Human Molecular Genetics Advance Access originally published online on September 14, 2004
Human Molecular Genetics 2004 13(21):2595-2606; doi:10.1093/hmg/ddh292
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Human Molecular Genetics, Vol. 13, No. 21 © Oxford University Press 2004; all rights reserved
Requirement of the forkhead gene Foxe1, a target of sonic hedgehog signaling, in hair follicle morphogenesis


1Telethon Institute of Genetics and Medicine (TIGEM), via Pietro Castellino 111, 80131 Napoli, Italy, 2Department of Dermatology and Comprehensive Cancer Center, University of Michigan, 1500 E. Medical Center Drive, Ann Arbor, MI, USA and 3Stazione Zoologica A. Dohrn, Villa Comunale 1, 80121 Napoli, Italy
Received July 7, 2004; Accepted September 6, 2004
| ABSTRACT |
|---|
|
|
|---|
The forkhead transcription factor FOXE1 is mutated in patients with BamforthLazarus syndrome that exhibit hair follicle defects, suggesting a possible role for Foxe1 in hair follicle morphogenesis. Here, we report that Foxe1 is specifically expressed in the lower undifferentiated compartment of the hair follicle, at a time and site that parallel activation of the Shh signaling pathway. The Foxe1 protein is also expressed in human and mouse basal cell carcinoma in which hedgehog signaling is constitutively activated, whereas it is undetectable in normal epidermis and squamous cell carcinoma. Moreover, expression of a dominant-negative form of Gli2 in skin results in complete suppression of Foxe1 expression in the hair follicle, whereas transcriptionally active Gli2 stimulates activity of the Foxe1 promoter. Foxe1-null skin displays aberrant hair formation with the production of thinner and curly pelage hairs. Although the hair follicle internal structure is conserved and several lineage markers are properly expressed, the orderly downgrowth of follicles is strikingly disrupted, causing disorientation, misalignment and aberrantly shaped of hair follicles. Our findings provide a strong indication that the defect in BamforthLazarus syndrome is due to altered FOXE1 function in the hair follicle, and is independent of systemic defects present in affected individuals. In addition, we establish Foxe1 as a downstream target of the Shh/Gli pathway in hair follicle morphogenesis, and as a crucial player for correct hair follicle orientation into the dermis and subcutis.
| INTRODUCTION |
|---|
|
|
|---|
The mammalian Forkhead Box (Fox) family of transcription factors consists of more than 50 proteins that are involved in biological processes such as tissue-specific transcription, cell fate determination during embryogenesis and cell survival (1).
Some forkhead genes have been associated with human developmental disorders, including immune, skeletal, circulatory, eye and skin defects (reviewed in 2). Mutations in the forkhead gene FOXE1/TTF-2 cause the BamforthLazarus syndrome (OMIM 241850), a rare autosomal-recessive condition characterized by congenital hypothyroidism, thyroid dysgenesis, cleft palate and abnormal hair growth (35). During mouse embryogenesis, Foxe1 is expressed in the foregut endoderm, in the craniopharyngeal ectoderm and in the thyroid primordium (6,7). Foxe1 was first isolated as a thyroid-specific protein able to regulate transcription of the target genes, thyroglobulin and thyroid peroxidase, by binding to specific regulatory DNA sequences in their promoters (79). In vivo studies revealed that Foxe1 null mice either lack the thyroid gland or the gland is small and ectopic, but fully differentiated, indicating a crucial role of Foxe1 in thyroid morphogenesis (10). In these mice, the thyroid bud is unable to descend from the pharyngeal endoderm to its final destination, suggesting a defect in thyroid bud migration. In addition to defects in thyroid development, Foxe1-null embryos display severe cleft palate and die soon after birth for reasons that are incompletely understood. Thus, a functional Foxe1 protein is required for normal thyroid organogenesis and for secondary palate closure in humans and mice.
A consistent feature of BamforthLazarus patients is sparse and spiky hair with reduced hair shaft diameter and loss of scale patterning, whereas nails and teeth are normal (3). Abnormal hair growth persists despite adequate thyroxin therapy (3). This finding indicates an intrinsic hair follicle abnormality suggesting that Foxe1 may be directly involved.
Hair follicle morphogenesis and terminal differentiation are highly regulated. Morphogenesis begins during embryogenesis in a region-specific manner and is governed by epithelialmesenchymal interactions (11). In response to a mesenchymal cue, ectodermal cells form a hair follicle rather than epidermis and begin to proliferate and grow downward. In response to a subsequent ectodermal message, the underlying mesenchymal cells organize and become a specialized structure called dermal papilla. Finally, in response to a message from the dermal papilla, the developing hair follicle grows and differentiates. The hair follicle is composed of several epithelial layers with different degrees of differentiation. The most external epithelial layer, the outer root sheath (ORS), is the basal compartment of the hair follicle where undifferentiated cells are thought to migrate from the stem cell compartment to replenish the transit amplifying compartment in the matrix of the bulb (1215). In the matrix, epithelial cells come in contact with the dermal papilla and are highly proliferative. When cells leave the matrix, they undergo one of at least seven programs of terminal differentiation, thus forming the various layers of the inner root sheath (IRS) and hair shaft. In postnatal skin, the hair follicle is perpetually renewed and undergoes cycles of proliferation (anagen), regression (catagen) and quiescence (telogen) (reviewed in (1618). Although the upper region of the hair follicle, the sebaceous gland and the dermal papilla are permanent structures, the lower two-thirds of the adult hair follicle proliferates/elongates and regresses depending on the hair cycle phase.
Several developmentally important extracellular signals, such as Wnts, BMPs, TGF-ßs, FGFs and Shh are involved in controlling hair follicle morphogenesis (17,19). Although induction of placode formation and hair follicle patterning are independent of Shh, this molecule is essential for downgrowth of the hair follicle in both embryonic and adult hair follicles. In Shh-null mice, hair follicle morphogenesis is initiated but fails to progress or is substantially delayed (2022). When grafted onto nude mice, Shh-null skin gives rise to abnormal follicles that appear to proliferate and express markers of terminal differentiation, but have a very small dermal papilla and are unable to descend in the deep dermis (20,21).
Shh displays a dynamic pattern of expression in the hair follicle. During embryogenesis, Shh is expressed in the proliferating epithelial cells at the lower tip of the developing follicle. In adult mice, Shh expression is localized in the matrix of the hair follicle bulb and its expression ceases in telogen, whereas it is up-regulated in early anagen, and is required for anagen progression (23,24).
Shh signaling is mediated by the transmembrane receptor Patched (Ptch), which acts by blocking signal transduction mediated by Smoothened (Smo) (25). Once Shh is bound to Ptch, Smo is derepressed and in turn activates gene expression via transcription factors belonging to the Gli family, Gli1, Gli2 and Gli3. Gli1 and Gli3 do not play an essential role in hair follicle formation, as null mice do not have a hair phenotype (26,27). In contrast, Gli2 is likely to be the primary effector of Shh as Gli2 defective mice exhibit an arrest of hair follicle development similar to the one displayed by mice lacking Shh (27).
The Shh signaling pathway is hyperactivated in a variety of hair follicle tumors, including basal cell carcinoma (BCC), the most common human cancer. Loss of function Ptch1 mutations or activating mutations in Smo have been detected in sporadic BCCs and in the Nevoid BCC Syndrome in humans (2831). In addition, Shh target genes Gli1 and Ptch1 are up-regulated in nearly all BCCs examined (29,32,33). Overexpression of Shh, Gli1 or Gli2 in mice also leads to BCC and other hair follicle derived tumors (3437).
