10% fetal calf serum (FCS) at 37°C, 5% CO2. Spontaneous transformation occurred regularly before passage 12, after which cells were cryopreserved.

Cre recombinase was isolated as the fusion protein, HTNC, consisting of a His-tag, the HIV-tat sequence, a nuclear localization sequence and Cre recombinase, from Escherichia coli carrying the pTriEx-HTNC expression plasmid as previously described (26). For in vitro deletion experiments, fibroblasts at 50% confluence were incubated at 37°C for 6 h in serum-free medium with 2 µM HTNC. Cells were then washed and returned to culture in DMEM with 10% FCS. Cultures were routinely split 1 : 5 at confluence, generally every 2 days.

Mouse lymphocytes were isolated by spleen disruption through a 80 µm cell sieve (Becton Dickinson, USA) and incubated in 1 µM HTNC in RPMI without serum for 2 h followed by washing and cultivation in RPMI with 10% FCS, 6 µg/ml concanavalin A (Sigma–Aldrich) and 40 µg/ml bacterial lipopolysaccharide (Sigma–Aldrich). Stimulated lymphocytes were harvested for chromosome preparation by standard protocols after 3 days of cultivation. For examination of chromosome breakage induced by the radiomimetic bleomycin (Medac, Germany), cultures were incubated in the drug for 3 h before harvesting and chromosome preparation.

Mitotic index determination by flow cytometry
The method employed was previously described for the analysis of the G2/M checkpoint in NBS patient cells (38). Briefly, mouse fibroblasts with the genotypes Nbnlox-6/ins-6 and Nbnlox-6/wt were treated as described with HTNC to delete the loxP-flanked exon 6. After 24 h, the cultures were split and after 48 h incubated with increasing concentrations of bleomycin (Medac) for 2 h. Cells were fixed in 75% ice-cold ethanol, and permeabilized for 10 min on ice in 0.1% Triton X-100 in phosphate buffered saline (PBS) containing 1% bovine serum albumin (BSA). After washing, the cells were incubated for 2 h at room temperature in 1% BSA in PBS with a polyclonal rabbit anti-phosphorylated histone H3 antibody (Upstate Biotechnology, USA) at 1 : 100 dilution. The cells were washed and incubated in 1% BSA in PBS with a Cy2-conjugated goat anti-rabbit antiserum (Jackson ImmunoResearch) at 1 : 100 dilution. The cells were washed and stained with propidium iodide at 25 µg/ml in 1% BSA in PBS containing 100 µg/ml RNase A. Cytometry was performed in the FACSCalibur (Becton Dickinson), at least 20 000 cells were counted per sample. Data were analysed with the WinMDI version 2.5 software.

Western analysis
Whole cell extracts were prepared by cell lysis in RIPA buffer and were separated on 8% polyacrylamide SDS gels. Proteins were electroblotted to nitrocellulose membranes, blocked in 5% dried milk in TBST and probed with a rabbit polyclonal anti-murine nibrin antiserum (20) or a rabbit polyclonal anti-human nibrin antiserum (Novus Biologicals) for 1 h at room temperature followed by incubation with horseradish peroxidase-conjugated secondary antibody diluted 1 : 1000. Chemiluminescent detection was performed using the ECL reagents (Amersham).


    SUPPLEMENTARY MATERIAL
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Supplementary Material is available at HMG Online.


    ACKNOWLEDGEMENTS
 
We are indebted to our colleagues for the kind provision of reagents: Dr Pat Concannon for the retroviral vector pLXIN-NBS1, Dr Kenshi Komatsu for the SV40 transformed NBS cell line, GM7166VA7, Dr Dieter Rietmacher for the targeting vector, pTV-FLOX and Dr Frank Edenhofer for the bacterial vector, pTriEx-HTNC. Ms Janina Radszewski and Mrs Susanne Rothe are gratefully acknowledged for their excellent technical assistance. P.-O.F. is the recipient of a fellowship from the Comité départmental de la Ligue Nationale contre le Cancer de Haute-Savoie (2000–2002), the Association de la Recherche pour le Cancer (ARC) (2002–2003) and Ligue Nationale contre le Cancer (2004). This work was supported by the Deutsche Forschungsgemeinschaft (SFB577).


