Skip Navigation


Human Molecular Genetics Advance Access originally published online on February 19, 2004
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow All Versions of this Article:
13/8/807    most recent
ddh095v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (54)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Morris, J. R.
Right arrow Articles by Solomon, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morris, J. R.
Right arrow Articles by Solomon, E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2004, Vol. 13, No. 8 807-817
DOI: 10.1093/hmg/ddh095
Human Molecular Genetics, Vol. 13, No. 8 © Oxford University Press 2004; all rights reserved

BRCA1 : BARD1 induces the formation of conjugated ubiquitin structures, dependent on K6 of ubiquitin, in cells during DNA replication and repair

Joanna R. Morris* and Ellen Solomon

Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, Division of Genetics and Development, Guy's Kings and St Thomas' School of Medicine, King's College London, 8th Floor Guy's Tower, Guy's Hospital, St Thomas' Street, London SE1 9RT, UK

Received December 4, 2003; Revised January 22, 2004; Accepted February 6, 2004


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
The N-terminus of the BRCA1 protein bears a RING finger domain that functions as an E3 ubiquitin ligase in vitro where it is able to catalyse the synthesis of monoubiquitin and polyubiquitin targeted proteins. This activity is greatly increased when BRCA1 is in a complex with its N-terminal binding partner BARD1. In this report we use an immunohistochemical approach to demonstrate the association of cellular BRCA1 with the end product of the ubiquitin conjugation and ligation pathway, conjugated ubiquitin. Association is apparent at DNA replication structures in S-phase and following treatment with hydroxyurea and also at sites of double strand break repair after exposure to ionizing radiation. Down-regulation of endogenous, cellular BRCA1 : BARD1 using siRNA results in abrogation of ubiquitin conjugation in these structures, suggesting that heterodimer activity is required for their formation. Conversely, ectopically expressed full-length BRCA1, but not BRCA1 bearing specific N-terminal amino acid substitutions, is able to cooperate with BARD1 to increase ubiquitin conjugation in cells. Conjugation of ubiquitin in foci is inhibited by the expression of ubiquitin bearing a lysine 6 mutation suggesting that the ubiquitin polymers formed at these sites are dependent on lysine-6 for linkage. Together these data demonstrate that BRCA1 directed ligation of ubiquitin occurs during S-phase and in response to replication stress and DNA damage and is therefore likely to be a significant aspect of BRCA1 cellular activity.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Individuals who carry mutations in the hereditary breast cancer gene BRCA1 are predisposed to early onset breast and ovarian cancer (1). Although the precise function of BRCA1 in tumour suppression remains speculative, it has been implicated in many varied cellular functions including DNA repair and cell cycle check-point control, centrosome duplication and transcription (2). The BRCA1 protein is expressed in late G1/S-phase, where it forms foci at sites of DNA replication (3). BRCA1 is also recruited to sites of DNA damage following ionizing radiation or replication block by hydroxyurea where it colocalizes with many DNA repair proteins (36). Indeed it appears to be important for cellular responses to DNA damage since loss of BRCA1 results in sensitivity to genotoxins in mouse and in human cells; moreover, cells deficient for BRCA1 exhibit defective repair of double-stranded breaks in S-phase by homologous recombination (6,7).

While overall the BRCA1 protein sequence is poorly conserved between species, there is nevertheless a high degree of homology over small recognized motifs at the C- and N-termini (two BRCT motifs and a RING finger domain, respectively). The majority of mutations in BRCA1 result in a truncated protein product and hence a loss of at least some of the C-terminal region. However a proportion of disease-associated mutations are missense and occur within the region coding for the RING domain, suggesting that at least some of the cellular functions attributed to BRCA1 are mediated by this structure.

The N-termini of the BRCA1 protein and its associated protein, BARD1, form a heterodimeric complex which has the ability to ligate ubiquitin under specific conditions in vitro (812). The ubiquitin pathway, which is present in all eukaryotes, covalently modifies target proteins by the attachment of the 76-amino acid ubiquitin to lysine residue(s) of the target. Proteins can be mono-ubiquitinated or the initial ubiquitin monomer may itself act as a target, generating polyubiquitin chains. The addition of ubiquitin occurs through a pathway beginning with the ATP-dependent covalent attachment (thioester linkage) to a ubiquitin activating enzyme (E1 activation enzyme). The ubiquitin is then passed to a ubiquitin conjugation enzyme (E2 conjugating enzyme), where it also forms a thioester link. The ligation of ubiquitin to the substrate generally then requires an E3 ubiquitin ligase enzyme which mediates the transfer of ubiquitin to lysine residue(s) in the target. The selection of substrates for ubiquitination seems mostly determined by interactions between the E3 enzymes and target protein (reviewed in 13).

Classically, linked ubiquitin chains target conjugated proteins to the proteasome for degradation; however in recent years it has become clear that the addition of ubiquitin to a target protein may have other consequences. Distinct polyubiquitin signals that act in different cellular processes can be created by variation in the choice of lysine linkage between ubiquitin monomers. Ubiquitin has seven lysine residues, any of which could potentially serve as a site of attachment for chain assembly. It appears that the same lysine residue is used as a donor on each ubiquitin monomer of a given extending chain (13). Lysine-48 linked ubiquitin chains target to the proteasome for degradation, while lysine-63 linked chains confer non-proteolytic signals that control various pathways and are required for DNA repair in yeast and also regulate the activation of certain protein kinases (14,15). Monoubiquitination of histones appears to affect both transcription and chromatin remodelling (reviewed in 16).