The molecular mechanisms downstream of the Shh/Gli signaling pathway that regulate hair follicle morphogenesis, hair cycling and BCC formation are largely unknown. Here, we report evidence that the forkhead domain transcription factor Foxe1 is a downstream target of Shh/Gli in hair follicle morphogenesis as well as in BCC. Importantly, Foxe1 is required for late stages of hair follicle morphogenesis and correct orientation of the hair follicle.
| RESULTS |
|---|
|
|
|---|
Foxe1 is expressed in the undifferentiated compartment of the hair follicle
Mutations in the forkhead protein FOXE1 are associated in humans with a developmental syndrome involving abnormal hair growth. To test whether Foxe1 is directly involved in hair follicle morphogenesis and/or maintenance, we first determined whether Foxe1 is expressed in skin. For this purpose, we isolated total RNA from various adult murine tissues and performed RTPCR with Foxe1-specific oligonucleotides. This analysis revealed robust Foxe1 mRNA expression in adult and newborn skin, whereas none of the other tested tissues expressed Foxe1 (Fig. 1A). Northern blot analysis confirmed Foxe1 mRNA expression in skin (data not shown).
|
To establish the localization of Foxe1 mRNA in skin, in situ hybridization analysis was performed on sections of 10-day-old mouse skin with DIG-labeled cRNA specific for mouse Foxe1. Foxe1 mRNA was readily detectable in the lower portion of the ORS in the hair follicle, whereas there was no expression in the upper part of the hair follicle or in the epidermis (Fig. 1B and data not shown). As control in situ hybridization with specific probes for keratin 17 and caspase 14, specific markers of the entire ORS and of the epidermis, respectively, gave the expected expression pattern (data not shown).
Immunohistochemistry analysis of mouse skin using anti-Foxe1 polyclonal antibodies resulted in nuclear staining in the lower ORS (Fig. 1C). Although the ORS surrounds the entire follicle and is continuous with the basal layer of the interfollicular epidermis, Foxe1 expression was restricted to the lower portion of the ORS, around and just above the hair bulb, thus confirming the in situ expression data. Double immunofluorescence analysis demonstrated that in the lower ORS, Foxe1 protein expression coincided with keratin 14 (K14) and keratin 17 (K17) expressions (data not shown).
In contrast to other ORS markers, such as K14, K17 and p63, Foxe1 could not be detected at early stages of hair follicle morphogenesis. At day 15.5 of embryonic life (E15.5), Foxe1 was absent in the hair bud, whereas it was readily detectable in tongue and thyroid gland (data not shown). Foxe1 expression was first detected at E17.5 only in a very small subset of well-formed hair follicles in few epithelial cells located above the forming dermal papilla (data not shown). Similar localization was present at P0 in a higher number of well-formed follicles between stages 3 and 4, when hair bud keratinocytes migrate downward into the dermis and surround the dermal papilla (11) (Fig. 1D). In the subsequent growing stages, Foxe1 expression was specifically located in the lower ORS.
These data demonstrate that Foxe1 is expressed in skin and is restricted to the undifferentiated, outermost compartment of the hair follicle and specifically to the lower portion that surrounds the bulb.
Foxe1 expression is dependent on the Shh/Gli signaling pathway
Shh gene is expressed in the proliferating epithelial cells at the lower tip of the developing hair follicle (38,39). Similarly Gli1, Gli2 and Ptch1 are expressed in partially overlapping domains in the lower epithelial portion of the hair bulb and ORS, as well as in the dermal papilla (27,40). Our findings that Foxe1 protein is specifically expressed in the lower ORS surrounding the hair bulb raised the possibility that Foxe1 is a target of the Shh/Gli pathway.
In postnatal skin, Shh expression ceases in telogen (quiescent stage), and its up-regulation in early anagen (growing stage) is thought to be crucial for hair follicle growth (23,24). Interestingly, Foxe1 expression displayed similar changes in expression during the hair cycle. In contrast to other ORS markers, such as K14 and p63, Foxe1 protein expression was lost in the first telogen period (Fig. 2A). Foxe1 expression was re-activated in early anagen and maintained in the following anagen steps and in catagen, whereas it was lost again in the subsequent telogen period, which lasts several weeks (data not shown). Interestingly in early anagen Foxe1 expression was localized in a cone of cells well above the developing hair bulb (Fig. 1E), similar to what was observed at beginning of hair follicle morphogenesis. At later stages in the fully developed follicles, Foxe1 was again expressed primarily in the lower ORS (data not shown). Thus, the temporal and spatial expression of Foxe1 in the hair follicle correlates with activation of the Shh signaling pathway.
|
In Shh and Gli2 null mice, hair follicle morphogenesis is arrested before the stage in which Foxe1 is expressed (20,21,27); thus, analysis of Foxe1 expression in the absence of these genes could not be performed. To test whether Shh/Gli signaling is required for Foxe1 expression in vivo, immunohistochemical analysis using anti Foxe1-specific antibodies was performed in transgenic mice expressing Gli2
C4, a transactivation domain mutant of Gli2 that inhibits Gli function in a dominant-negative manner (41). Gli2
C4 transgenic mice display short and malformed hair follicles, but express multiple markers for hair follicle cell lineages (42), H. Sheng and A.A. Dlugosz, manuscript in preparation). Although Foxe1 expression was readily detected in wild-type littermates, no expression could be detected in transgenic mice expressing Gli2
C4 (Fig. 2B). In contrast, K14 expression, used as control of ORS integrity, was unaffected in the presence of Gli dominant-negative mutant. Taken together, these findings indicate that in skin Foxe1 is expressed in a temporal and spatial highly regulated fashion, which parallels Shh activation, and that Shh/Gli signaling is required for Foxe1 expression in the hair follicle.
Foxe1 expression in human and mouse BCC
BCC is a locally invasive tumor of the skin thought to derive from cells of the undifferentiated compartment of the hair follicle, and to be a consequence of inappropriate, sustained activation of the Shh signaling pathway (2933,35,37). To determine whether Foxe1 is expressed under conditions in which the Shh signaling pathway is aberrantly activated, we tested whether FOXE1 was expressed in BCC as compared to normal human skin. Skin sections were immunostained with Foxe1-specific antibodies. Although FOXE1 protein expression was low to undetectable in normal human epidermis, intense nuclear staining was found in BCC (Fig. 3A and data not shown). Fourteen independent BCC samples were tested and all were positive for Foxe1 expression. In contrast, no expression was detected in normal skin or in squamous cell carcinoma (SCC), an epidermal-derived cancer, in which Shh signaling is not activated (reviewed in 43), suggesting that FOXE1 expression is a specific feature of BCC (Fig. 3A).
|
BCC is very uncommon in mice, but can be induced by constitutive activation of Shh signaling (28,3537). Transgenic mice overexpressing the Shh effector Gli2 in keratinocytes develop multiple BCCs (37). Immunohistochemical analysis of BCC derived from Gli2 overexpressing transgenic mice showed that Foxe1 was highly expressed in tumors cells, but not in overlying epidermis or in age-matched control skin (Fig. 3A and data not shown), in parallel with previously reported expression of Gli2, Gli1 and Ptch 1 (37). Induced expression of Foxe1 gene in mouse BCC was confirmed at the RNA level by real-time RTPCR (data not shown).
