Human Molecular Genetics Advance Access originally published online on September 22, 2004
Human Molecular Genetics 2004 13(22):2829-2840; doi:10.1093/hmg/ddh304
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Human Molecular Genetics, Vol. 13, No. 22 © Oxford University Press 2004; all rights reserved
The del22q11.2 candidate gene Tbx1 regulates branchiomeric myogenesis
Department of Genetics and Development, Columbia University, 701 West 168th Street, New York, NY 10032, USA
Received July 16, 2004; Accepted September 15, 2004
| ABSTRACT |
|---|
|
|
|---|
Formation and remodeling of the pharyngeal arches play central roles in craniofacial development. TBX1, encoding a T-box-containing transcription factor, is the major candidate gene for del22q11.2 (DiGeorge or velo-cardio-facial) syndrome, characterized by craniofacial defects, thymic hypoplasia, cardiovascular anomalies, velopharyngeal insufficiency and skeletal muscle hypotonia. Tbx1 is expressed in pharyngeal mesoderm, which gives rise to branchiomeric skeletal muscles of the head and neck. Although the genetic control of craniofacial muscle development is known to involve pathways distinct from those operational in the trunk, the regulation of branchiomeric myogenesis has remained enigmatic. Here we show that branchiomeric muscle development is severely perturbed in Tbx1 mutant mice. In the absence of Tbx1, the myogenic determination genes Myf5 and MyoD fail to be normally activated in pharyngeal mesoderm. Unspecified precursor cells expressing genes encoding the transcriptional repressors Capsulin and MyoR are present in the mandibular arch of Tbx1 mutant embryos. Sporadic activation of Myf5 and MyoD in these precursor cells results in the random presence or absence of hypoplastic mandibular arch-derived muscles at later developmental stages. Tbx1 is also required for normal expression of Tlx1 and Fgf10 in pharyngeal mesoderm, in addition to correct neural crest cell patterning in the mandibular arch. Tbx1 therefore regulates the onset of branchiomeric myogenesis and controls normal mandibular arch development, including robust transcriptional activation of myogenic determination genes. While no abnormalities in branchiomeric myogenesis were detected in Tbx1+/ mice, reduced TBX1 levels may contribute to pharyngeal hypotonia in del22q11.2 patients.
| INTRODUCTION |
|---|
|
|
|---|
Formation and remodeling of the pharyngeal arches play central roles in development of the face and neck (1). Pharyngeal arches form in a rostrocaudal sequence and comprise ectoderm, endoderm and neural crest-derived mesenchyme surrounding a mesodermal core. Pharyngeal endoderm gives rise to glandular derivatives including the thymus and parathyroid glands, whereas neural crest-derived mesenchyme gives rise to cartilage, bone and connective tissue and contributes to septation of the cardiac outflow tract (2).
The mesodermal core of the pharyngeal arches is derived from cranial paraxial and anterior occipital mesoderm which migrates laterally into the pharyngeal region and gives rise to branchiomeric skeletal muscles of the head and neck (36). Branchiomeric muscles include muscles of mastication, derived from the first or mandibular arch; muscles of facial expression, derived from the second or hyoid arch; and muscles of the pharynx and larynx, derived from more caudal arches (2). Non-branchiomeric head muscles include extra-ocular muscles derived from the anterior-most paraxial and pre-chordal mesoderm, and tongue muscles, which are derived from the hypoglossal cord and originate in anterior somites (2,7). The genetic regulation of craniofacial myogenesis has remained enigmatic (6,810). Members of the MyoD family of basic helixloophelix myogenic regulatory factors (MRFs) act at a nodal point in the establishment of skeletal muscle lineages throughout the embryo and are first expressed in the pharyngeal arches of the mouse at embryonic day (E) 9.5 (reviewed in 11). However, distinct pathways regulate MRF expression in head versus trunk mesoderm (6,810). Mice lacking Myf5 and the paired homeodomain transcription factor Pax3 do not develop skeletal muscle in the trunk or limb, yet head muscles form normally (9). Furthermore, Wnt signals, which promote trunk myogenesis, have been recently shown to block head myogenesis (12). The transcription factors that activate Myf5 and MyoD expression in pharyngeal mesoderm are unknown, although mice lacking two bHLH repressor proteins, Capsulin and MyoR, fail to express Myf5 in the first arch and lack a subset of mandibular arch-derived muscles (13).
del22q11.2 (DiGeorge or velo-cardio-facial) syndrome is characterized by craniofacial defects, thymic hypoplasia, cardiovascular anomalies, velopharyngeal insufficiency and skeletal muscle hypotonia, associated in the majority of cases with a heterozygous multigene deletion of chromosome 22q11.2 (14). Through analysis of the homologous region of the murine genome, the gene encoding the T-box-containing transcription factor TBX1 has been identified as a major candidate gene for del22q11.2 syndrome (reviewed in 15). Point mutations in TBX1 have recently been identified in DiGeorge patients who do not carry a multigene deletion at 22q11.2 (16). Tbx1 is expressed in pharyngeal endoderm and mesoderm (17), and mice lacking Tbx1 display perinatal lethality and exhibit defects in the majority of structures perturbed in del22q11.2 patients, including failure of caudal pharyngeal morphogenesis and associated craniofacial and cardiovascular defects (18,19). Mice heterozygous for Tbx1 display abnormal development of the fourth pharyngeal arch artery at E10.5, a defect associated with the cardiovascular anomalies observed in del22q11.2 patients (18,20).