In vitro, all lysine residues of ubiquitin are capable of linking together ubiquitin monomers. Analysis of the BRCA1 : BARD1 complex in vitro has suggested it may form lysine-63- and/or lysine-6-linked chains (10,17,18). Since there is compelling evidence for the ubiquitin ligase activity of the BRCA1 : BARD1 heterodimer using purified components in vitro, we wished to ask whether any evidence might be found for the same activity in cells, and if so whether it might coincide with S-phase or repair of DNA. We took the approach of examining endogenous proteins and ubiquitin conjugation by immunohistochemical means. In this report we provide the first evidence that BRCA1 colocalizes with conjugated ubiquitin at replication forks and at sites of DNA repair following damage induced by gamma irradiation in vivo. The evidence supports the view that BRCA1 activity is required for the conjugation of ubiquitin observed and that interaction with BARD1 and an E2 enzyme are required to enhance this activity. Our results suggest that the formation of conjugated ubiquitin by endogenous BRCA1 requires lysine-6 of ubiquitin. The data strongly support the hypothesis that a function of BRCA1 in vivo includes ubiquitin conjugation.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Conjugated ubiquitin colocalizes with BRCA1 in S-phase and in hydroxyurea-induced foci
The final product of the ubiquitin conjugation pathway, the covalent link between the C-terminal glycine of ubiquitin to a substrate lysine, can be localized in cells using a monoclonal antibody which is specific for linked but not free ubiquitin (19). Use of this antibody to identify conjugated ubiquitin epitopes in fixed cells has been established (20,21). In asynchronous cultures of human breast epithelial MCF-7 cells we noticed that a proportion (20–35%) contained discrete foci of conjugated ubiquitin within the nucleus (Fig. 1A). The remainder showed a weaker, more diffuse stain, or isolated foci (Fig. 1A). Immunohistochemical staining for the 20S core subunit of the proteasome and for PML revealed poor colocalization with these foci (Supplementary Material, Figure A), whereas conjugated ubiquitin foci were found to be colocalized with BRCA1 foci (Fig. 1B and C). Since BRCA1 nuclear dots are known to be cell cycle dependent and present primarily in S-phase (22), this suggested that nuclear conjugation of ubiquitin in foci also occurred in S-phase. To test this, cell cultures were synchronized by serum starvation and release; enrichment for cells in S-phase was confirmed in parallel cultures by PCNA staining (data not shown) (23). Under these conditions, 71% of cells were in S-phase (59% early S-phase and 12% in late S-phase) and scored positively for BRCA1 nuclear foci. In these cells, the majority of BRCA1 foci were found colocalized with conjugated ubiquitin foci (Table 1 and Fig. 1D–F). If the conjugated ubiquitin foci are associated with the BRCA1 : BARD1 heterodimer, colocalization with BARD1 would also be expected. Immunostaining of S-phase cells for endogenous BARD1 showed colocalization with conjugated ubiquitin foci (Fig. 1G–I), suggesting that the foci are associated with the heterodimer. Staining of serum starved cells, in G1 of the cell cycle, showed no conjugated ubiquitin foci or BRCA1 foci (Fig. 1J–L). These observations suggest that the colocalization of conjugated ubiquitin foci with BRCA1 foci occurs in S-phase.



View larger version (69K):
[in this window]
[in a new window]
 
Figure 1. Conjugated ubiquitin colocalizes with BRCA1 in S-phase and in hydroxyurea (HU)-induced foci. MCF-7 cells were either asynchronous (AC), synchronized in G1 by 24 h serum starvation (JL) or synchronized in S-phase by 24 h serum starvation, followed by 24 h release (DI and MU). S-phase cells were either untreated (D–I), pulsed with BrdU for 30 min (S–U) or treated with 3 mM HU for 60 min (M–R). All cells were then fixed, permeabilized and immunostained. In cells pulsed with BrdU, incorporated nucleotide was revealed after fixation by digestion with DNaseI (S–U). Antibodies against BRCA1*, conjugated ubiquitin, BARD1, {gamma}H2AX or BrdU were used as indicated. When the pictures are merged, where green and red signals overlap a yellow signal is seen indicating colocalization. *Several polyclonal antibodies directed against BRCA1 (D-16, KAPST0201 and I-20) were tested for colocalization with MS110 (a monoclonal antibody directed against the N-terminus of BRCA1). All showed colocalization. KAPST0201 showed the clearest foci and this antibody is shown and used throughout the study. All immunohistochemical experiments were also completed using COS-7 cells, no differences between cell types was observed. All bars are 20 µm.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Focus formation and colocalization of BRCA1 with conjugated ubiquitin in S-phase cells, after gamma irradiation (10 Gy, followed by 90 min recovery) or following hydroxyurea treatment (3 mM for 60 min). In cells expressing BRCA1 (a nucleus displaying more than five BRCA1 foci was considered as expressing BRCA1), the numbers of colocalizing and non-colocalizing BRCA1 and conjugated ubiquitin foci were recorded. A minimum of 30 nuclei were counted for each condition
 