To further dissect Foxe1 responses to Shh signaling in keratinocytes, we studied skin tumor cell lines derived from transgenic mice expressing a constitutively active form of Gli2 under the control of keratin 5 promoter (Gli2
N2), which displays constitutive activation of the Shh pathway in vitro and in vivo, on the basis of up-regulation of Gli1 and Ptch1 mRNA (34,41). Foxe1 expression was analyzed and compared in Gli2
N2 expressing keratinocyte cell lines versus a similarly treated wild-type keratinocyte cell line, designated WT-7. Although Foxe1 expression at the RNA level was very low in WT-7 cells, it was strongly up-regulated in two independent K5-Gli2
N2 tumor cell lines (G2N2c and Tb3a) (Fig. 3B). Interestingly, Foxe1 expression was induced to a similar extent as the classical Shh downstream targets Gli1 and Ptch1. A strong Foxe1 induction in Gli2
N2 keratinocytes was also observed at the protein level by immunoblotting using Foxe1-specific antibodies (Fig. 3C). Although mouse primary keratinocytes and WT-7 cells did not express Foxe1 protein at any detectable levels, Foxe1 expression was readily detectable in cells expressing Gli2
N2.
Regulation of Foxe1 promoter by Shh/Gli signaling
To determine whether Foxe1 promoter was responsive to Shh/Gli signaling, we cloned a 2.39 kb rat genomic fragment comprising 1.8 kb of the promoter region and the entire 5'-UTR (0.59 kb), upstream of the luciferase gene used as reporter. Consistent with the expression data, Foxe1 promoter displayed a strong activity in G2N2c cells as compared with the promoter-less construct and to a thymidine kinase (TK) promoter (Fig. 4A). To test whether the Foxe1 promoter activity was dependent on Gli, the promoter was co-transfected with the Gli dominant-negative mutant Gli2
C4. In the presence of Gli2
C4, Foxe1 promoter was strongly inhibited (up to 80%) in a dose-dependent manner (Fig. 4A). In contrast, TK promoter was not affected by expression of Gli2
C4.
|
To further identify the Foxe1 promoter region responsive to Gli, various promoter deletions were generated and tested for their susceptibility to Gli2
C4 (Fig. 4B). Progressive deletions of the promoter region enhanced transcriptional activity, but displayed similar inhibition by Gli2
C4 (Fig. 4C). The smallest region tested, comprising only 0.19 kb of genomic region upstream of the transcription start site, as well as the 5'-UTR region, was still strongly inhibited by Gli2
C4 (70% inhibition at the highest Gli2
C4 concentration).
The Foxe1 promoter sequence was analyzed for Gli consensus binding sites (GACCACCCA) (4446) by visual inspection and by bioinformatics analysis using MatInspector (GenomatixSuite 3.1.0) (47), TRANSFAC (TRANSFAC Professional 8.2) (48) and by comparison between rat and human promoters using rVISTA (49). No putative binding sites for Gli could be found in
1600 Foxe1 promoter even at low stringency, whereas a putative binding site (GGCCACCCA) was located at position 1.1 kb in the rat and mouse promoter, but not in the human promoter. However, consistent with the deletion experiment, mutation of the Gli-binding site (GGCCAGGCA) did not affect the response to Gli2
C4 (data not shown).
Taken together, these data suggest that Foxe1 gene expression is regulated by the Shh/Gli pathway at the transcriptional level, and that regulation of the Foxe1 promoter is likely to be indirect.
Foxe1-null skin displays aberrant hair follicle morphogenesis
To assess the role of Foxe1 in hair follicle morphogenesis and maintenance, we analyzed the skin of mice carrying a homozygous disruption of Foxe1 (Foxe1/) (10). Histological and immunohistochemical analyses of dorsal skin sections of Foxe1/ mice at birth did not reveal any differences compared to wild-type skin (data not shown). Thus, Foxe1 is not required for early stages of hair follicle morphogenesis, as also suggested by its late expression.
As Foxe1/ mice die at birth, we grafted Foxe1/ newborn skin onto the backs of immunodeficient mice to examine later stages of hair follicle morphogenesis. Thirty immunodeficient mice received grafts from either Foxe1/ mice or wild-type littermates. Hair appeared within 710 days in grafts from wild-type newborns, and reached maximum length in about 2 weeks (Fig. 5A). A similar time course was observed in Foxe1/ grafts; however, in this case the hair coat was sparse, thin and kinky as compared to wild-type ones, with hairs pointing in different directions at different angles (Fig. 5B). To determine whether there was a defect at the level of the hair shaft, hairs were plucked and observed under the dissecting microscope. The mouse coat contains four hair typesguard, awl, auchene and zigzagthat differ in several properties (50,51). The hair types are distinguished by their length and by the structure of the medulla (the central cylinder of the hair), which normally contains cells arranged in columns. Zigzag hairs, the most abundant hair type, possess a single column of cells, whereas the remaining hair types have two or more columns side by side. Wild-type hair from the graft appeared normal and had the expected ratio among hair types (Fig. 5C and data not shown). In contrast, Foxe1/ hairs were kinky and curly, unusually thin, with a C- or S-shaped curvature, and an irregular septation between cells, making it difficult to distinguish among the different hair types (Fig. 5D). Quantitative analysis of more than a thousand hair shafts revealed a 50% reduction in hair consisting of 35 cell layers (auchene/awl), with a concomitant increase of single cell hairs, which appeared unusually thin, lacked sharp bends and were irregularly septulated.
|
Histological analysis revealed remarkable changes in Foxe1/ skin. At 2 weeks after grafting, wild-type hair follicles were uniformly sloped and organized in an orderly parallel array (Fig. 6A). In contrast, in Foxe1/ skin, hair follicles were clearly misaligned, variably angled and somewhat smaller than wild-type ones (Fig. 6B, see arrows). The presence of oblique and transverse sections among longitudinal sections of hair follicles indicates that follicles curved in and out of the plane of section. Foxe1 immunostaining was used as control for the presence (Fig. 6C) or absence (Fig. 6D) of Foxe1 protein in wild-type and Foxe1/ grafts, respectively. Interestingly, the differentiation program of Foxe1/ skin appeared normal as judged by immunostaining with several differentiation markers such as K17 (staining the ORS, medulla of the hair shaft and the matrix) and trichohyalin (a marker of IRS), as well as K14 (a marker of ORS and basal layer of the epidermis), K6a (a marker of ORS inner layer), Hb2 (a marker of hair cuticle), and markers of the epidermis such as K1 (a marker of the spinous layer), involucrin (a marker of the granular layer), filaggrin, loricrin (a marker of the granular layer and stratum corneum) (Fig. 6EH and data not shown). Proliferation was also unaffected at least as judged by expression of the proliferation marker Ki67, which was similarly expressed in Foxe1/ skin and wild-type controls (data not shown).
|
Taken together these findings indicate that Foxe1, although is unlikely to be involved in proliferation and differentiation of hair follicle keratinocytes, is essential for correct hair follicle orientation and downgrowth in late steps of hair follicle morphogenesis.
| DISCUSSION |
|---|
|
|
|---|
Hair follicle morphogenesis and the hair cycle are highly regulated processes in which induction and silencing of gene expression are finely tuned. The regulation of gene expression in terminally differentiating hair follicle cells is well characterized (5259). In contrast, little is known about gene expression control in cells of the ORS, where undifferentiated progenitors cells are thought to migrate from the stem cell compartment to replenish the transit-amplifying compartment. We show here that the forkhead protein Foxe1 is expressed in the lower ORS surrounding the bulb, is a downstream target of the Shh signaling, and participates in late stages of hair follicle morphogenesis, as lack of Foxe1 causes aberrant downgrowth of the hair follicle in the deep dermis.
Macroscopically, the hair defect in Foxe1-deficient skin recapitulates the hair phenotype (sparse and spiky hair) of patients affected by BamforthLazarus syndrome, which are homozygous for loss-of-function mutations affecting the Foxe1 DNA-binding domain (35). Our expression data, coupled with grafting experiments, provide a strong indication that the defect is due to altered Foxe1 function in the hair follicle and is independent of systemic defects present in affected individuals. In addition, we show that hair defects are due to aberrant hair follicle morphogenesis caused by an inability of the hair follicle to descend correctly into the dermis and subcutisa process that leads to misaligned and aberrantly shaped hair follicles. In contrast, cell proliferation and terminal differentiation of Foxe1/ hair follicles appear unaffected.