Here we demonstrate that Tbx1 regulates the onset of branchiomeric myogenesis in the mouse. Loss of Tbx1 results in sporadic activation of Myf5 and MyoD in the mandibular arch and the random presence or absence of hypoplastic first arch-derived muscles at later developmental stages. Tbx1 is therefore required for robust transcriptional activation of myogenic determination genes in the mandibular arch. We demonstrate that Tbx1 also regulates the expression of Tlx1 and Fgf10 in the mesodermal core of the mandibular arch and the patterning of surrounding neural crest cells. Our results have important implications for the study of craniofacial development and suggest that reduced TBX1 levels may underlie pharyngeal hypotonia in del22q11.2 syndrome patients.
| RESULTS |
|---|
|
|
|---|
Tbx1 is required for normal activation of Myf5 and MyoD in pharyngeal mesoderm
Tbx1 is expressed in the mesodermal core of the first and second pharyngeal arches during E9 (Fig. 1A and B). Transcripts encoding the MRFs Myf5 and MyoD are activated in the mesodermal core of the first and second arches at E9.5 (Fig. 1C, D and I). Tbx1 mutant mice have been previously generated and found to model multiple aspects of del22q11.2 syndrome (18). We investigated MRF gene expression in Tbx1 heterozygous and homozygous mutant embryos by in situ hybridization. Myf5 and MyoD are activated normally in the pharyngeal arches of Tbx1+/ embryos (Fig. 1D, E, I and J). In contrast, in Tbx1/ embryos, no Myf5 transcripts were detected in the pharyngeal region at E9.5 (Fig. 1F), whereas Myf5 expression in the somites is indistinguishable in Tbx1/ and Tbx1+/ embryos (Fig. 1E and F). Transcriptional activation of Myf5 fails not only in the second pharyngeal arch, which is severely hypoplastic in Tbx1 mutant embryos (18,19), but also in the mandibular arch. A transgene containing a nuclear-localized ß-galactosidase reporter gene controlled by 96 kb of DNA upstream from the Myf5 gene (y96Myf5nlacZ), which reproduces the endogenous Myf5 expression pattern (21), also fails to be activated throughout the mesodermal core of the first and second arches of Tbx1/ embryos (Fig. 1G and H). However, the cellular resolution provided by the reporter gene revealed sporadic patches of ß-galactosidase-positive cells in the mandibular arch of Tbx1/ embryos (Fig. 1H and H'). Similarly, sporadic patches of MyoD-expressing cells were observed in the mandibular arch of Tbx1/ embryos (Fig. 1K and K').
|
Tbx1 is not required for migration of cranial paraxial mesoderm into the mandibular arch
The mesodermal core of the pharyngeal arches is derived from cranial paraxial mesoderm which migrates laterally into the pharyngeal region (36). Patches of MRF-expressing cells in the mandibular arch could result from sporadic transcriptional activation in a subset of cells within the mesodermal core, or from normal activation in a severely hypocellular core. Capsulin, encoding a bHLH transcriptional repressor, is expressed in the mesodermal core prior to Myf5 expression (Fig. 2A; 13). Capsulin and the related bHLH transcriptional repressor gene MyoR are required for Myf5 activation in the mandibular arch; Capsulin MyoR double mutant embryos subsequently fail to form a subset of skeletal muscles derived from the first arch (13). We analyzed Capsulin expression in Tbx1/ embryos in order to investigate whether normal lateral migration of cranial paraxial mesoderm to the pharyngeal arches takes place in the absence of Tbx1. Capsulin transcripts are observed in the mesodermal core of the mandibular arch of Tbx1/ embryos in a profile indistinguishable from that of Tbx1+/ embryos (Fig. 2AF); in contrast, no Capsulin transcripts accumulate in the region of the second arch of Tbx1/ embryos (Fig. 2B and D). MyoR is also expressed in the mandibular arch of Tbx1 mutant embryos at E9.5 (Figs 2H and 3B). This result demonstrates that migration of cranial paraxial mesoderm into the mandibular arch takes place in the absence of Tbx1. Pre-myogenic cells are therefore present in the mandibular arch of Tbx1/ embryos, although the majority of these cells fail to activate MRF transcription.
|
|
In order to investigate whether Tbx1 directly activates Myf5 transcription in branchial arch mesoderm, we searched for T-box-binding sites in a previously identified 1.1 kb branchiomeric enhancer of the Myf5 gene (22). We identified a T-box motif (GTGTGAA) at nucleotide 636 which is conserved in six mammalian species (cow, dog, man, mouse, pig and rat). The in vivo role of this element was evaluated by site directed mutagenesis followed by transgenesis. Four out of six embryos carrying the wild-type enhancer upstream of a minimal TK promoter expressed an nlacZ reporter gene in myogenic cells of the branchial arches at E11.5. Four out of five embryos carrying the mutated enhancer expressed the reporter gene in a similar distribution in branchial arch muscle masses. This result demonstrates that Myf5 transcription in pharyngeal mesoderm is not dependent on this T-box site. The role of less conserved T-box sites present in the 1.1 kb enhancer, and in other branchiomeric enhancers at the Myf5 locus (23), remains to be evaluated.
Tbx1 regulates Tlx1 and Fgf10 expression in pharyngeal mesoderm
We investigated whether other genes normally expressed in the mandibular arch show aberrant expression patterns in Tbx1/ embryos. Tlx1, encoding a homeobox-containing transcription factor, is expressed in the mesodermal core of the first and second arches at E9.5 (Fig. 3C and C') (24). In the absence of Tbx1, Tlx1 transcript levels are severely reduced, but still detectable, in the mesodermal core, whereas Tlx1 expression in surface ectoderm of the mandibular arch is unaffected (Fig. 3D and D'). Mice lacking Tlx1 are asplenic but viable and fertile, and pharyngeal- and first arch-derived muscles are present and anatomically normal (25), demonstrating that Tlx1, although downregulated in the absence of Tbx1, is not required for branchiomeric myogenesis.