BRCA1 and histone 2AX phosphorylated on serine 139 (named {gamma}H2AX) have been reported at sites of stalled replication forks induced by hydroxyurea (HU) or ultraviolet light (3,24). Hydroxyurea blocks DNA replication by inhibiting ribonucleotide reductase, resulting in a reduced cellular pool of deoxynucleoside triphosphates for DNA synthesis. Stalled forks undergo irreversible collapse and/or are processed into double stranded breaks (25,26). To test whether conjugated ubiquitin might also be found at such sites, synchronous S-phase cultures of MCF-7 cells were treated with 3 mM HU for 1 h before immunohistochemical staining. Figure 1M–U shows conjugated ubiquitin foci in response to HU. These foci differ from those seen in S-phase, frequently being large (>1 µm) or hoop-shaped (diameter ~2 µm). On examination, the colocalization of BRCA1 with conjugated ubiquitin was evident and revealed BRCA1 in the same structures (Fig. 1M–O). Quantification of foci in >30 nuclei showed that the majority of BRCA1 foci were found colocalized with conjugated ubiquitin foci following HU treatment (Table 1). Indirect immunofluorescene also confirmed that {gamma}H2AX was present at HU-induced foci (Fig. 1P–R), whereas {gamma}H2AX foci are rarely seen in S-phase foci (data not shown). To further confirm that conjugated ubiquitin focus formation is at the DNA replication fork, cells synchronized in S-phase were pulsed with the nucleotide analogue 5-bromo-2-deoxyuridine (BrdU). Following fixation, permeabilization and digestion of DNA, colocalization was evident between BrdU and conjugated ubiquitin (Fig. 1S–U). Together these results suggest that sites of conjugated ubiquitin colocalize with BRCA1 and {gamma}H2AX foci at the replication fork.

Conjugated ubiquitin colocalizes with BRCA1 at sites of DNA damage repair following irradiation
BRCA1 is recruited to sites of DNA damage induced by gamma radiation and appears earlier than other repair factors such as Rad51, but after {gamma}H2AX (5,27). To examine whether conjugated ubiquitin is also formed at such sites we used a 137Cs source to introduce double stranded DNA breaks in cultured cells. Cells synchronized by serum starvation and release in S-phase were irradiated and then analysed for conjugated ubiquitin, BRCA1 and {gamma}H2AX initially at 90 min post-irradiation. Following exposure to ionizing radiation, conjugated ubiquitin and {gamma}H2AX were observed, like BRCA1, in multiple smaller foci (~0.5 µm, >30 per nuclei; Fig. 2A, B and D and Table 1). As was observed for S-phase and HU-induced foci, the majority of BRCA1 foci formed colocalized with conjugated ubiquitin foci (although a proportion of each focus type does not colocalize; Table 1). Conjugated ubiquitin foci and {gamma}H2AX foci also closely colocalized (Fig. 2D–F) and recovery after irradiation in the presence of BrdU demonstrated that conjugated ubiquitin foci are formed at sites of newly incorporated nucleotide (Fig. 2G–I). These observations suggest that an E3 ligase activity is found at sites of DNA repair following damage.



View larger version (43K):
[in this window]
[in a new window]
 
Figure 2. Conjugated ubiquitin colocates with BRCA1 at sites of DNA damage repair following damage by ionizing radiation. MCF-7 cells were synchronized in S-phase by 24 h serum starvation and release, then after irradiation (10 Gy) and recovery for 90 min at 37°C the cells were fixed, permeabilized and immunostained with antibodies to BRCA1 (A), conjugated ubiquitin (B, C and H) or BrdU (G). Where green and red signals overlap a yellow signal is seen, indicating colocalization (C, F and I). All immunohistochemical experiments were also completed using COS-7 cells, no differences between cell types was observed. All bars are 10 µm. S-phase MCF-7 cultures were irradiated (10 Gy), and allowed to recover at 37°C for 3, 15, 30, 60 and 90 min before fixation, permeablization and immunostaining with antibodies directed against {gamma}H2AX, BRCA1 and conjugated ubiquitin. For each time point, 100 nuclei were examined and the number of cells containing foci for each antigen recorded and shown in (P). Representative cells at 3 min (JL) and 60 min (MO) post-irradiation, are shown immunostained for BRCA1, {gamma}H2AX and conjugated ubiquitin. All bars are 10 µm.

 
While examining cells for conjugated ubiquitin and {gamma}H2AX foci, we noticed that a small proportion of MCF-7 cells (<2%) contained {gamma}H2AX but lacked conjugated ubiquitin foci, whereas the converse was not observed. This suggested that the formation of {gamma}H2AX foci might precede the conjugation of ubiquitin at these sites. {gamma}H2AX focus formation is localized in large chromatin domains at and around the site of DNA damage which appear within 1–3 min of exposure to gamma irradiation (28). We therefore examined cells for foci at earlier time points post-exposure. After 3 min of recovery, {gamma}H2AX foci were apparent in 80% of cells whereas BRCA1 and conjugated ubiquitin foci were seen in just 5–6% (Fig. 2L and P). At this early time point the majority of cells showed no or low diffuse staining for BRCA1 and conjugated ubiquitin (Fig. 2J and K), suggesting that S-phase foci, and the associated ubiquitin conjugate, are rapidly dispersed following irradiation. The foci of BRCA1 and ubiquitin became apparent around the same time point, between 30 and 60 min post-irradiation (Fig. 2P). Therefore the kinetics of conjugated ubiquitin foci formed after DNA damage are consistent with BRCA1 focus formation and not {gamma}H2AX. These observations also suggest that conjugates seen at IR-induced foci are formed de novo.

Inhibition of ubiquitin conjugation by knock-down of BRCA1 : BARD1
BRCA1 foci and conjugated ubiquitin foci appear closely colocalized both in time and space and in response to hydroxyurea and irradiation. To establish whether the observed ubiquitin conjugation was dependent upon BRCA1 activity, we undertook to reduce BRCA1 expression using small interfering RNAs. Figure 3 shows that BRCA1 siRNA down-regulated BRCA1 protein expression dramatically compared with cells treated with control siRNA. Control and BRCA1 siRNA-treated cells were synchronized in S-phase by serum starvation and release and exposed to HU or radiation. Where control cells showed considerable accumulation of conjugated ubiquitin, cells treated with BRCA1 siRNA did not. It was interesting that the few cells retaining BRCA1 expression also retained ubiquitin conjugation (Fig. 3, arrow a). Irradiation of BRCA1 siRNA-treated S-phase synchronized cells also showed reduced conjugation of ubiquitin compared with controls, although some foci remained, suggesting that the formation of some conjugated ubiquitin foci is independent of BRCA1.