Hair follicle defects similar to those found in Foxe1/ skin occur in mice in which the TGF-alpha/EGF-receptor signaling is disrupted (6064). A major difference between these animal models is that, though TGF-alpha null mice display defects in pelage hair as well as in whiskers hair, defects in Foxe1 null mice are confined to pelage hair (A. Brancaccio and C. Missero, unpublished data). A similar selectivity was also reported in Shh and Gli2 defective mice (27), even though both molecules are expressed in the whisker follicles. These observations suggest that some molecular mechanisms in hair follicle morphogenesis are distinct between pelage and whisker follicles, and that the Shh/Gli/Fox pathway is essential only in pelage follicle morphogenesis, whereas TGF-alpha/EGFR signaling is required for both. A genetic interaction between the EGF pathway and Foxe1 has not been explored fully; however, Foxe1 is unlikely to control TGF-alpha expression, as they do not co-localize in the hair follicle. In addition, exogenous expression of Foxe1 in mouse primary keratinocytes by retroviral infection does not alter the expression levels of TGF-alpha, EGF or EGF receptor (A. Brancaccio and C. Missero, unpublished data). The EGF receptor is expressed in the ORS, raising the possibility that Foxe1 may be controlled by the TGF-alpha signaling pathway. In this context, the absence of Foxe1 may disrupt a proliferative signal required for ORS and/or bulb growth, which in turn may result in aberrant downgrowth. However, obvious proliferation defects could not be detected in Foxe1/ skin either at birth or at 2 weeks after grafting, suggesting that the molecular defect underlying abnormal hair follicle morphogenesis may be more complex. In line with this hypothesis is the phenotype of Shh-null mice, which display severe defects in hair follicle morphogenesis and downgrowth that are not simply explained by proliferation defects. Indeed, when grafted to nude mice, Shh mutant skin gives rise to large abnormal follicles with a high rate of proliferation in some cells; however, these abortive follicles display impaired downgrowth (20,21).
Foxe1 has a very restricted spatial and temporal pattern of expression in the hair follicle, being present specifically in the lower ORS surrounding the bulb, an undifferentiated portion of the hair follicle, which may contain migrating stem cells (16). Interestingly, Foxe1 expression ceases in telogen and is then induced in the new anagen. This peculiar pattern of expression overlapsat least in partwith Shh and its targets genes Ptch1 and Gli, which are also expressed in the lower hair follicle (40), and similarly to Foxe1 are not expressed in telogen. Of the three Gli transcription factors involved in Shh-responsive gene expression, Gli2 is the key mediator of Shh in mouse skin (27). Here, we present genetic evidences demonstrating that Foxe1 is a downstream target of Shh/Gli signaling: (i) Foxe1 expression is completely suppressed in transgenic mice expressing a dominant-negative Gli in skin; (ii) Foxe1 is aberrantly expressed in human and mouse BCC where the Shh signaling is constitutively activated; (iii) Foxe1 is strongly up-regulated in keratinocytes expressing an activated form of Gli2; (iv) activity of the Foxe1 promoter is much stronger in keratinocytes carrying the activated form of Gli2 than in wild-type keratinocytes; and (v) a dominant-negative Gli mutant inhibits Foxe1 promoter activity.
During mouse embryonic development, a number of forkhead genes is regulated by Shh, and some of these genes have been shown to be direct transcriptional targets of Shh/Gli signaling (44,6568). We show that the Foxe1 promoter is responsive to Shh/Gli signaling as it is strongly inhibited by the dominant-negative form of Gli. Very recently, FOXE1 mRNA and promoter have been reported to be induced by wild-type Gli2 overexpression in HaCaT cells, a human keratinocyte cell line (69). A homologous portion of the human and rat promoters was analyzed and found to be responsive to Gli2 [(69) and present study], reinforcing the notion that Gli2 affects Foxe1 transcription by controlling directly or indirectly its proximal promoter region. Five Gli-binding sites with partial homology with the previously reported Gli-binding consensus motif GACCACCCA (45) were found in the human promoter, however, none of these potential binding sites were conserved in the rat promoter sequence. We further dissected the rat Foxe1 promoter region responding to Gli and found that it comprises a very small region of the promoter surrounding the transcription start site and the 5'-UTR, where no putative Gli-binding sites could be identified by bioinformatics analysis. Foxe1 promoter is TATA-less and several putative cis-acting elements, such as AP1-, AP2-, E2F- and SP1-binding sites, are found in this region, which are conserved among human, mouse and rat sequences. Further experiments will be required to identify which of these sites mediate Gli transcription effect on the Foxe1 minimal promoter, or whether Gli binds directly to the promoter in a non-canonical binding site. Interestingly, Foxe1 displays a narrower pattern of expression as compared to Shh and Ptch1, suggesting that Foxe1 expression may be refined by mechanisms other than Shh signaling.
Although Foxe1 has a very restricted spatial and temporal pattern of expression in the hair follicle and its loss results in aberrant hair follicle morphogenesis, deregulated expression of Foxe1 is associated with BCC in humans and mice. Foxe1 mRNA has been reported to be expressed at the RNA level in a panel of human BCCs (69). These results are consistent with our findings that the Foxe1 protein is aberrantly expressed in human BCC, and also in a mouse model of BCC induced by overexpression of the transcription factor Gli2, strengthening the notion that Foxe1 is a target of Shh signaling and is likely to play a role in BCC formation. While Foxe1 role in BCC formation remains to be explored, our results point to a possible role of Foxe1 in contributing to local invasion of surrounding tissues by facilitating downgrowth of neoplastic tissue in the dermis in parallel with its physiological role in the downgrowth of the hair follicle.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell cultures, transfection and reporter assays
Mouse primary keratinocytes were isolated from 2-day-old Swiss CD1 mice and cultured under low calcium conditions (0.05 mm) in the presence of 4% Ca2+-chelated fetal bovine serum (Invitrogen), and EGF (BD Bioscience), as previously described (70,71). WT-7, G2N2c and Tb3A keratinocytes were cultured under low calcium conditions in the presence of 8% Ca2+-chelated fetal bovine serum, and KGF (Sigma) as described (34). Confluent mouse primary keratinocytes were transfected in 12-well plates 5 days after plating, whereas keratinocyte cell line were subcultured in 12-well plates and transfected 2 days after plating under subconfluent conditions. Transient transfections were performed using 4 µl of Lipofectamine 2000 (Invitrogen) according to manufacture's instructions. Cells were transfected with reporter plasmid (0.5 µg) Foxe1 promoter-Luc vector, pGL3 (control plasmid), or a TK minimal promoter-pGL3 (72); effector plasmid Gli2
C4 (0.5 and 1 µg) (41,42); and pCMV-Renilla (20 ng). Cells were harvested 48 h after transfection, and luciferase levels were determined with Dual-Luciferase Reporter assay kit (Promega) following the manufacture's protocol. Renilla luciferase activity was used to normalize for transfection efficiency. To construct reporter plasmids for Foxe1 promoter, a 2.39 kb rat genomic fragment (XhoIHindIII) containing a 5' upstream 1.80 Kb promoter region and Foxe1 5'-UTR (0.59 kb) was cloned blunt in SmaI in front of the luciferase gene pGL3-Luc (Promega). Deletion mutants were generated by cutting and ligating pGL3-Foxe1 promoter with SacI (
1600), BstXIKpnI (
1100) and XbaIKpnI (
500).