    FOOTNOTES
 
* To whom correspondence should be addressed. Tel: +49 30450566016; Fax: +49 30450566904; Email: martin.digweed{at}charite.de

{dagger} Present address: Molecular Genetics Program, Benaroya Research Institute at Virginia Mason, Seattle, WA 98101, USA. Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 

  1. Seemanova, E., Passarge, E., Beneskova, D., Houstek, J., Kasal, P. and Sevcikova, M. (1985) Familial microcephaly with normal intelligence, immunodeficiency, and risk for lymphoreticular malignancies: a new autosomal recessive disorder. Am. J. Med. Genet., 20, 639–648.[CrossRef][Web of Science][Medline]

  2. Chrzanowska, K.H., Kleijer, W.J., Krajewska-Walasek, M., Bialecka, M., Gutkowska, A., Goryluk-Kozakiewicz, B., Michalkiewicz, J., Stachowski, J., Gregorek, H., Lyson-Wojciechowska, G. et al. (1995) Eleven Polish patients with microcephaly, immunodeficiency, and chromosomal instability: the Nijmegen breakage syndrome. Am. J. Med. Genet., 57, 462–471.[CrossRef][Web of Science][Medline]

  3. Saar, K., Chrzanowska, K.H., Stumm, M., Jung, M., Nurnberg, G., Wienker, T.F., Seemanova, E., Wegner, R.D., Reis, A. and Sperling, K. (1997) The gene for the ataxia-telangiectasia variant, Nijmegen breakage syndrome, maps to a 1-cM interval on chromosome 8q21. Am. J. Hum. Genet., 60, 605–610.[Web of Science][Medline]

  4. Varon, R., Vissinga, C., Platzer, M., Cerosaletti, K.M., Chrzanowska, K.H., Saar, K., Beckmann, G., Seemanova, E., Cooper, P.R., Nowak, N.J. et al. (1998) Nibrin, a novel DNA double-strand break repair protein, is mutated in Nijmegen breakage syndrome. Cell, 93, 467–476.[CrossRef][Web of Science][Medline]

  5. Carney, J.P., Maser, R.S., Olivares, H., Davis, E.M., Le Beau, M., Yates, J.R., III, Hays, L., Morgan, W.F. and Petrini, J.H. (1998) The hMre11/hRad50 protein complex and Nijmegen breakage syndrome: linkage of double-strand break repair to the cellular DNA damage response. Cell, 93, 477–486.[CrossRef][Web of Science][Medline]

  6. Schiestl, R.H., Zhu, J. and Petes, T.D. (1994) Effect of mutations in genes affecting homologous recombination on restriction enzyme-mediated and illegitimate recombination in Saccharomyces cerevisiae. Mol. Cell. Biol., 14, 4493–4500.[Abstract/Free Full Text]

  7. Bressan, D.A., Baxter, B.K. and Petrini, J.H. (1999) The Mre11–Rad50–Xrs2 protein complex facilitates homologous recombination-based double-strand break repair in Saccharomyces cerevisiae. Mol. Cell. Biol., 19, 7681–7687.[Abstract/Free Full Text]

  8. Harfst, E., Cooper, S., Neubauer, S., Distel, L. and Grawunder, U. (2000) Normal V(D)J recombination in cells from patients with Nijmegen breakage syndrome. Mol. Immunol., 37, 915–929.[CrossRef][Web of Science][Medline]

  9. Kraakman-van der Zwet, M., Overkamp, W.J., Friedl, A.A., Klein, B., Verhaegh, G.W., Jaspers, N.G., Midro, A.T., Eckardt-Schupp, F., Lohman, P.H. and Zdzienicka, M.Z. (1999) Immortalization and characterization of Nijmegen breakage syndrome fibroblasts. Mutat. Res., 434, 17–27.[Web of Science][Medline]

  10. Sullivan, K.E., Veksler, E., Lederman, H. and Lees-Miller, S.P. (1997) Cell cycle checkpoints and DNA repair in Nijmegen breakage syndrome. Clin. Immunol. Immunopathol., 82, 43–48.[CrossRef][Web of Science][Medline]

  11. Yeo, T.C., Xia, D., Hassouneh, S., Yang, X.O., Sabath, D.E., Sperling, K., Gatti, R.A., Concannon, P. and Willerford, D.M. (2000) V(D)J rearrangement in Nijmegen breakage syndrome. Mol. Immunol., 37, 1131–1139.[CrossRef][Web of Science][Medline]

  12. Gatei, M., Young, D., Cerosaletti, K.M., Desai-Mehta, A., Spring, K., Kozlov, S., Lavin, M.F., Gatti, R.A., Concannon, P. and Khanna, K. (2000) ATM-dependent phosphorylation of nibrin in response to radiation exposure. Nat. Genet., 25, 115–119.[CrossRef][Web of Science][Medline]