View larger version (58K):
[in this window]
[in a new window]
 
Figure 3. Knockdown of BRCA1–BARD1 expression inhibits ubiquitin conjugation. Control and BRCA1 siRNA transfected MCF-7 cells were synchronized in S-phase by serum starvation and release and either fixed or exposed to HU (3 mM) for 60 min, or ionizing radiation (10 Gy) followed by 90 min recovery at 37°C. Cells were fixed, permeabilized and stained with antibodies to BRCA1 (red), conjugated ubiquitin (green) or BARD1 (red) as indicated. Arrow a indicates a cell with BRCA1 expression remaining that also has conjugated ubiquitin present. Arrow b indicates three cells that retain BARD1 expression that also show immunostain to conjugated ubiquitin. When the pictures are merged, where green and red signals overlap a yellow signal is seen, indicating colocalization. All bars are 10 µm.

 
Several groups have noted that BRCA1 and BARD1 protein stability are interdependent (8,29,30); we therefore tested whether BARD1 showed reduced expression in cells treated with siRNAs to BRCA1. Figure 3 shows that BARD1 expression is reduced in siBRCA1 treated cells compared with control cells. As before, where a few cells retained expression, ubiquitin conjugation was also evident (Fig. 3, arrow b). These data suggest that, although we cannot differentiate between a requirement for BRCA1 and one for BARD1, the BRCA1 : BARD1 complex appears to be required for the ubiquitin conjugation observed immunohistochemically in cells.

Overexpression of full length, but not N-terminally deleted or mutated BRCA1, induces increased ubiquitin conjugation in cells
In vitro studies have shown that BARD1 is required for adequate levels of BRCA1 E3 ligase activity (10,29). Recently the binding interface formed between the BRCA1 : BARD1 complex and the E2 enzyme, UbcH5c, has been mapped (31). The interface is formed by the first and second zinc binding loops and central alpha-helix of the BRCA1 RING domain. This is a region disrupted by cancer-predisposing mutations such as the C61G substitution, a germline missense mutation associated with hereditary breast cancer (32). To confirm that BRCA1 has the ability to induce conjugated ubiquitin structures, and to examine whether RING domain mutations might ablate the activity, we expressed BRCA1 tagged at the C-terminus by EGFP with and without BARD1 in cells. The immunostain for conjugated ubiquitin in cells expressing EGFP was then evaluated for intensity and distribution. Cells were also transfected with EGFP-tagged BRCA1 amino acids 100–1863 (this construct, del 100, lacks the RING domain and flanking helices required for the interaction with BARD1) or with tagged BRCA1 bearing N-terminal substitutions. The I26A substitution has been shown to disrupt the interaction between the heterodimer and UbcH5c, while the C61G substitution inhibits BRCA1 E3 ligase activity in in vitro ubiquitin ligase assays (8,31,33).

As observed previously, coexpression of BARD1 promoted the formation of exogenous BRCA1 into nuclear foci (34). This was evident with all but the del 100 BRCA1 expression construct, particularly at lower levels of BRCA1 expression (data not shown). High expression of the full-length BRCA1 construct resulted in increased ubiquitin conjugation throughout the nucleus in a manner not observed in untransfected cells (Fig. 4B). This distribution of conjugated ubiquitin was seen only when BARD1 was cotransfected. In yeast assays, the M18T substitution has no impact on the ability of BRCA1to heterodimerize with BARD1 (own unpublished data). In cells, the level and distribution of ubiquitin conjugation seen when this construct was coexpressed with BARD1 was comparable to that seen with wild-type BRCA1, suggesting that the E3 ligase activity is intact. Expression of del 100 BRCA1 and BRCA1 with C61G and I26A substitutions did not coincide with high levels of ubiquitin conjugation with or without exogenous BARD1 expression (Fig. 4A). These observations suggest that the activity is dependent on an intact BRCA1 RING finger domain and on an interaction mediated through Ile-26, presumably the binding of BRCA1 to an E2 enzyme.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 4. Overexpression of full-length wild-type BRCA1 with BARD1 can induce high levels of ubiquitin conjugation in cells. 293T cells were transfected with mammalian expression constructs bearing EGFP-tagged wild-type BRCA1 (WT), EGFP-tagged 1–100 amino acid deleted BRCA1 (del 100), EGFP-tagged BRCA1 with missense substitutions shown, or the EGFP vector alone. BRCA1 plasmids were transfected either alone or with a construct expressing myc-tagged full length BARD1. Forty-eight hours after transfection, cells were fixed and immunostained with antibodies to conjugated ubiquitin and/or to myc. Transfected cells (cells expressing green fluorescent protein, or staining for c-myc) where then scored into one of three groups for the intensity and distribution of conjugated ubiquitin: 1, low/absent conjugation; 2, in foci; or 3, present at high levels throughout the nucleus. A minimum of 110 nuclei were scored per transfection and the distribution of conjugated ubiquitin for each is shown in (A). The experiment was replicated three times, a representative experiment is shown. (B) The three patterns of conjugated ubiquitin distribution seen (red). Cells transfected with the del 100 BRCA1–EGFP (green) and BARD1 show either a low/absent (1, arrow) levels of ubiquitin conjugation, or conjugated ubiquitin foci (2, arrow), while many cells expressing full-length wild-type BRCA1–EGFP (green) and BARD1 showed high levels of ubiquitin conjugation throughout the nucleus (3, arrow). When the pictures are merged, where green and red signals overlap a yellow signal is seen, indicating colocalization. All bars are 10 µm.