RNA isolation and analysis
RNA was extracted from CD1 mouse tissues using Trizol-LS Reagent (Invitrogen) and was treated with RNase-free DNase I (Promega). cDNA was synthesized using Superscript II (Invitrogen) and random primers. Specific cDNA was amplified with Taq DNA polymerase (Invitrogen) with the following oligonucleotide primers: for glyceraldehyde-3-phosphate GAPDHf (TGAAGGTCGGTGTGAACGGATTTGGC) and GAPDHr (CATGTAGGCCATGAGGTCCACCAC); for Foxe1 Foxe1f (GACTCCGTGCTGGAGTTCAGAGC) and Foxe1r (GATCAAGGGGTCCGGACGTG). Two-step real-time RTPCR was performed using the SYBR® Green PCR Core Kit (Applied Biosystem). For real-time RTPCR oligonucleotide primers were as followed: GAPDHf (GTATGACTCCACTCACGGCAAA), GAPDHr (TTCCCATTCTCGGCCTTG), Foxe1f (GACAACCCCAAGAAGTGGCA), Foxe1r (GGGATCTTGAGGAAGCAGTCG), Gli1f (GCAACCTGCCAGCTGAAGTC) and Gli1r (CATGTCCCCTTCCAAAGGG), Gli2f (CCGCACCTACAGCTTCGAG) and Gli2r (GTTGCGTGTAGCTCCCTCTTG), Ptch1f (AGACCAACGTGGAGGAGCTG) and Ptch1r (CTCGACTCACTCGTCCACCA).
Immunoblotting analysis
Protein extracts were prepared by lysing subconfluent 100 mm dishes in 2x SDS loading buffer. Protein concentration was determined using the Bio-Rad DC protein assay. Upon addition of 5% 2-mercaptoethanol, 30 µg of protein lysates were run on a 12% SDSPAGE gel and transferred on Immobilon-P transfer membrane (Millipore). Membrane was then blocked with 5% non-fat dry milk in phosphate-buffered saline (PBS), probed with anti-Foxe1 polyclonal antibodies (1 : 500) (6) for 1 h, washed and incubated with horseradish peroxidase-conjugated donkey anti-rabbit IgG secondary antibody (1 : 2000) and detected by chemiluminescence (Amersham). Reprobing of the same filter was performed by incubating membrane in stripping buffer (2% SDS, 100 mM 2-mercaptoethanol in 62.5 mM TrisHCl pH 6.8). After extensive washing, the membrane was incubated with anti-ERK1-specific antibodies (1 : 200; Santa Cruz) as loading control.
In situ hybridization
In situ hybridization was performed as previously described (6). Briefly, skin was fixed in 4% fresh paraformaldehyde overnight at 4°C, washed in PBS, incubated in 30% sucrose/PBS overnight at 4°C and embedded in OCT compound (Sakura). Sections of 16 µm were treated with proteinase-K 20 µg/ml for 15 min and hybridized with DIG-riboprobe in 50% formamide overnight at 60°C. After extensive washings, slides were incubated with anti-DIG-alkaline phosphatase antibodies (Roche), washed and incubated in NBT/BCIP solution (Roche), 1 mM levamisole (Sigma) for 612 h.
Hybridization was performed with 1 µg/ml of digoxygenin-labeled Foxe1 cRNA probe corresponding to a NotIBamHI cDNA fragment comprising 442 bp of coding sequence (lacking the forkhead domain) and 326 bp of 3'-UTR, cloned into Bluescript KS+ (6). Probes for keratin 17 and caspase 14 were generated as previously described (73,74). Antisense and sense probes were transcribed from the T3 and T7 promoters, respectively, using a DIG labeling kit (Roche) as described by manufacturer's instructions.
Histology and immunostaining
Skin samples were fixed in 4% paraformaldehyde in PBS overnight at 4°C, embedded in paraffin. Wild-type skin was obtained from Swiss CD-1 mice at different ages unless otherwise indicated. Mouse BCC samples were obtained from transgenic mice expressing wild-type Gli2 under the control of the bovine K5 promoter (37). Mouse skins carrying a dominant-negative form of Gli were obtained from transgenic mice expressing Gli2
C4 under the control of the bovine K5 promoter (42). Human tissue samples were obtained according to a protocol approved by the University of Michigan IRB. For immunohistochemistry, 7 µm thick sections were deparaffinized, boiled in 10 mM sodium citrate (pH 6.0) for 20 min, and stained with the Vectastain kit according to the manufacturer's instructions (Vector Laboratories). For immunofluorescence, relevant Texas Red-conjugated goat antibodies (1 : 100; Jackson Laboratories) were used to detect primary antibodies. Before the last wash, DNA was stained with DAPI at 100 ng/ml in PBS (5 min). Slides were mounted using Vectashield as mounting reagent (Vector Laboratories). Slides were examined under an Axioplan 2 imaging microscope (Zeiss). We used the following primary antibodies: Foxe1 (diluted 1 : 500) (6), keratin 14 (1 : 10 000; Covance-Babco), trichohyalin (1 : 1000; donated by George Rogers), keratin 17 (1 : 200; donated by Pierre Coulombe).
Skin grafting
Full-thickness skin grafting was performed as described by Sundberg et al. (75) with minor modifications. A patch of full-thickness skin (
10x10 mm2) was removed from the back of an anaesthetized nu/nu CD-1 mouse, and was replaced by a patch of full-thickness skin from newborn Foxe1-null mouse or a wild-type littermate. Each graft was secured by sterile Vaseline gauze and silicon transplantation chamber. The chambers were removed 45 days after grafting and graft biopsies and hair were harvested 23 weeks after grafting. Skin from 14 wild-type and 16 Foxe1-null mice was grafted. All experiments involving mice were conducted according to IACUC procedures.
| ACKNOWLEDGEMENTS |
|---|
We thank Graciana Diez-Roux for critical reading of the manuscript, and Emanuele Marra and the TIGEM Transgenic Core for technical assistance in skin grafting and generation of transgenic mice. We thank Aiqin Wang for generating keratinocyte cell lines expressing Gli2
N2 and providing tissue from K5-Gli2
C4 mice. We are indebted to Jean Gilder (Scientific Communication) for text editing. We are grateful to Roberto Di Lauro for Foxe1/ mice, George Rogers and Pierre Coulombe for antibodies. A.B. was a Predoctoral Fellow from University of Napoli Federico II. A.A.D. was supported by NIH grants AR45973 and CA87837. C.M. was supported by grants from the Italian Telethon Foundation, from Ministry of Instruction, University and Research (MIUR FIRB) project, and from Regione Campania.
| FOOTNOTES |
|---|
* To whom correspondence should be addressed. Tel: +39 816132219; Fax: +39 815609877; Email: missero{at}tigem.it
Present address: Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX 77030, USA. ![]()
Present address: Department of Molecular Biology of the Cell I, German Cancer Research Center, Im Neuenheimer Feld 280, D-69120 Heidelberg, Germany. ![]()
¶ Present address: Istituto di Biostrutture e Bioimmagini, Via Mezzocannone 6, 80134 Napoli, Italy. ![]()
| REFERENCES |
|---|
|
|
|---|
- Carlsson, P. and Mahlapuu, M. (2002) Forkhead transcription factors: key players in development and metabolism. Dev. Biol., 250, 123.[CrossRef][Web of Science][Medline]
- Lehmann, O.J., Sowden, J.C., Carlsson, P., Jordan, T. and Bhattacharya, S.S. (2003) Fox's in development and disease. Trends Genet., 19, 339344.[CrossRef][Web of Science][Medline]
-
Bamforth, J.S., Hughes, I.A., Lazarus, J.H., Weaver, C.M. and Harper, P.S. (1989) Congenital hypothyroidism, spiky hair, and cleft palate. J. Med. Genet., 26, 4951.