Fgf10, encoding a fibroblast growth factor, is also expressed in the mesodermal core of the pharyngeal arches at E9.5 (Fig. 3E) (26). Fgf10 transcripts do not accumulate in the mesodermal core of Tbx1/ mandibular arches, whereas expression in first arch ectoderm is unaffected (Fig. 3F) (27). To pursue this observation, we analyzed the expression profile of an Fgf10 enhancer-trap nlacZ transgene (Mlc1vnlacZ24) (26) in Tbx1 mutant embryos. Consistent with the loss of endogenous Fgf10 transcripts in the mesodermal core of the mandibular arch, the Fgf10 enhancer-trap transgene fails to be expressed in the proximal core region of the mandibular arch of Tbx1/ embryos (Fig. 3G and H). Transgene expression, however, was maintained in the distal region of the mesodermal core, in proximity to the aortic sac (arrow in Fig. 3H and H'), where Myf5 and MyoD are not expressed.
Fgf10 null mice die at birth, lacking lungs, limbs and displaying aplasia and hypoplasia of multiple other organs (28,29). Since Fgf10 is expressed in pharyngeal mesodermal prior to E9.5 (26), we investigated whether Fgf10 is required for MRF gene activation by crossing the y96Myf5nlacZ transgene into an Fgf10 mutant background (28). Normal activation of the transgene was observed in branchiomeric muscle masses in the absence of Fgf10 (Fig. 3I and J), indicating that Fgf10, although downstream of Tbx1, is not required for the activation of Myf5.
Tbx1 is required to pattern neural crest-derived mesenchyme in the mandibular arch
In addition to investigating gene expression in the mesodermal core, we examined gene expression in the surrounding mandibular mesenchyme of Tbx1/ embryos. Crabp1 in situ hybridization revealed that neural crest cells colonize the Tbx1/ mandibular arch (Fig. 4A and B), confirming the observations of Vitelli et al. (19). However, although neural crest cells are present in the mandibular arch of Tbx1/ embryos, mandibular mesenchyme is abnormally patterned. We observed altered distributions of transcripts encoding the regionally expressed transcription factors Tbx2, Tbx3, Dlx7, Msx2 and Prx2 in the mandibular arch of Tbx1/ embryos (Fig. 4CL). The predominant defect was an expanded expression domain of these genes in the proximal arch region (arrows in Fig. 4D, F, H, J and L). Expansion of the Tbx2 expression domain was observed in three out of four Tbx1/ mandibular arches scored; in one arch Tbx2 transcripts were observed throughout the mandibular mesenchyme (Fig. 4D). In addition, a reduction of Dlx7 transcripts in the anterior region of the mandibular arch was noted (arrowhead in Fig. 4H and H'). These results suggest that, in addition to the defect in myogenic specification of the Tbx1/ mesodermal core, patterning defects in surrounding neural crest cells may contribute to the mutant phenotype.
|
BMP and Wnt inhibitors in mandibular mesenchyme have been shown to promote branchiomeric myogenesis by antagonizing anti-myogenic signals from pharyngeal epithelia, thus regulating the activation of MRF genes in the mesodermal core on neural crest influx (12). Tzahor et al. (12) demonstrated in the chick that Frzb and Gremlin are expressed in neural crest cells adjacent to the mesodermal core of the first and second pharyngeal arches at the time of myogenic induction. We investigated the distribution of Frzb1 and Gremlin transcripts in Tbx1/ embryos at E9.5 (Fig. 4MP). Frzb1 expression was observed in the mandibular arch of control and Tbx1/ embryos (Fig. 4M and N). An expanded domain of Frzb1 expression was observed in the proximal mandibular arch in the absence of Tbx1 (Fig. 4N), similar to that observed for Tbx2 and Tbx3 (Fig. 4). Gremlin transcripts were only detectable in the mandibular arch at a low level, in both control and Tbx1/ embryos (Fig. 4O and P). In contrast, Gremlin expression in the second arch was absent from the hypoplastic Tbx1/ second arch region (Fig. 4O and P). These results suggest that Tbx1-dependent MRF gene activation in the mandibular arch is not mediated by Frzb1 or Gremlin transcription.
Sporadic mandibular myogenesis and failure of caudal branchiomeric myogenesis in the absence of Tbx1
At mid-gestation, Myf5 and MyoD expression is severely reduced in the pharyngeal region of Tbx1/ compared with Tbx1+/+ and Tbx1+/ embryos (Fig. 5AC and HJ). Muscle masses derived from the first and second arches, in addition to muscle masses that normally form in the caudal pharyngeal region, are missing from Tbx1/ embryos (Fig. 5C and J). Small unilateral patches of MRF-expressing cells within the normal domain of mandibular arch-derived muscle mass development are present in almost all Tbx1/ embryos analyzed at E10.5 (Fig. 5D, E, G, KL'). In addition to single unilateral patches of MRF-positive cells within the mandibular arch, we observed asymmetric bilateral patches and spatially separate unilateral patches of MRF expression (Fig. 5D and L). Rare spots of MRF expression were observed at the site of second arch muscle formation (arrow in Fig. 5E). These results are consistent with sporadic activation of MRF transcription in the absence of Tbx1. MRF expression at sites of non-branchiomeric myogenesis, including somites, limb-bud muscle masses, extra-ocular muscles and the hypoglossal cord, is normal in Tbx1/ embryos, although the length of the hypoglossal cord is reduced owing to perturbed caudal pharyngeal morphology (Fig. 5IL).