 
Although exogenous BRCA1 : BARD1 expression was able to induce high levels of ubiquitin conjugation, this did not did not occur in every transfected cell. This may be because not every cell examined received the BARD1 construct (only the EGFP was evaluated), or because the E3-ligase activity is regulated and/or limited in a subset of cells. Clearly, in some cells expressing exogenous BRCA1 : BARD1, ubiquitin conjugation is far higher than that observed in untransfected cells, suggesting that in these cells at least the remaining components of the ubiquitin ligation cascade, such as E2 enzyme availability, are not limiting. Together, these data show that exogenous BRCA1 is able to induce ubiquitin conjugation in partnership with BARD1. Substitutions that disrupt the zinc-binding properties of the RING or replace residues required for binding to the E2 enzyme abrogate this activity in vivo.

Conjugated ubiquitin moieties in BRCA1-associated foci are dependent on lysine 6 of ubiquitin
Particular polyubiquitin signals are likely to have different functional consequences. Since any of the seven lysines of ubiquitin could potentially serve as a site of attachment during chain assembly, we wished to establish which form of ubiquitin conjugation was associated with BRCA1. A panel of ubiquitin constructs was generated each with a different lysine amino acid substituted to arginine. These were transfected into MCF-7 cells and the cells examined by immunohistochemistry for ubiquitin conjugation. Exogenous expression of myc-tagged ubiquitin either unmutated or substituted K11R, K33R, K29R, K48R or K63R showed no reduction in conjugated ubiquitin staining (Fig. 5A–C and data not shown). It was apparent that all these variants could be incorporated into conjugated structures, since foci detected using an antibody to the myc-tag colocalized with foci detected by antibody to conjugated ubiquitin (Fig. 5A–C). Expression of ubiquitin bearing a K6R substitution resulted in a reduction of conjugated ubiquitin. All cells expressing this mutant had little or no staining for conjugated ubiquitin (Fig. 5D–F); this was evident in untreated, and both hydroxyurea-treated and irradiated cells (Fig. 5 and data not shown). The interpretation of ubiquitin substituted K27R was difficult because this mutation resulted in the perinuclear localization of the mutant and conjugated ubiquitin and appeared to prevent the nuclear localization not only of the mutated protein itself but also of endogenous ubiquitin (data not shown).



View larger version (111K):
[in this window]
[in a new window]
 
Figure 5. The ubiquitin conjugates in BRCA1-associated conjugated foci are dependent on lysine 6 linkaged ubiquitin. MCF-7 cells were transfected with either an unmutated ubiquitin-myc tagged expression construct (AC, GI) or a construct bearing a K6R substitution (DF, JL). Cells were immunostained with antibodies to conjugated ubiquitin (green, B and E) and myc (red) or with FK1 (green, H and K) and myc (red). The pictures in (C, F, I and L) are merged; where green and red signals overlap a yellow signal is seen indicating colocalization of myc-tagged exogenous ubiquitin and conjugated ubiquitin. All bars are 10 µm.

 
The pattern of staining detected using a second antibody, FK1, known to bind to polyubiquitin chains including those linked by K48, K29 and K63 in immunoblots (Affiniti Research Products, Supplementary Material, Fig. B), in cells was diffuse compared to that observed with the anti-conjugated ubiquitin antibody (data not shown and Fig. 5). Expression of K6R ubiquitin in cells did not inhibit the formation of conjugated ubiquitin detected using FK1 antibody suggesting that other forms of ubiquitin linkage are not inhibited by the mutant (Fig. 5J–L). The formation of BRCA1 and {gamma}H2AX foci was also unperturbed by the K6R ubiquitin mutant. Similarly we found that the reduction of the cellular pool of free ubiquitin by pre-treatment with proteasome inhibitor, Ada-(Ahx)3-(leu)3-vinyl sulfone (35), prior to hydroxyurea treatment or irradiation was able to prevent the formation of conjugated ubiquitin foci, but had no effect on BRCA1 or {gamma}H2AX foci (Supplementary Material, Fig. C and data not shown). These data confirm that the formation of ubiquitin conjugates occurs downstream of the formation of these foci. These data support the view that the majority of BRCA1-dependent ubiquitin conjugation is in the form of ubiquitin chains that require the K6 residue of ubiquitin.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
The E3 ubiquitin ligase activity of the BRCA1 : BARD1 N-terminal heterodimer in in vitro systems has been described many times, but the relevance of this to cellular BRCA1 activity was unknown (810,12). In this report, we provide evidence that endogenous ubiquitin conjugation occurs in association with endogenous BRCA1 in mammalian cells. The end product of the ubiquitin cascade forms in nuclear foci that colocalize with BRCA1 and its N-terminal binding partner BARD1 in foci found in S-phase. Importantly, the relocation of BRCA1 to stalled replication forks and sites of DNA breakage and repair, as identified by {gamma}H2AX and BrdU incorporation, is accompanied by ubiquitin conjugation at those sites. Following irradiation, the kinetics of conjugated ubiquitin focus formation is consistent with that of BRCA1 focus formation. Indeed, the majority of conjugated ubiquitin foci observed within the nucleus at any time point or following all treatments used are associated with BRCA1. We conclude that the conjugation is a consequence of heterodimer activity since knock-down of BRCA1 and BARD1 using siRNA reduced the levels of ubiquitin conjugation dramatically. Conversely, the expression of exogenous BRCA1 : BARD1 is capable of inducing large-scale ubiquitination in cells. This activity is dependent on the expression of both partners and of an intact BRCA1 RING domain and E2 binding face. That exogenous BRCA1 requires exogenous BARD1 in order to induce large-scale ubiquitination may suggest that unpaired endogenous BARD1 is unavailable, presumably in a complex with endogenous BRCA1. The E3 ligase activity is ablated by C61G, a BRCA1 germline missense mutation associated with hereditary breast cancer. Our own studies suggest that this mutation disrupts the binding to BARD1 only in certain assays (own unpublished data and 36). In cells, coexpression of the mutant with BARD1 does not prevent the formation of BRCA1 foci, suggesting that they are able to interact (own unpublished data and 34). It is likely therefore that this mutation disrupts the enzymatic activity of BRCA1 through its impact on E2 binding rather than on heterodimerization with BARD1. The I26A substitution is present on the external face of the RING region and has no impact on BARD1 binding (own unpublished data and 31). This mutation inhibits the interaction of the heterodimer with the E2 enzyme, UbcH5c, in vitro (31), and in our assay is not associated with increased ubiquitin conjugation in cells. Thus the impact specific mutations have on BRCA1 associated ubiquitin conjugation activity in vivo appears to be consistent with conclusions reached by various groups using in vitro ubiquitin ligase assays.