[Abstract/Free Full Text] - Clifton-Bligh, R.J., Wentworth, J.M., Heinz, P., Crisp, M.S., John, R., Lazarus, J.H., Ludgate, M. and Chatterjee, V.K. (1998) Mutation of the gene encoding human TTF-2 associated with thyroid agenesis, cleft palate and choanal atresia. Nat. Genet., 19, 399401.[CrossRef][Web of Science][Medline]
-
Castanet, M., Park, S.M., Smith, A., Bost, M., Leger, J., Lyonnet, S., Pelet, A., Czernichow, P., Chatterjee, K. and Polak, M. (2002) A novel loss-of-function mutation in TTF-2 is associated with congenital hypothyroidism, thyroid agenesis and cleft palate. Hum. Mol. Genet., 11, 20512059.
[Abstract/Free Full Text] - Dathan, N., Parlato, R., Rosica, A., De Felice, M. and Di Lauro, R. (2002) Distribution of the titf2/foxe1 gene product is consistent with an important role in the development of foregut endoderm, palate, and hair. Dev. Dyn., 224, 450456.[CrossRef][Web of Science][Medline]
- Zannini, M., Avantaggiato, V., Biffali, E., Arnone, M.I., Sato, K., Pischetola, M., Taylor, B.A., Phillips, S.J., Simeone, A. and Di Lauro, R. (1997) TTF-2, a new forkhead protein, shows a temporal expression in the developing thyroid which is consistent with a role in controlling the onset of differentiation. EMBO J., 16, 31853197.[CrossRef][Web of Science][Medline]
-
Francis-Lang, H., Price, M., Polycarpou-Schwarz, M. and Di Lauro, R. (1992) Cell-type-specific expression of the rat thyroperoxidase promoter indicates common mechanisms for thyroid-specific gene expression. Mol. Cell. Biol., 12, 576588.
[Abstract/Free Full Text] - Civitareale, D., Lonigro, R., Sinclair, A.J. and Di Lauro, R. (1989) A thyroid-specific nuclear protein essential for tissue-specific expression of the thyroglobulin promoter. EMBO J., 8, 25372542.[Web of Science][Medline]
- De Felice, M., Ovitt, C., Biffali, E., Rodriguez-Mallon, A., Arra, C., Anastassiadis, K., Macchia, P.E., Mattei, M.G., Mariano, A., Scholer, H. et al. (1998) A mouse model for hereditary thyroid dysgenesis and cleft palate. Nat. Genet., 19, 395398.[CrossRef][Web of Science][Medline]
- Hardy, M.H. (1992) The secret life of the hair follicle. Trends Genet., 8, 5561.[Web of Science][Medline]
-
Tumbar, T., Guasch, G., Greco, V., Blanpain, C., Lowry, W.E., Rendl, M. and Fuchs, E. (2004) Defining the epithelial stem cell niche in skin. Science, 303, 359363.
[Abstract/Free Full Text] - Morris, R.J., Liu, Y., Marles, L., Yang, Z., Trempus, C., Li, S., Lin, J.S., Sawicki, J.A. and Cotsarelis, G. (2004) Capturing and profiling adult hair follicle stem cells. Nat. Biotechnol., 22, 411417.[CrossRef][Web of Science][Medline]
- Oshima, H., Rochat, A., Kedzia, C., Kobayashi, K. and Barrandon, Y. (2001) Morphogenesis and renewal of hair follicles from adult multipotent stem cells. Cell, 104, 233245.[CrossRef][Web of Science][Medline]
- Morris, R.J. and Potten, C.S. (1999) Highly persistent label-retaining cells in the hair follicles of mice and their fate following induction of anagen. J. Invest. Dermatol., 112, 470475.[CrossRef][Web of Science][Medline]
-
Paus, R. and Cotsarelis, G. (1999) The biology of hair follicles. N. Engl. J. Med., 341, 491497.
[Free Full Text] - Millar, S.E. (2002) Molecular mechanisms regulating hair follicle development. J. Invest. Dermatol., 118, 216225.[CrossRef][Web of Science][Medline]
- Fuchs, E. and Raghavan, S. (2002) Getting under the skin of epidermal morphogenesis. Nat. Rev Genet., 3, 199209.[CrossRef][Web of Science][Medline]
- Fuchs, E., Merrill, B.J., Jamora, C. and DasGupta, R. (2001) At the roots of a never-ending cycle. Dev. Cell, 1, 1325.[CrossRef][Web of Science][Medline]
- St-Jacques, B., Dassule, H.R., Karavanova, I., Botchkarev, V.A., Li, J., Danielian, P.S., McMahon, J.A., Lewis, P.M., Paus, R. and McMahon, A.P. (1998) Sonic hedgehog signaling is essential for hair development. Curr. Biol., 8, 10581068.[CrossRef][Web of Science][Medline]
- Chiang, C., Swan, R.Z., Grachtchouk, M., Bolinger, M., Litingtung, Y., Robertson, E.K., Cooper, M.K., Gaffield, W., Westphal, H., Beachy, P.A. et al. (1999) Essential role for Sonic hedgehog during hair follicle morphogenesis. Dev. Biol., 205, 19.[CrossRef][Web of Science][Medline]
- Karlsson, L., Bondjers, C. and Betsholtz, C. (1999) Roles for PDGF-A and Sonic hedgehog in development of mesenchymal components of the hair follicle. Development, 126, 26112621.[Abstract]
- Sato, N., Leopold, P.L. and Crystal, R.G. (1999) Induction of the hair growth phase in postnatal mice by localized transient expression of Sonic hedgehog. J. Clin. Invest., 104, 855864.[Web of Science][Medline]
- Wang, L.C., Liu, Z.Y., Gambardella, L., Delacour, A., Shapiro, R., Yang, J., Sizing, I., Rayhorn, P., Garber, E.A., Benjamin, C.D. et al. (2000) Regular articles: conditional disruption of hedgehog signaling pathway defines its critical role in hair development and regeneration. J. Invest. Dermatol., 114, 901908.[CrossRef][Web of Science][Medline]
- Taipale, J., Cooper, M.K., Maiti, T. and Beachy, P.A. (2002) Patched acts catalytically to suppress the activity of smoothened. Nature, 418, 892897.[CrossRef][Medline]
- Park, H.L., Bai, C., Platt, K.A., Matise, M.P., Beeghly, A., Hui, C.C., Nakashima, M. and Joyner, A.L. (2000) Mouse Gli1 mutants are viable but have defects in SHH signaling in combination with a Gli2 mutation. Development, 127, 15931605.[Abstract]
-
Mill, P., Mo, R., Fu, H., Grachtchouk, M., Kim, P.C., Dlugosz, A.A. and Hui, C.C. (2003) Sonic hedgehog-dependent activation of Gli2 is essential for embryonic hair follicle development. Genes Dev., 17, 282294.