  13. Wu, X., Ranganathan, V., Weisman, D.S., Heine, W.F., Ciccone, D.N., O'Neill, T.B., Crick, K.E., Pierce, K.A., Lane, W.S., Rathbun, G. et al. (2000) ATM phosphorylation of Nijmegen breakage syndrome protein is required in a DNA damage response. Nature, 405, 477–482.[CrossRef][Medline]

  14. Buscemi, G., Savio, C., Zannini, L., Micciche, F., Masnada, D., Nakanishi, M., Tauchi, H., Komatsu, K., Mizutani, S., Khanna, K. et al. (2001) Chk2 activation dependence on Nbs1 after DNA damage. Mol. Cell. Biol., 21, 5214–5222.[Abstract/Free Full Text]

  15. Falck, J., Petrini, J.H., Williams, B.R., Lukas, J. and Bartek, J. (2002) The DNA damage-dependent intra-S phase checkpoint is regulated by parallel pathways. Nat. Genet., 30, 290–294.[CrossRef][Web of Science][Medline]

  16. Uziel, T., Lerenthal, Y., Moyal, L., Andegeko, Y., Mittelman, L. and Shiloh, Y. (2003) Requirement of the MRN complex for ATM activation by DNA damage. EMBO J., 22, 5612–5621.[CrossRef][Web of Science][Medline]

  17. Maser, R.S., Zinkel, R. and Petrini, J.H. (2001) An alternative mode of translation permits production of a variant NBS1 protein from the common Nijmegen breakage syndrome allele. Nat. Genet., 27, 417–421.[CrossRef][Web of Science][Medline]

  18. Tanzanella, C., Antoccia, A., Spadoni, E., di Masi, A., Pecile, V., Demori, E., Varon, R., Marseglia, G.L., Tiepolo, L. and Maraschio, P. (2003) Chromosome instability and nibrin protein variants in NBS heterozygotes. Eur. J. Hum. Genet., 11, 297–303.[CrossRef][Web of Science][Medline]

  19. Tauchi, H., Kobayashi, J., Morishima, K., van Gent, D.C., Shiraishi, T., Verkaik, N.S., van Heems, D., Ito, E., Nakamura, A., Sonoda, E. et al. (2002) Nbs1 is essential for DNA repair by homologous recombination in higher vertebrate cells. Nature, 420, 93–98.[CrossRef][Medline]

  20. Dumon-Jones, V., Frappart, P.O., Tong, W.M., Sajithlal, G., Hulla, W., Schmid, G., Herceg, Z., Digweed, M. and Wang, Z.Q. (2003) Nbn heterozygosity renders mice susceptible to tumor formation and ionizing radiation-induced tumorigenesis. Cancer Res., 63, 7263–7269.[Abstract/Free Full Text]

  21. Zhu, J., Petersen, S., Tessarollo, L. and Nussenzweig, A. (2001) Targeted disruption of the Nijmegen breakage syndrome gene NBS1 leads to early embryonic lethality in mice. Curr. Biol., 11, 105–109.[CrossRef][Web of Science][Medline]

  22. Kang, J., Bronson, R.T. and Xu, Y. (2002) Targeted disruption of NBS1 reveals its roles in mouse development and DNA repair. EMBO J., 21, 1447–1455.[CrossRef][Web of Science][Medline]

  23. Williams, B.R., Mirzoeva, O.K., Morgan, W.F., Lin, J., Dunnick, W. and Petrini, J.H. (2002) A murine model of Nijmegen breakage syndrome. Curr. Biol., 12, 648–653.[CrossRef][Web of Science][Medline]

  24. Kuhn, R., Schwenk, F., Aguet, M. and Rajewsky, K. (1995) Inducible gene targeting in mice. Science, 269, 1427–1429.[Abstract/Free Full Text]

  25. Betz, U.A., Vosshenrich, C.A., Rajewsky, K. and Muller, W. (1996) Bypass of lethality with mosaic mice generated by Cre–loxP-mediated recombination. Curr. Biol., 6, 1307–1316.[CrossRef][Web of Science][Medline]

  26. Peitz, M., Pfannkuche, K., Rajewsky, K. and Edenhofer, F. (2002) Ability of the hydrophobic FGF and basic TAT peptides to promote cellular uptake of recombinant Cre recombinase: a tool for efficient genetic engineering of mammalian genomes. Proc. Natl Acad. Sci. USA, 99, 4489–4494.[Abstract/Free Full Text]