Our analysis using a panel of lysine substituted ubiquitin constructs suggests that the majority of the conjugation seen in S-phase foci and in foci induced by replication fork stalling and DNA damage are dependent on lysine-6 of ubiquitin. In this respect, the observations in cells support the recent data from in vitro ubiquitin ligase systems that suggest BRCA1 : BARD1 is able to catalyse the production of K6-linked ubiquitin polymers (17,18). As knowledge of the specificity of the anti-conjugated ubiquitin antibodies used in this study to all types of ubiquitin linkage is incomplete we cannot rule out the possibility that other forms of ubiquitin linkages are also formed in association with BRCA1. Nor can we rule out the possibility that levels of mono-ubiquitination occur in association with BRCA1 activity that are undetected by the immunohistochemical approach we have used.

Polyubiquitin chain structure modulates signalling; the distinct physical conformations of K63- and K48-linked chains are such that one mediates degradation through the proteasome while the other does not. The data in this study, combined with observations from in vitro assays, now raise the interesting question of what response K6-linked ubiquitin might invoke. To date information on this linkage is limited. In yeast, mutation of ubiquitin at K6 has no effect on growth rate or resistance to DNA damaging agents, unlike the K63 mutant, which is deficient in DNA repair (14). Of all ubiquitin linkages in yeast the K6 form is the least abundant (37). The activity of the yeast E2 enzyme RAD6, which catalyses the ubiquitination of histone H2B, is inhibited by K6R ubiquitin, suggesting that the linkage may have relevance to histone modification. In purified systems K6-linked ubiquitin generated by BRCA1 : BARD1 can be deubiquitnated by the proteasome, although whether this leads to degradation in vivo is unclear (18,38).

As yet, a natural enzymatic substrate for the BRCA1 : BARD1 E3 ubiquitin ligase has not been identified. In vitro assays have shown mono-ubiquitination of histones and poly-autoubiquitination (9,12). Highly expressed heterodimer in cells also autoubiquitinates, although whether this is a natural substrate is not yet clear (18). In vitro BRCA1 : BARD1 N-terminal regions are capable of self assembly into supramolecular structures, which have potent E3 ligase activity (39). The scale of ubiquitin conjugation apparent at BRCA1 foci in cells shown in this report certainly suggests that the activity is substantial, and it may be that autoubiquitinated BRCA1 contributes to the signal that we see.

BRCA1 and its apparent ubiquitin conjugation activity locate at sites of DNA damage, also occupied by many DNA repair factors. Given the temporal and spatial association of the ubiquitin conjugating activity, it is tempting to speculate that its function may be linked to a role in DNA repair. We would predict from our observations that the target substrate(s) to which ubiquitin is conjugated are likely to be factors involved in the DNA repair process (which may include BRCA1 itself). Perhaps K6-linked polyubiquitin chains affect the concentration of repair factors near the lesion, act as a signal amplification or enable DNA decondensation and/or nucleosome and chromatin assembly. Clearly, much needs to be done to establish what role K6-linked ubiquitin plays in DNA repair.

Our data provide evidence that BRCA1 activity is associated with the conjugation of ubiquitin in vivo, in S-phase foci, after replication stress and following DNA damage. Taken together it suggests that the BRCA1 E3-ligase activity is likely to be a significant aspect of BRCA1 cellular activity. The ubiquitin-ligase assay may therefore represent the first functional assay for N-terminal missense/unclassified variants.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Cells
MCF-7 human mammary epithelial cells were grown in RPMI (Sigma), 0.01 mg/ml bovine insulin with 10% fetal calf serum and antibiotics, penicillin (100 u/ml) and streptomycin (100 u/ml). COS-7 African Green monkey cells and human 293T/17 kidney epithelial cells were grown in Dulbecco's modified Eagle's medium containing 10% fetal calf serum and antibiotics as described above.

Treatment of cells
Synchronization
For cell synchronization in S-phase subconfluent cells were serum starved for 24 h in Dulbecco's modified Eagle's medium (Sigma) (COS7), or RPMI (MCF-7) and released for 7 h (COS-7) and 24 h (MCF-7) in medium containing 20% fetal calf serum. For cell cycle progression measured by FACS analysis, cells were fixed in 70% ethanol and stained with propidium iodide (Sigma).