[Abstract/Free Full Text] - Xie, J., Murone, M., Luoh, S.M., Ryan, A., Gu, Q., Zhang, C., Bonifas, J.M., Lam, C.W., Hynes, M., Goddard, A. et al. (1998) Activating Smoothened mutations in sporadic basal-cell carcinoma. Nature, 391, 9092.[CrossRef][Medline]
- Gailani, M.R., Stahle-Backdahl, M., Leffell, D.J., Glynn, M., Zaphiropoulos, P.G., Pressman, C., Unden, A.B., Dean, M., Brash, D.E., Bale, A.E. et al. (1996) The role of the human homologue of Drosophila patched in sporadic basal cell carcinomas. Nat. Genet., 14, 7881.[CrossRef][Web of Science][Medline]
- Hahn, H., Wicking, C., Zaphiropoulous, P.G., Gailani, M.R., Shanley, S., Chidambaram, A., Vorechovsky, I., Holmberg, E., Unden, A.B., Gillies, S. et al. (1996) Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome. Cell, 85, 841851.[CrossRef][Web of Science][Medline]
- Johnson, R.L., Rothman, A.L., Xie, J., Goodrich, L.V., Bare, J.W., Bonifas, J.M., Quinn, A.G., Myers, R.M., Cox, D.R., Epstein, E.H., Jr et al. (1996) Human homolog of patched, a candidate gene for the basal cell nervous syndrome. Science, 272, 16681671.[Abstract]
-
Unden, A.B., Zaphiropoulos, P.G., Bruce, K., Toftgard, R. and Stahle-Backdahl, M. (1997) Human patched (PTCH) mRNA is overexpressed consistently in tumor cells of both familial and sporadic basal cell carcinoma. Cancer Res., 57, 23362340.
[Abstract/Free Full Text] - Dahmane, N., Lee, J., Robins, P., Heller, P. and Ruiz i Altaba, A. (1997) Activation of the transcription factor Gli1 and the Sonic hedgehog signalling pathway in skin tumours. Nature, 389, 876881.[CrossRef][Medline]
-
Sheng, H., Goich, S., Wang, A., Grachtchouk, M., Lowe, L., Mo, R., Lin, K., de Sauvage, F.J., Sasaki, H., Hui, C.C. et al. (2002) Dissecting the oncogenic potential of Gli2: deletion of an NH(2)-terminal fragment alters skin tumor phenotype. Cancer Res., 62, 53085316.
[Abstract/Free Full Text] -
Oro, A.E., Higgins, K.M., Hu, Z., Bonifas, J.M., Epstein, E.H., Jr and Scott, M.P. (1997) Basal cell carcinomas in mice overexpressing Sonic hedgehog. Science, 276, 817821.
[Abstract/Free Full Text] -
Nilsson, M., Unden, A.B., Krause, D., Malmqwist, U., Raza, K., Zaphiropoulos, P.G. and Toftgard, R. (2000) Induction of basal cell carcinomas and trichoepitheliomas in mice overexpressing GLI-1. Proc. Natl Acad. Sci. USA, 97, 34383443.
[Abstract/Free Full Text] - Grachtchouk, M., Mo, R., Yu, S., Zhang, X., Sasaki, H., Hui, C.C. and Dlugosz, A.A. (2000) Basal cell carcinomas in mice overexpressing Gli2 in skin. Nat. Genet., 24, 216217.[CrossRef][Web of Science][Medline]
- Iseki, S., Araga, A., Ohuchi, H., Nohno, T., Yoshioka, H., Hayashi, F. and Noji, S. (1996) Sonic hedgehog is expressed in epithelial cells during development of whisker, hair, and tooth. Biochem. Biophys. Res. Commun., 218, 688693.[CrossRef][Web of Science][Medline]
- Bitgood, M.J. and McMahon, A.P. (1995) Hedgehog and Bmp genes are coexpressed at many diverse sites of cellcell interaction in the mouse embryo. Dev. Biol., 172, 126138.[CrossRef][Web of Science][Medline]
- Oro, A.E. and Higgins, K. (2003) Hair cycle regulation of Hedgehog signal reception. Dev. Biol., 255, 238248.[CrossRef][Web of Science][Medline]
- Sasaki, H., Nishizaki, Y., Hui, C., Nakafuku, M. and Kondoh, H. (1999) Regulation of Gli2 and Gli3 activities by an amino-terminal repression domain: implication of Gli2 and Gli3 as primary mediators of Shh signaling. Development, 126, 39153924.[Abstract]
-
Allen, M., Grachtchouk, M., Sheng, H., Grachtchouk, V., Wang, A., Wei, L., Liu, J., Ramirez, A., Metzger, D., Chambon, P. et al. (2003) Hedgehog signaling regulates sebaceous gland development. Am. J. Pathol., 163, 21732178.
[Abstract/Free Full Text] - Mercurio, A.M. (2003) Invasive skin carcinomaRas and alpha6beta4 integrin lead the way. Cancer Cell., 3, 201202.[CrossRef][Web of Science][Medline]
- Sasaki, H., Hui, C., Nakafuku, M. and Kondoh, H. (1997) A binding site for Gli proteins is essential for HNF-3beta floor plate enhancer activity in transgenics and can respond to Shh in vitro. Development, 124, 13131322.[Abstract]
-
Kinzler, K.W. and Vogelstein, B. (1990) The GLI gene encodes a nuclear protein which binds specific sequences in the human genome. Mol. Cell. Biol., 10, 634642.
[Abstract/Free Full Text] -
Yoon, J.W., Kita, Y., Frank, D.J., Majewski, R.R., Konicek, B.A., Nobrega, M.A., Jacob, H., Walterhouse, D. and Iannaccone, P. (2002) Gene expression profiling leads to identification of GLI1-binding elements in target genes and a role for multiple downstream pathways in GLI1-induced cell transformation. J. Biol. Chem., 277, 55485555.
[Abstract/Free Full Text] -
Quandt, K., Frech, K., Karas, H., Wingender, E. and Werner, T. (1995) MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucl. Acids Res., 23, 48784884.
[Abstract/Free Full Text] -
Matys, V., Fricke, E., Geffers, R., Gossling, E., Haubrock, M., Hehl, R., Hornischer, K., Karas, D., Kel, A.E., Kel-Margoulis, O.V. et al. (2003) TRANSFAC: transcriptional regulation, from patterns to profiles. Nucl. Acids Res., 31, 374378.
[Abstract/Free Full Text] -
Loots, G.G., Ovcharenko, I., Pachter, L., Dubchak, I. and Rubin, E.M. (2002) rVista for comparative sequence-based discovery of functional transcription factor binding sites. Genome Res., 12, 832839.
[Abstract/Free Full Text] - Dry, F. (1926) The coat of the mouse (Mus musculus). J. Genet., 16, 287340.[Web of Science]
- Sundberg, J.P. and Morgan, M.E. (1994) Hair types and subtypes in the laboratory mouse. In Sundberg, J.P. (ed.), Handbook of Mouse Mutations with Skin and Hair Abnormalities: Animal Models and Biochemical Tools. Boca Raton, FL: CRC Press.
-
Ellis, T., Gambardella, L., Horcher, M., Tschanz, S., Capol, J., Bertram, P., Jochum, W., Barrandon, Y. and Busslinger, M. (2001) The transcriptional repressor CDP (Cutl1) is essential for epithelial cell differentiation of the lung and the hair follicle. Genes Dev., 15, 23072319.
[Abstract/Free Full Text] -
Kaufman, C.K., Zhou, P., Pasolli, H.A., Rendl, M., Bolotin, D., Lim, K.C., Dai, X., Alegre, M.L. and Fuchs, E. (2003) GATA-3: an unexpected regulator of cell lineage determination in skin. Genes Dev., 17, 21082122.
[Abstract/Free Full Text] -
Jave-Suarez, L.F., Winter, H., Langbein, L., Rogers, M.A. and Schweizer, J. (2002) HOXC13 is involved in the regulation of human hair keratin gene expression. J. Biol. Chem., 277, 37183726.