|
At subsequent developmental stages, the expression of MRF genes in the second and caudal pharyngeal arches is sever-ely perturbed or absent, suggesting that the majority of branchiomeric muscles do not form in Tbx1/ embryos (Fig. 6), including muscles of the pharynx, larynx and part of the developing trapezius muscle (arrow in Fig. 6A, D and E). However, unilateral (or asymmetric bilateral) patches of MRF expression were observed in Tbx1/ embryos in the region where mandibular arch-derived muscle masses normally develop (arrowheads in Fig. 6C and H). Extremely hypoplastic laryngeal muscles were present in a subset of Tbx1/ embryos (data not shown). Expression of Myf5 or MyoD is essential for skeletal muscle determination, and mice lacking both genes develop neither differentiated skeletal muscle fibres nor skeletal myoblasts (30). Failure of branchiomeric myogenesis was confirmed by analysis of Myogenin transcripts, encoding a member of the MRF family essential for differentiation (Fig. 6I and J), and two differentiation markers, a myosin light chain transgene (Mlc3fnlacZ2E; Fig. 6KM) and embryonic myosin light chain transcripts (Mlc1a/emb; data not shown). No differences in MRF or differentiation marker expression were observed between Tbx1+/ and Tbx1+/+ littermates (Fig. 6K and L). Normally developing hypobranchial and tongue muscle development was apparent in the absence of branchiomeric muscles, consistent with the presence of the hypoglossal cord at earlier developmental stages (Fig. 6N and O).
|
A subset of the normal complement of mandibular arch-derived muscles was observed in all Tbx1/ embryos scored at late fetal stages (n=11; Fig. 7; Table 1). Tbx1/ mandibular arch-derived muscles are frequently hypoplastic and asymmetric or unilateral. Each mandibular arch-derived muscle was absent in at least one embryo. When present, Tbx1/ first arch-derived muscles contain both primary and secondary muscle fibers, indicating that the normal sequence of myofiber development can take place in the absence of Tbx1 (Fig. 7I and J). Individual muscles were either unilaterally present on the right or left side (Fig. 7BD), smaller on one side than the other (Fig. 7C), bilaterally symmetric (Fig. 7E) or bilaterally absent (Fig. 7F; Table 1). Muscle loss is significantly more severe on the left than right side (P<0.01). Although almost all second arch-derived muscles were absent (Fig. 7G and H), rare hypoplastic fibers were observed at sites of normal second arch muscle formation (arrowhead in Fig. 7B). Our data suggest that the formation of first arch-derived muscles in Tbx1/ embryos is a direct consequence of sporadic activation of MRF transcription in the mandibular arch, and that the precise sub-regions of the mesodermal core in which MRF activation occurs define the resulting complement of first arch-derived muscles. Furthermore, although sporadic Tbx1-independent MRF activation can occur in either the left or right mandibular arch, the probability of activation occurring in the right arch is greater than that in the left arch.
|
|
Branchiomeric muscles form normally in Tbx1+/ mice
Patients with del22q11.2 syndrome are haploinsufficient for TBX1 and, in most cases, about 30 linked genes on chromosome 22q11.2 (14). Although we observed no differences in MRF or myogenic differentiation-specific gene expression between Tbx1+/+ and Tbx1+/ littermates during in utero development (Figs 5 and 6), we examined branchiomeric muscles in Tbx1+/+ and Tbx1+/ mice at 5 weeks of age (Fig. 8). The use of a fast fiber myosin light chain nlacZ transgene (Mlc3fnlacZ2E) permitted detailed comparison of heterozygous and wild-type pharyngeal and laryngeal muscles by whole-mount and histological analysis. All Tbx1+/ branchiomeric muscles scored were present and appeared anatomically normal (n=6), including mandibular arch-derived muscles (Fig. 8A and B), pharyngeal constrictor muscles (Fig. 8CF and MR) and intrinsic laryngeal muscles (Fig. 8GL and OR) derived from the caudal branchiomeric region. Furthermore, expression of the fast fiber muscle transgene was comparable in Tbx1+/+ and Tbx1+/ muscles (Fig. 8).
|
| DISCUSSION |
|---|
|
|
|---|
In this paper we have demonstrated that Tbx1 regulates the onset of branchiomeric myogenesis in the mouse. The failure of branchiomeric myogenesis in Tbx1/ mice uncovers an evolutionarially conserved role for Tbx1 in pharyngeal muscle development. The zebrafish van gogh (vgo) mutation shows loss and reduction of certain pharyngeal muscles (31). Vgo alleles have recently been shown to result from point mutations in the zebrafish tbx1 gene (32). Our results in the mouse significantly extend these observations and reveal a low-level of sporadic myogenesis in the mandibular arch which is Tbx1-independent. We demonstrate that Tbx1 is not required for myogenic differentiation but rather functions during the initiation of branchiomeric myogenesis to ensure robust bilateral activation of MRF genes in pharyngeal mesoderm. Our findings have direct implications for the understanding of skeletal muscle heterogeneity, craniofacial development and the pathogenesis of del22q11.2 syndrome.
Here we discuss two possible mechanisms by which Tbx1 could regulate MRF activation in the mandibular arch. Myf5 and MyoD could be direct transcriptional targets of Tbx1 (Fig. 9, pathway A); alternatively, or in addition, Tbx1 could indirectly regulate MRF gene activation through modulation of pro-myogenic signals in surrounding neural crest cells (pathway B).
|
According to pathway A, Tbx1 is a direct regulator of MRF genes and loss of Tbx1 would directly impair the robustness of branchiomeric enhancers of Myf5 and MyoD. Enhancer elements have been argued to act in a stochastic fashion to increase the probability that a regulated gene will be transcribed in each cell within the domain of enhancer action (33). Impaired branchiomeric enhancer function would result in reduced probability of transcriptional activation in pre-myogenic cells of the mandibular core, consistent with our observations of sporadic MRF activation in the absence of Tbx1. Such a hypothesis is in agreement with observations that a T-box-binding site mediates activation of Xenopus Myf5 in trunk muscle and that ascidan and sea-urchin T-box genes are implicated in activation of the skeletal myogenic program (3436). Furthermore, a Caenorhabditis elegans Tbx1 subfamily member, MLS-1, acts as a fate switch during specification of non-striated muscle, a role similar to that of muscle founder identity genes in Drosophila (37). Myf5 expression in branchiomeric muscles is regulated by at least five elements in an extended region upstream of and within the Myf5 gene (8,2123). We have identified T-box-binding sites in defined Myf5 pharyngeal arch enhancer elements, including a highly conserved site GTGTGAA in the 1.1 kb branchial arch enhancer defined by Summerbell et al. (22). However, site directed mutagenesis of this T-box target site in transgenic embryos did not impair enhancer activity in pharyngeal mesoderm. Future experiments will address whether additional T-box target sites in the 1.1 kb or other branchial arch enhancer elements mediate activation of Myf5 by Tbx1.