Irradiation
Cells were irradiated using a gamma cell 1000 Elite irradiator (Caesium-137 source) and allowed to recover at 37°C for varying time peroids.

Chemical treatments
Cells were treated with 3 mM hydroxyurea (Sigma) for 1 h before fixation. Proteasome inhibitor Ada-(Ahx)3-(leu)3-vinyl sulfone (Affiniti Research Products) was used at a final concentration of 50 µM in DMSO (40). For analysis of newly incorporated nucleotide, cells were either pulsed with 10 mM BrdU (Amersham) for 30 min and fixed or incubated with 10 mM BrdU concurrent with irradiation and recovery before fixation for immunofluorescence.

Plasmids
The BRCA1 mammalian expression constructs were generated in pEGFP-N2 (Clontech). Fragments coding for BRCA1 amino acids 1–1863 and 100–1863 (del100) were generated by PCR amplification using forward primers 5'-CAGATCTCGAGCATGGATTTATCTGCTCTTCGCGTT-3', and 5'-CAGATCTCGAGCTATGCAAACAGCTATAATTTTGC-3' respectively and the reverse primer 5'-CGAAGCTTGAGTAGTGGCTGTGGGGGATCTGGGG-3' and cloned into XhoI/NotI sites so that the EGFP fluorescent protein was fused C-terminal and in-frame with BRCA1. BARD1 cDNA was a kind gift of Richard Baer (University of Texas, TX, USA), it was cloned using NotI/KpnI into pcDNA3.1 so that the myc epitope was fused C-terminal and in-frame. The N-terminal myc-HIS epitope tagged ubiquitin expression construct, pCW7, were a kind gift of Roger Everett (MRC Virology unit, Glasgow, UK). All single amino acid mutants were generated using site-directed primer mutagenesis. Ubiquitin lysine codons were replaced by the arginine codon AGA. All mutations and constructs were sequenced before use.

Immunofluorescence microscopy
All cells were grown on glass cover slips for immunofluorescence microscopy. For all but PCNA staining, cells were fixed for 10 min in 4% paraformaldehyde at room temperature, then permeablized in 1xPBS, 0.5% Triton-X-100 for 5 min at room temperature. For PCNA-staining cells were fixed and permeablized by 10 min incubation in (70 : 30 w/v) methanol–acetone and air dried. Non-specific antigens were blocked in 20% fetal calf serum 1xPBS before incubation with antibodies. All incubations were performed at 28°C for 1 h. Under conditions used no significant signal attributable to secondary antibody alone was detected. Indirect immunofluorescence of BrdU incorporation was achieved by digestion with 10 U/ml DNaseI concurrent with primary anti-BrdU antibody as described by Kennedy et al. (25). Cells were examined using a Zeiss LSM 510 confocal microscope with three lasers giving excitation lines at 633, 543 and 488 nm. Data from channels was collected sequentially using the appropriate band-pass filters. Data were collected with 8-fold averaging at a resolution of 1024x1024 pixels, using an optical slice of between 0.5 and 1 µm using a 63x objective within the Zeiss Axioplan-II microscope.

Antibodies
The monoclonal IgG antibody FK-2, which recognizes conjugated but not free ubiquitin was used throughout the study, and referred to as anti-conjugated ubiquitin antibody (used at 1 : 10 000). The IgM monoclonal FK-1 was also used (and referred to as FK1) and recognizes only polyubiquitin linked chains (used at 1 : 1000). It must be noted that the linkage specificity of FK1 and 2 antibodies has not been precisely determined (19). They were obtained from Affiniti Research Products (Exeter, UK). BRCA1 (KAPST0201) antibody raised to human BRCA1 synthetic peptide (amino acids 768–793) was obtained from Stressgen Bioreagents (Victoria, Canada) and used at 1 : 1000 dilution. Santa Cruz antibodies D-16 goat polyclonal was used at 1 : 100 and I-20, rabbit polyclonal was used at 1 : 500 dilution, and goat polyclonal N-19 (to BARD1) was used at a 1 : 500 dilution. MS110 ascites sera was used at 1 : 100 dilution. Antibody to Serine-139 phosphorylated histone 2AX ({gamma}H2AX) was obtained from Upstate Biotechnology (Lake Placid, USA) and used at a 1 : 500 dilution. Anti-BrdU monoclonal (antibody 8955) and polyclonal (antibody1893) were purchased from AbCam (Cambridge, UK) and used at 1 : 500 dilutions. Rabbit polyclonal antibody to 20S proteasome {alpha}/ß subunits (PW8155) was purchased from Affiniti Research Products (Exeter, UK) and used at 1 : 500 dilution. PML rabbit anti-sera were generated in house (41) and was used at 1 : 500 dilution. PCNA–FITC conjugated antibody was obtained from Santa Cruz and used at 1 : 1000 dilution. The use of PCNA antigen to subdivide S-phase is reviewed in Celis et al. (23). The nuclear distribution of PCNA, as a marker for S-phase, was quantified; 50 nuclei where examined and the intensity/distribution of PCNA placed in one of three groups, diffuse/absent, granular or nucleoli. Secondary antibodies used were goat-anti-mouse IgM (µ-chain specific)–FITC conjugate at 1 : 100 (Sigma) F9259. All other secondaries, donkey–anti-sheep IgG–FITC (Abcam), swine–anti-rabbit IgG–TRITC conjugate, goat–anti-mouse IgG–FITC conjugate, and rabbit–anti-mouse IgG–TRITC conjugate (all DAKO), were used at 1 : 1000 concentrations.