[Abstract/Free Full Text] - Huelsken, J., Vogel, R., Erdmann, B., Cotsarelis, G. and Birchmeier, W. (2001) Beta-catenin controls hair follicle morphogenesis and stem cell differentiation in the skin. Cell, 105, 533545.[CrossRef][Web of Science][Medline]
- Hong, H.K., Noveroske, J.K., Headon, D.J., Liu, T., Sy, M.S., Justice, M.J. and Chakravarti, A. (2001) The winged helix/forkhead transcription factor Foxq1 regulates differentiation of hair in satin mice. Genesis, 29, 163171.[CrossRef][Web of Science][Medline]
- Pennisi, D., Gardner, J., Chambers, D., Hosking, B., Peters, J., Muscat, G., Abbott, C. and Koopman, P. (2000) Mutations in Sox18 underlie cardiovascular and hair follicle defects in ragged mice. Nat. Genet., 24, 434437.[CrossRef][Web of Science][Medline]
- Lee, D., Prowse, D.M. and Brissette, J.L. (1999) Association between mouse nude gene expression and the initiation of epithelial terminal differentiation. Dev. Biol., 208, 362374.[CrossRef][Web of Science][Medline]
-
Zhou, P., Byrne, C., Jacobs, J. and Fuchs, E. (1995) Lymphoid enhancer factor 1 directs hair follicle patterning and epithelial cell fate. Genes Dev., 9, 700713.
[Abstract/Free Full Text] -
Fowler, K.J., Walker, F., Alexander, W., Hibbs, M.L., Nice, E.C., Bohmer, R.M., Mann, G.B., Thumwood, C., Maglitto, R., Danks, J.A. et al. (1995) A mutation in the epidermal growth factor receptor in waved-2 mice has a profound effect on receptor biochemistry that results in impaired lactation. Proc. Natl Acad. Sci. USA, 92, 14651469.
[Abstract/Free Full Text] - Luetteke, N.C., Qiu, T.H., Peiffer, R.L., Oliver, P., Smithies, O. and Lee, D.C. (1993) TGF alpha deficiency results in hair follicle and eye abnormalities in targeted and waved-1 mice. Cell, 73, 263278.[CrossRef][Web of Science][Medline]
-
Luetteke, N.C., Phillips, H.K., Qiu, T.H., Copeland, N.G., Earp, H.S., Jenkins, N.A. and Lee, D.C. (1994) The mouse waved-2 phenotype results from a point mutation in the EGF receptor tyrosine kinase. Genes Dev., 8, 399413.
[Abstract/Free Full Text] - Mann, G.B., Fowler, K.J., Gabriel, A., Nice, E.C., Williams, R.L. and Dunn, A.R. (1993) Mice with a null mutation of the TGF alpha gene have abnormal skin architecture, wavy hair, and curly whiskers and often develop corneal inflammation. Cell, 73, 249261.[CrossRef][Web of Science][Medline]
-
Threadgill, D.W., Dlugosz, A.A., Hansen, L.A., Tennenbaum, T., Lichti, U., Yee, D., LaMantia, C., Mourton, T., Herrup, K., Harris, R.C. et al. (1995) Targeted disruption of mouse EGF receptor: effect of genetic background on mutant phenotype. Science, 269, 230234.
[Abstract/Free Full Text] -
Yamagishi, H., Maeda, J., Hu, T., McAnally, J., Conway, S.J., Kume, T., Meyers, E.N., Yamagishi, C. and Srivastava, D. (2003) Tbx1 is regulated by tissue-specific forkhead proteins through a common Sonic hedgehog-responsive enhancer. Genes Dev., 17, 269281.
[Abstract/Free Full Text] -
Jeong, J., Mao, J., Tenzen, T., Kottmann, A.H. and McMahon, A.P. (2004) Hedgehog signaling in the neural crest cells regulates the patterning and growth of facial primordia. Genes Dev., 18, 937951.
[Abstract/Free Full Text] - Mahlapuu, M., Enerback, S. and Carlsson, P. (2001) Haploinsufficiency of the forkhead gene Foxf1, a target for Sonic hedgehog signaling, causes lung and foregut malformations. Development, 128, 23972406.[Web of Science][Medline]
- Wu, S.C., Grindley, J., Winnier, G.E., Hargett, L. and Hogan, B.L. (1998) Mouse Mesenchyme forkhead 2 (Mf2): expression, DNA binding and induction by Sonic hedgehog during somitogenesis. Mech. Dev., 70, 313.[CrossRef][Web of Science][Medline]
- Eichberger, T., Regl, G., Ikram, M.S., Neill, G.W., Philpott, M.P., Aberger, F. and Frischauf, A.M. (2004) FOXE1, a new transcriptional target of GLI2 is expressed in human epidermis and basal cell carcinoma. J. Invest. Dermatol., 122, 11801187.[CrossRef][Web of Science][Medline]
-
Missero, C., Di Cunto, F., Kiyokawa, H., Koff, A. and Dotto, G.P. (1996) The absence of p21Cip1/WAF1 alters keratinocyte growth and differentiation and promotes ras-tumor progression. Genes Dev., 10, 30653075.
[Abstract/Free Full Text] - Hennings, H., Michael, D., Cheng, C., Steinert, P., Holbrook, K. and Yuspa, S.H. (1980) Calcium regulation of growth and differentiation of mouse epidermal cells in culture. Cell, 19, 245254.[CrossRef][Web of Science][Medline]
-
Ohno, M., Zannini, M., Levy, O., Carrasco, N. and di Lauro, R. (1999) The paired-domain transcription factor Pax8 binds to the upstream enhancer of the rat sodium/iodide symporter gene and participates in both thyroid-specific and cyclic-AMP-dependent transcription. Mol. Cell. Biol., 19, 20512060.
[Abstract/Free Full Text] - Panteleyev, A.A., Paus, R., Wanner, R., Nurnberg, W., Eichmuller, S., Thiel, R., Zhang, J., Henz, B.M. and Rosenbach, T. (1997) Keratin 17 gene expression during the murine hair cycle. J. Invest. Dermatol., 108, 324329.[CrossRef][Web of Science][Medline]
- Eckhart, L., Ban, J., Fischer, H. and Tschachler, E. (2000) Caspase-14: analysis of gene structure and mRNA expression during keratinocyte differentiation. Biochem. Biophys. Res. Commun., 277, 655659.[CrossRef][Web of Science][Medline]
- Sundberg, J.P., Dunstan, R.W., Roop, D.R. and Beamer, W.G. (1994) Full-thickness skin grafts from flaky skin mice to nude mice: maintenance of the psoriasiform phenotype. J. Invest. Dermatol., 102, 781788.[CrossRef][Web of Science][Medline]
-
McGowan, K.M. and Coulombe, P.A. (1998) Onset of keratin 17 expression coincides with the definition of major epithelial lineages during skin development. J. Cell. Biol., 143, 469486.
[Abstract/Free Full Text] -
Rothnagel, J.A. and Rogers, G.E. (1986) Trichohyalin, an intermediate filament-associated protein of the hair follicle. J. Cell. Biol., 102, 14191429.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
M. Kunisada, C.-Y. Cui, Y. Piao, M. S.H. Ko, and D. Schlessinger Requirement for Shh and Fox family genes at different stages in sweat gland development Hum. Mol. Genet., May 15, 2009; 18(10): 1769 - 1778. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-H. Gu and P. A. Coulombe Hedgehog Signaling, Keratin 6 Induction, and Sebaceous Gland Morphogenesis: Implications for Pachyonychia Congenita and Related Conditions Am. J. Pathol., September 1, 2008; 173(3): 752 - 761. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Dentice, C. Luongo, S. Huang, R. Ambrosio, A. Elefante, D. Mirebeau-Prunier, A. M. Zavacki, G. Fenzi, M. Grachtchouk, M. Hutchin, et al. Sonic hedgehog-induced type 3 deiodinase blocks thyroid hormone action enhancing proliferation of normal and malignant keratinocytes PNAS, September 4, 2007; 104(36): 14466 - 14471. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