  27. Cerosaletti, K.M., Desai-Mehta, A., Yeo, T.C., Kraakman-Van Der Zwet, M., Zdzienicka, M.Z. and Concannon, P. (2000) Retroviral expression of the NBS1 gene in cultured Nijmegen breakage syndrome cells restores normal radiation sensitivity and nuclear focus formation. Mutagenesis, 15, 281–286.[Abstract/Free Full Text]

  28. Luo, G., Yao, M.S., Bender, C.F., Mills, M., Bladl, A.R., Bradley, A. and Petrini, J.H. (1999) Disruption of mRad50 causes embryonic stem cell lethality, abnormal embryonic development, and sensitivity to ionizing radiation. Proc. Natl Acad. Sci. USA, 96, 7376–7381.[Abstract/Free Full Text]

  29. Xiao, Y. and Weaver, D.T. (1997) Conditional gene targeted deletion by Cre recombinase demonstrates the requirement for the double-strand break repair Mre11 protein in murine embryonic stem cells. Nucl. Acids Res., 25, 2985–2991.[Abstract/Free Full Text]

  30. Desai-Mehta, A., Cerosaletti, K.M. and Concannon, P. (2001) Distinct functional domains of nibrin mediate Mre11 binding, focus formation, and nuclear localization. Mol. Cell. Biol., 21, 2184–2191.[Abstract/Free Full Text]

  31. Tauchi, H., Kobayashi, J., Morishima, K., Matsuura, S., Nakamura, A., Shiraishi, T., Ito, E., Masnada, D., Delia, D. and Komatsu, K. (2001) The forkhead-associated domain of NBS1 is essential for nuclear foci formation after irradiation but not essential for hRAD50/hMRE11/NBS1 complex DNA repair activity. J. Biol. Chem., 276, 12–15.[Abstract/Free Full Text]

  32. Cerosaletti, K.M. and Concannon, P. (2003) Nibrin forkhead-associated domain and breast cancer C-terminal domain are both required for nuclear focus formation and phosphorylation. J. Biol. Chem., 278, 21944–21951.[Abstract/Free Full Text]

  33. The International Nijmegen Breakage Syndrome Study Group. (2000) Nijmegen breakage syndrome. Arch. Dis. Child, 82, 400–406.[Abstract/Free Full Text]

  34. Wilda, M., Demuth, I., Concannon, P., Sperling, K. and Hameister, H. (2000) Expression pattern of the Nijmegen breakage syndrome gene, Nbs1, during murine development. Hum. Mol. Genet., 9, 1739–1744.[Abstract/Free Full Text]

  35. Vissinga, C.S., Yeo, T.C., Woessner, J., Massa, H.F., Wilson, R.K., Trask, B.J. and Concannon, P. (1999) Identification, characterization, and mapping of a mouse homolog of the gene mutated in Nijmegen breakage syndrome. Cytogenet. Cell Genet., 87, 80–84.[CrossRef][Web of Science][Medline]

  36. Moll, U., Lau, R., Sypes, M.A., Gupta, M.M. and Anderson, C.W. (1999) DNA-PK, the DNA-activated protein kinase, is differentially expressed in normal and malignant human tissues. Oncogene, 18, 3114–3126.[CrossRef][Web of Science][Medline]

  37. Girard, P.M., Foray, N., Stumm, M., Waugh, A., Riballo, E., Maser, R.S., Phillips, W.P., Petrini, J., Arlett, C.F. and Jeggo, P.A. (2000) Radiosensitivity in Nijmegen breakage syndrome cells is attributable to a repair defect and not cell cycle checkpoint defects. Cancer Res., 60, 4881–4888.[Abstract/Free Full Text]

  38. Xu, B., Kim, S.T., Lim, D.S. and Kastan, M.B. (2002) Two molecularly distinct G(2)/M checkpoints are induced by ionizing irradiation. Mol. Cell. Biol., 22, 1049–1059.[Abstract/Free Full Text]

  39. Antoccia, A., Ricordy, R., Maraschio, P., Prudente, S. and Tanzarella, C. (1997) Chromosomal sensitivity to clastogenic agents and cell cycle perturbations in Nijmegen breakage syndrome lymphoblastoid cell lines. Int. J. Radiat. Biol., 71, 41–49.[CrossRef][Web of Science][Medline]