Tlx1 and Fgf10 are additional targets of Tbx1 in the mesodermal core of the mandibular arch. However, neither of these genes appears to act downstream of Tbx1 in the regulation of branchiomeric myogenesis, since first arch-derived muscles form normally in Tlx1 mutant mice (25), and a Myf5nlacZ transgene is expressed normally in branchiomeric muscle masses of Fgf10/ embryos. Our observations concerning Tbx1-dependent core expression of Fgf10 are consistent with those of Vitelli et al. (27), and the recent demonstration that Tbx1 can activate an Fgf10 promoter in COS-7 cells through a conserved T-box-binding element (38). However, analysis of an Fgf10 enhancer-trap transgene in Tbx1 mutant embryos reveals that transgene expression in the distal region of the mesodermal core is Tbx1-independent. Although the extent of overlap between endogenous Fgf10 and Tbx1 expression in the distal mesodermal core remains to be determined, this result suggests that Tbx1 specifically regulates transcription in the proximal region of the mesodermal core where MRF gene activation takes place.
In contrast to Myf5, MyoD, Fgf10 and Tlx1, the genes encoding the transcriptional repressors Capsulin and MyoR are expressed normally in the mesodermal core of the Tbx1/ mandibular arch. The presence of Capsulin and MyoR transcripts demonstrates that Tbx1 does not regulate the lateral movement of cranial paraxial mesoderm into the mandibular arch. In contrast, MyoR and Capsulin transcripts are absent from the second and more caudal arches, which are severely hypoplastic in Tbx1/ embryos (18). Thus, unlike the situation in the mandibular arch, failure of branchiomeric myogenesis in the second and more caudal arches of Tbx1/ embryos is essentially a result of failure of caudal pharyngeal morphogenesis, possibly involving proliferation defects as documented for progenitor cells of the outflow tract of the heart (38). However, the expression pattern of Tbx1 in pharyngeal mesoderm and the observation of sporadic muscle fibers at the sites of second arch-derived muscle formation (Figs 5E and 7B) suggest that Tbx1 may play a series of roles, regulating pharyngeal outgrowth and subsequently ensuring robust bilateral MRF expression at sites of caudal branchiomeric myogenesis, analagous to our observations in the mandibular arch.
Capsulin and MyoR are together required for Myf5 activation in the mandibular arch, and for subsequent development of a subset of first arch-derived muscles (13). Capsulin and MyoR, however, are not sufficient to activate robust MRF expression in the absence of Tbx1, although they may contribute to the low level of sporadic MRF activation observed in Tbx1/ embryos. Since Capsulin, but not MyoR, is expressed prior to MRF activation, and since branchiomeric myogenesis is normal in Capsulin/ embryos (13), it appears unlikely that Capsulin/MyoR act upstream of Tbx1 in the mandibular arch. We conclude that Capsulin/MyoR and Tbx1 define independent parallel inputs into branchiomeric myogenesis, which converge at the level of MRF activation (Fig. 9).
Tbx1 could also control MRF expression indirectly, through the regulation of pro-myogenic signals in the mandibular arch (Fig. 9, pathway B). Candidate signals include secreted Wnt and BMP inhibitors expressed in mandibular mesenchyme at the time of MRF gene activation. Frzb and Gremlin, Wnt and BMP antagonists, respectively, have been proposed to isolate the mesodermal core from anti-myogenic signals originating from pharyngeal endoderm or ectoderm (12). Our results demonstrate that Frzb1 and low level Gremlin expression are maintained in the Tbx1/ mandibular arch. However, Tbx1 regulated signals from pharyngeal mesoderm to surrounding neural crest cells could interfere with signaling at the post-transcriptional level or regulate transcription of as yet unidentified BMP or Wnt antagonists. Indeed, transcripts encoding regionally expressed transcription factors in the mandibular neural crest mesenchyme are abnormally distributed in the absence of Tbx1. Aberrant neural crest migration has been documented in Tbx1 mutant mice (19) and may underlie the altered gene expression domains documented here. In addition to a defect in specification of the mesodermal core, loss of Tbx1 therefore results in abnormalities of the surrounding neural crest cells, which could in turn lead to further developmental defects in core mesoderm (Fig. 9). Our results demonstrate that Tbx1 plays a central role in mandibular development and suggest that Tbx1 may control MRF activation and subsequent branchiomeric myogenesis through both direct and indirect mechanisms. Since Tbx1 is expressed in pharyngeal endoderm in addition to core mesoderm, conditional mutagenesis will be required to define the relative importance of each of these expression domains in the regulation of branchiomeric myogenesis.