  40. Ito, A., Tauchi, H., Kobayashi, J., Morishima, K., Nakamura, A., Hirokawa, Y., Matsuura, S., Ito, K. and Komatsu, K. (1999) Expression of full-length NBS1 protein restores normal radiation responses in cells from Nijmegen breakage syndrome patients. Biochem. Biophys. Res. Commun., 265, 716–721.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
C. S. Vissinga, T. C. Yeo, S. Warren, J. V. Brawley, J. Phillips, K. Cerosaletti, and P. Concannon
Nuclear Export of NBN Is Required for Normal Cellular Responses to Radiation
Mol. Cell. Biol., February 15, 2009; 29(4): 1000 - 1006.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. A. Adelman, S. De, and J. H. J. Petrini
Rad50 Is Dispensable for the Maintenance and Viability of Postmitotic Tissues
Mol. Cell. Biol., January 15, 2009; 29(2): 483 - 492.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
K. Matsuzaki, A. Shinohara, and M. Shinohara
Forkhead-Associated Domain of Yeast Xrs2, a Homolog of Human Nbs1, Promotes Nonhomologous End Joining Through Interaction With a Ligase IV Partner Protein, Lif1
Genetics, May 1, 2008; 179(1): 213 - 225.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
S. Difilippantonio, A. Celeste, M. J. Kruhlak, Y. Lee, M. J. Difilippantonio, L. Feigenbaum, S. P. Jackson, P. J. McKinnon, and A. Nussenzweig
Distinct domains in Nbs1 regulate irradiation-induced checkpoints and apoptosis
J. Exp. Med., May 14, 2007; 204(5): 1003 - 1011.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
L. Kruger, I. Demuth, H. Neitzel, R. Varon, K. Sperling, K. H. Chrzanowska, E. Seemanova, and M. Digweed
Cancer incidence in Nijmegen breakage syndrome is modulated by the amount of a variant NBS protein
Carcinogenesis, January 1, 2007; 28(1): 107 - 111.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
J. Lu, Q. Wei, M. L. Bondy, D. Li, A. Brewster, S. Shete, T.-K. Yu, A. Sahin, F. Meric-Bernstam, K. K. Hunt, et al.
Polymorphisms and haplotypes of the NBS1 gene are associated with risk of sporadic breast cancer in non-Hispanic white women <=55 years
Carcinogenesis, November 1, 2006; 27(11): 2209 - 2216.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
R. Varon, V. Dutrannoy, G. Weikert, C. Tanzarella, A. Antoccia, L. Stockl, E. Spadoni, L.-A. Kruger, A. d. Masi, K. Sperling, et al.
Mild Nijmegen breakage syndrome phenotype due to alternative splicing
Hum. Mol. Genet., March 1, 2006; 15(5): 679 - 689.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
E Seemanova, K Sperling, H Neitzel, R Varon, J Hadac, O Butova, E Schrock, P Seeman, and M Digweed
Nijmegen breakage syndrome (NBS) with neurological abnormalities and without chromosomal instability
J. Med. Genet., March 1, 2006; 43(3): 218 - 224.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Z. You, C. Chahwan, J. Bailis, T. Hunter, and P. Russell
ATM Activation and Its Recruitment to Damaged DNA Require Binding to the C Terminus of Nbs1
Mol. Cell. Biol., July 1, 2005; 25(13): 5363 - 5379.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
C Hughes, A Murphy, C Martin, O Sheils, and J O'Leary
Molecular pathology of prostate cancer
J. Clin. Pathol., July 1, 2005; 58(7): 673 - 684.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
D. French, M. R. Wilkinson, W. Yang, L. de Chaisemartin, E. H. Cook, S. Das, M. J. Ratain, W. E. Evans, J. R. Downing, C.-H. Pui, et al.
Global gene expression as a function of germline genetic variation
Hum. Mol. Genet., June 15, 2005; 14(12): 1621 - 1629.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. E. Clatworthy, M. A. Valencia-Burton, J. E. Haber, and M. A. Oettinger
The MRE11-RAD50-XRS2 Complex, in Addition to Other Non-homologous End-joining Factors, Is Required for V(D)J Joining in Yeast
J. Biol. Chem., May 27, 2005; 280(21): 20247 - 20252.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Kracker, Y. Bergmann, I. Demuth, P.-O. Frappart, G. Hildebrand, R. Christine, Z.-Q. Wang, K. Sperling, M. Digweed, and A. Radbruch
Nibrin functions in Ig class-switch recombination
PNAS, February 1, 2005; 102(5): 1584 - 1589.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow All Versions of this Article:
13/20/2385    most recent
ddh278v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (23)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Demuth, I.
Right arrow Articles by Digweed, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Demuth, I.
Right arrow Articles by Digweed, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?