Tbx1 mutant mice display defects in the majority of structures perturbed in del22q11.2 patients, including mesenchymal derivatives of the first pharyngeal arch, such as the inner ear, tooth and mandible (18). Our finding that specification of skeletal myogenesis is abnormal in the mandibular arch of Tbx1/ mice suggests that many of these craniofacial defects may be secondary to abnormal specification of the mesodermal core. Skeletal muscle hypotonia has been noted in >50% of del22q11.2 patients (3941). Furthermore, defects in pharyngeal muscles contribute to velopharyngeal insufficiency, which occurs in 90% of del22q11.2 patients (42). We observed no differences between Tbx1+/+ and Tbx1+/ branchiomeric muscles during in utero development or at 5 weeks of age. However, the cardiovascular and craniofacial phenotype of Tbx1+/ mice is milder than that of haploinsufficient del22q11.2 patients, while almost all structures affected in the human syndrome are severely affected in Tbx1/ embryos (18). Our results suggest that this is also true of branchiomeric myogenesis, and that reduced TBX1 levels may lead to pharyngeal hypotonia in del22q11.2 patients.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Mice carrying the null allele Tbx1tm1Pa (here referred to as Tbx1) have been previously described (18), as have mice carrying the y96Myf5nlacZ, Mlc1vnlacZ24 and Mlc3fnlacZ2E transgenes (21,26,43). Fgf10+/ mice were kindly provided by Drs N. Itoh and S. Kato (28). Mice were maintained on a mixed genetic background. Tbx1 genotypes were determined using PCR on DNA isolated from tail tips or yolk sacs using the primer combinations defined by Jerome and Papaioannou (18); Fgf10 genotypes were carried out as described by Sekine et al. (28).
X-gal revelation, whole mount in situ hybridization and histology were performed as previously described (18,43). MF20 antibody developed by D. Fishman, Cornell University Medical College, was obtained from the Developmental Studies Hybridoma Bank, NICHD, University of Iowa, Department of Biological Sciences, Iowa City, IA, USA. Immunohistochemistry was carried out on 14 µm cryostat sections as described previously (43). The statistical significance of rightleft differences in Tbx1/ mandibular arch-derived muscles was determined by the chi square test.
Riboprobes to detect transcripts of myogenic regulatory and structural genes were prepared as described elsewhere (9). Templates for MyoR (503 bp), Capsulin (460 bp) and Frzb1 (426 bp) were prepared by PCR from mouse strain 129 DNA using the following primers: MyoR 5'-TCTAGATCTACGTGGCCATTCGTGGTCTCTGGAC, MyoR 3'-CCGAAGAGCTCTAATGCCGGCCTTC; Capsulin 5'-TCTAGATCTCTCTAAACATGTCCACTGGCTCC, Capsulin 3'-CAGGTTGACTGGGTGAATGTAACCG; Frzb1 5'-TCTAGATCTTAAGGGGCACACTGGAATCAGTAGC, Frzb1 3'-GTGCAATGGCTTAAACCTACCCACC.
Products were subcloned in pGEM-TEasy prior to synthesis of antisense riboprobes using the restriction endonuclease BglII and T7 RNA polymerase (Capsulin) and BglII and SP6 RNA polymerase (MyoR and Frzb1). Tlx1 riboprobe was synthesized using T7 RNA polymerase and BamHI digested IMAGE clone 4164519. A plasmid generating a 1700 nucleotide Dlx7 riboprobe was kindly provided by T. Lufkin (Mount Sinai Medical Centre, NY, USA). Other probes have been described elsewhere: Tbx1, Tbx2 and Tbx3 (17), Prx2 (44), Gremlin (45), Crabp1 (46) and Msx2 (47).
A 1.1 kb NheIBsaBI Myf5 branchial arch enhancer (22) was amplified from mouse DNA using primers M5A-F and M5A-R and subcloned in pGEM-TEasy. Mutagenesis of the T-box target site at nucleotide 636 was carried out using the QuikChange XL site directed mutagenesis kit (Stratagene) and primers M5A-mut1 and M5A-mut2. Mutant and wild-type enhancers were DNA sequence verified and subcloned into a NotI site upstream of the TK promoter and nlacZ reporter gene in pSKTTKnlacZ (48). Transgenic embryos were generated by pronuclear injection and analyzed at E11.5; 4 independent X-gal-positive embryos were obtained for both wild-type and mutant constructs. Primers: M5A-F CAGCTAGCAAGTGCAGTGATTGGC, M5A-R GATGGTCATCTCATGGGGATGACAG; M5A-mut1 GGCTTTTGTCACCAAAGTACTAGAAGCCACTCTTTTAAGAGGAG, M5A-mut2 CTCCTCTTAAAAGAGTGGCTTCTAGTACTTTGGTGACA AAAGCC.
| ACKNOWLEDGEMENTS |
|---|
We thank Sharaghim Tajbakhsh for discussion and probes, Juliette Hadchouel and Margaret Buckingham for providing y96Myf5nlacZ mice, Marcia Ontell for providing Mlc3fnlacZ2E mice; Nobu Itoh and Shigeaki Kato for providing Fgf10+/ mice and Thomas Lufkin and Richard Harland for probes. This work was supported by NIH grant HD33082 (V.E.P.). R.G.K. is an INSERM research fellow.
| FOOTNOTES |
|---|
* To whom correspondence should be addressed. Tel: +1 2123054791; Fax: +1 2129232090; Email: rk2149{at}columbia.edu
| REFERENCES |
|---|
|
|
|---|
- Richman, J.M. and Lee, S.-H. (2003) About face: signals and genes controlling jaw patterning and identity in vertebrates. Bioessays, 25, 554568.[CrossRef][ISI][Medline]
- Kaufman, M.H. and Bard, J.B.L. (1999) The Anatomical Basis of Mouse Development. Academic Press, San Diego, pp. 6076.
- Noden, D.M. (1983) The embryonic origins of avian cephalic and cervical muscles and associated connective tissues. Am. J. Anat., 168, 257276.[CrossRef][ISI][Medline]
- Couly, G.F., Coltey, P.M. and Le Douarin, N.M. (1992) The developmental fate of the cephalic mesoderm in quailchick chimeras. Development, 114, 115.[Abstract]
-
Trainor, P.A., Tan, S.S. and Tam, P.P. (1994) Cranial paraxial mesoderm: regionalisation of cell fate and impact on craniofacial development in mouse embryos. Development, 120, 23972408.
[Abstract/Free Full Text] - Hacker, A. and Guthrie, S. (1998) A distinct developmental programme for the cranial paraxial mesoderm in the chick embryo. Development, 125, 34613472.[Abstract]
- Mackenzie, S., Walsh, F.S. and Graham, A. (1998) Migration of hypoglossal myoblast precursors. Dev. Dyn., 213, 349358.[CrossRef][ISI][Medline]
- Patapoutian, A., Miner, J.H., Lyons, G.E. and Wold, B. (1993) Isolated sequences from the linked Myf-5 and MRF4 genes drive distinct patterns of muscle-specific expression in transgenic mice. Development, 118, 6169.[Abstract]
- Tajbakhsh, S., Rocancourt, D., Cossu, G. and Buckingham, M. (1997) Redefining the genetic hierarchies controlling skeletal myogenesis: Pax-3 and Myf-5 act upstream of MyoD. Cell, 89, 127138.[CrossRef][ISI][Medline]
-
Mootoosamy, R.C. and Dietrich, S. (2002) Distinct regulatory cascades for head and trunk myogenesis. Development, 129, 573583.
[Abstract/Free Full Text] - Buckingham, M. (2001) Skeletal muscle formation in vertebrates. Curr. Opin. Genet. Dev., 11, 440448.[CrossRef][ISI][Medline]
-
Tzahor, E., Kempf, H., Mootoosamy, R.C., Poon, A.C., Abzhanov, A., Tabin, C.J., Dietrich, S. and Lassar, A.B. (2003) Antagonists of Wnt and BMP signaling promote the formation of vertebrate head muscle. Genes Dev., 17, 30873099.
[Abstract/Free Full Text] -
Lu, J.R., Bassel-Duby, R., Hawkins, A., Chang, P., Valdez, R., Wu, H., Gan, L., Shelton, J.M., Richardson, J.A. and Olson, E.N. (2002) Control of facial muscle development by MyoR and capsulin. Science, 298, 23782381.
[Abstract/Free Full Text] -
Scambler, P.J. (2000) The 22q11 deletion syndromes. Hum. Mol. Genet., 9, 24212426.
[Abstract/Free Full Text] -
Baldini, A. (2002) DiGeorge syndrome: the use of model organisms to dissect complex genetics. Hum. Mol. Genet., 11, 23632369.
[Abstract/Free Full Text] - Yagi, H., Furutani, Y., Hamada, H., Sasaki, T., Asakawa, S., Minoshima, S., Ichida, F., Joo, K., Kimura, M., Imamura, S. et al. (2003) Role of TBX1 in human del22q11.2 syndrome. Lancet, 362, 13661373.[CrossRef][ISI][Medline]
- Chapman, D.L., Garvey, N., Hancock, S., Alexiou, M., Agulnik, S.I., Gibson-Brown, J.J., Cebra-Thomas, J., Bollag, R.J., Silver, L.M. and Papaioannou, V.E. (1996) Expression of the T-box family genes, Tbx1Tbx5, during early mouse development. Dev. Dyn., 206, 379390.[CrossRef][ISI][Medline]
- Jerome, L.A. and Papaioannou, V.E. (2001) DiGeorge syndrome phenotype in mice mutant for the T-box gene, Tbx1. Nat. Genet., 27, 286291.[CrossRef][ISI][Medline]
-
Vitelli, F., Morishima, M., Taddei, I., Lindsay, E.A. and Baldini, A. (2002) Tbx1 mutation causes multiple cardiovascular defects and disrupts neural crest and cranial nerve migratory pathways. Hum. Mol. Genet., 11, 915922.
[Abstract/Free Full Text] - Lindsay, E.A., Vitelli, F., Su, H., Morishima, M., Huynh, T., Pramparo, T., Jurecic, V., Ogunrinu, G., Sutherland, H.F., Scambler, P.J. et al. (2001) Tbx1 haploinsufficieny in the DiGeorge syndrome region causes aortic arch defects in mice. Nature, 410, 97101.[CrossRef][Medline]
- Hadchouel, J., Tajbakhsh, S., Primig, M., Chang, T.H., Daubas, P., Rocancourt, D. and Buckingham, M. (2000) Modular long-range regulation of Myf5 reveals unexpected heterogeneity between skeletal muscles in the mouse embryo. Development, 127, 44554467.[Abstract]
- Summerbell, D., Ashby, P.R., Coutelle, O., Cox, D., Yee, S. and Rigby, P.W. (2000) The expression of Myf5 in the developing mouse embryo is controlled by discrete and dispersed enhancers specific for particular populations of skeletal muscle precursors. Development, 127, 37453757.[Abstract]
- Carvajal, J.J., Cox, D., Summerbell, D. and Rigby, P.W. (2001) A BAC transgenic analysis of the Mrf4/Myf5 locus reveals interdigitated elements that control activation and maintenance of gene expression during muscle development. Development, 128, 18571868.[Abstract]
- Roberts, C.W., Sonder, A.M., Lumsden, A. and Korsmeyer, S.J. (1995) Development expression of Hox11 and specification of splenic cell fate. Am. J. Pathol., 146, 10891101.[Abstract]
- Roberts, C.W., Shutter, J.R. and Korsmeyer, S.J. (1994) Hox11 controls the genesis of the spleen. Nature, 368, 747749.[CrossRef][Medline]
- Kelly, R.G., Brown, N.A. and Buckingham, M.E. (2001) The arterial pole of the mouse heart forms from Fgf10-expressing cells in pharyngeal mesoderm. Dev. Cell, 1, 435440.[CrossRef][ISI][Medline]
-
Vitelli, F., Taddei, I., Morishima, M., Meyers, E.N., Lindsay, E.A. and Baldini, A. (2002) A genetic link between Tbx1 and fibroblast growth factor signaling. Development, 129, 46054611.
[Abstract/Free Full Text] - Sekine, K., Ohuchi, H., Fujiwara, M., Yamasaki, M., Yoshizawa, T., Sato, T., Yagishita, N., Matsui, D., Koga, Y., Itoh, N. and Kato, S. (1999) Fgf10 is essential for limb and lung formation. Nat. Genet., 21, 138141.[CrossRef][ISI][Medline]
-
Min, H., Danilenko, D.M., Scully, S.A., Bolon, B., Ring, B.D., Tarpley, J.E., DeRose, M. and Simonet, W.S. (1998) Fgf-10 is required for both limb and lung development and exhibits striking functional similarity to Drosophila branchless. Genes Dev., 12, 31563161.
[Abstract/Free Full Text] - Rudnicki, M.A., Schnegelsberg, P.N., Stead, R.H., Braun, T., Arnold, H.H. and Jaenisch, R. (1993) MyoD or Myf-5 is required for the formation of skeletal muscle. Cell, 75, 13511359.[CrossRef][ISI][Medline]
- Piotrowski, T. and Nusslein-Volhard, C. (2000) The endoderm plays an important role in patterning the segmented pharyngeal region in zebrafish (Danio rerio). Dev. Biol., 225, 339356.[CrossRef][ISI][Medline]
-
Piotrowski, T., Ahn, D.G., Schilling, T.F., Nair, S., Ruvinsky, I., Geisler, R., Rauch, G.J., Haffter, P., Zon, L.I., Zhou, Y. et al. (2003) The zebrafish van gogh mutation disrupts tbx1, which is involved in the DiGeorge deletion syndrome in humans. Development, 130, 50435052.
[Abstract/Free Full Text] - Fiering, S., Whitelaw, E. and Martin D.I. (2000) To be or not to be active: the stochastic nature of enhancer action. Bioessays, 22, 381387.[CrossRef][ISI][Medline]
- Lin, G.F., Geng, X., Chen, Y., Qu, B., Wang, F., Hu, R. and Ding, X. (2003) T-box binding site mediates the dorsal activation of myf-5 in Xenopus gastrula embryos. Dev. Dyn., 226, 5158.[CrossRef][ISI][Medline]
-
Mitani, Y., Takahashi, H. and Satoh, N. (2001) Regulation of the muscle-specific expression and function of an ascidian T-box gene, As-T2. Development, 128, 37173728.
[Abstract/Free Full Text] - Croce, J., Lhomond, G., Lozano, J.C. and Gache, C. (2001) ske-T, a T-box gene expressed in the skeletogenic mesenchyme lineage of the sea urchin embryo. Mech. Dev., 107, 159162.[CrossRef][ISI][Medline]
- Kostas, S.A. and Fire, A. (2002) The T-box factor MLS-1 acts as a molecular switch during specification of nonstriated muscle in C. elegans. Genes Dev., 16, 257269.
-
Xu, H., Morishima, M., Wylie, J.N., Schwartz, R.J., Bruneau, B.G., Lindsay, E.A. and Baldini, A. (2004) Tbx1 has a dual role in the morphogenesis of the cardiac outflow tract. Development, 131, 32173227.
[Abstract/Free Full Text] -
Shprintzen, R.J., Goldberg, R., Young, D. and Wolford, L. (1981) The velo-cardio-facial syndrome: a clinical and genetic analysis. Pediatrics, 67, 167172.
[Abstract/Free Full Text] - Gerdes, M., Solot, C., Wang, P.P., Moss, E., LaRossa, D., Randall, P., Goldmuntz, E., Clark, B.J., III, Driscoll, D.A., Jawad, A. et al. (1999) Cognitive and behavior profile of preschool children with chromosome 22q11.2 deletion. Am. J. Med. Genet., 85, 127133.[CrossRef][ISI][Medline]
- Zim, S., Schelper, R., Kellman, R., Tatum, S., Ploutz-Snyder, R. and Shprintzen, R. (2003) Thickness and histologic and histochemical properties of the superior pharyngeal constrictor muscle in velocardiofacial syndrome. Arch. Facial Plastic Surg., 5, 503510.[CrossRef]
- Goldberg, R., Motzkin, B., Marion, R., Scambler, P.J. and Shprintzen, R.J. (1993) Velo-cardio-facial syndrome: a review of 120 patients. Am. J. Med. Genet., 45, 313319.[CrossRef][ISI][Medline]
-
Kelly, R., Alonso, S., Tajbakhsh, S., Cossu, G. and Buckingham, M. (1995) Myosin light chain 3F regulatory sequences confer regionalized cardiac and skeletal muscle expression in transgenic mice. J. Cell Biol., 129, 383396.
[Abstract/Free Full Text] - Optelten, D.J., Vogels, R., Robert, B., Kalkhoven, E., Zwartkruis, F., de Laaf, L., Destree, O.H., Deschamps, J., Lawson, K.A. and Meijlink, F. (1991) The mouse homeobox gene, S8, is expressed during embryogenesis predominantly in mesenchyme. Mech. Dev., 34, 2941.[CrossRef][ISI][Medline]
- Khokha, M.F., Hsu, D., Brunet, L.J., Dionne, M.S. and Harland, R.M. (2003) Gremlin is the BMP antagonist required for maintenance of Shh and Fgf signals during limb patterning. Nat. Genet., 34, 303307.[CrossRef][ISI][Medline]
- Giguere, V., Lyn, S., Yip, P., Siu, C-H. and Amin, S. (1990) Molecular cloning of cDNA encoding a second cellular retinoic acid-binding protein. Proc. Natl Acad. S