RNA interference
Control (non-silencing) siRNA consisted of a single RNA duplex, target sequence AATTCTCCGAACGTGTCACGT, from Qiagen/Xeragon (Germantown MD, USA). Four BRCA1 pooled siRNA duplexes with ‘UU’ overhangs and 5' phosphate on the antisense strand were purchased from Upstate signalling solutions/Dharmacon (Massachusetts, USA). Both RNA sets were used at a final concentration of 100 mM and were transfected using FuGENE (Roche) according to the manufacturer's instructions. For synchronization of transfected cells MCF-7 cells were serum starved 16 h after siRNA transfection for 24 h and released into 20% fetal calf serum for a further 24 h before treatment and/or fixation.


    SUPPLEMENTARY MATERIAL
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Supplementary Material is available at HMG Online.


    ACKNOWLEDGEMENTS
 
This work was supported by a grant from the Medical Research Council (G6900577). Our thanks go to A. Catteau, D. Grimwade, R. Roberts and R. Everett for helpful comments and reading of the manuscript.


    FOOTNOTES
 
* To whom correspondence should be addressed. Tel: +44 2079555000, ext. 5585/2520; Fax: +44 2079558762; Email: joanna.morris{at}kcl.ac.uk


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 

  1. Miki, Y., Swensen, J., Shattuck-Eidens, D., Futreal, P.A., Harshman, K., Tavtigian, S., Liu, Q., Cochran, C., Bennett, L.M., Ding, W. et al. (1994) A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science, 266, 66–71.[Abstract/Free Full Text]

  2. Venkitaraman, A.R. (2002) Cancer susceptibility and the functions of BRCA1 and BRCA2. Cell, 108, 171–182.[CrossRef][ISI][Medline]

  3. Scully, R., Chen, J., Plug, A., Xiao, Y., Weaver, D., Feunteun, J., Ashley, T. and Livingston, D.M. (1997) Association of BRCA1 with Rad51 in mitotic and meiotic cells. Cell, 88, 265–275.[CrossRef][ISI][Medline]

  4. Wang, Y., Cortez, D., Yazdi, P., Neff, N., Elledge, S.J. and Qin, J. (2000) BASC, a super complex of BRCA1-associated proteins involved in the recognition and repair of aberrant DNA structures. Genes Dev., 14, 927–939.[Abstract/Free Full Text]

  5. Scully, R., Chen, J., Ochs, R.L., Keegan, K., Hoekstra, M., Feunteun, J. and Livingston, D.M. (1997) Dynamic changes of BRCA1 subnuclear location and phosphorylation state are initiated by DNA damage. Cell, 90, 425–435.[CrossRef][ISI][Medline]

  6. Zhong, Q., Chen, C.F., Li, S., Chen, Y., Wang, C.C., Xiao, J., Chen, P.L., Sharp, Z.D. and Lee, W.H. (1999) Association of BRCA1 with the hRad50–hMre11–p95 complex and the DNA damage response. Science, 285, 747–750.[Abstract/Free Full Text]

  7. Moynahan, M.E., Chiu, J.W., Koller, B.H. and Jasin, M. (1999) Brca1 controls homology-directed DNA repair. Mol. Cell, 4, 511–518.[CrossRef][ISI][Medline]

  8. Hashizume, R., Fukuda, M., Maeda, I., Nishikawa, H., Oyake, D., Yabuki, Y., Ogata, H. and Ohta, T. (2001) The RING heterodimer BRCA1-BARD1 is a ubiquitin ligase inactivated by a breast cancer-derived mutation. J. Biol. Chem., 276, 14537–14540.[Abstract/Free Full Text]

  9. Chen, A., Kleiman, F.E., Manley, J.L., Ouchi, T. and Pan, Z.Q. (2002) Autoubiquitination of the BRCA1*BARD1 RING ubiquitin ligase. J. Biol. Chem., 277, 22085–22092.[Abstract/Free Full Text]

  10. Xia, Y., Pao, G.M., Chen, H.W., Verma, I.M. and Hunter, T. (2003) Enhancement of BRCA1 E3 ubiquitin ligase activity through direct interaction with the BARD1 protein. J. Biol. Chem., 278, 5255–5263.[Abstract/Free Full Text]

  11. Lorick, K.L., Jensen, J.P., Fang, S., Ong, A.M., Hatakeyama, S. and Weissman, A.M. (1999) RING fingers mediate ubiquitin-conjugating enzyme (E2)-dependent ubiquitination. Proc. Natl Acad. Sci. USA, 96, 11364–11369.[Abstract/Free Full Text]

  12. Mallery, D.L., Vandenberg, C.J. and Hiom, K. (2002) Activation of the E3 ligase function of the BRCA1/BARD1 complex by polyubiquitin chains. EMBO J., 21, 6755–6762.[CrossRef][ISI][Medline]

  13. Dubiel, W. and Gordon, C. (1999) Ubiquitin pathway: another link in the polyubiquitin chain? Curr. Biol., 9, R554–557.[CrossRef][ISI][Medline]

  14. Spence, J., Sadis, S., Haas, A.L. and Finley, D. (1995) A ubiquitin mutant with specific defects in DNA repair and multiubiquitination. Mol. Cell. Biol., 15, 1265–1273.[Abstract]

  15. Wang, C., Deng, L., Hong, M., Akkaraju, G.R., Inoue, J. and Chen, Z.J. (2001) TAK1 is a ubiquitin-dependent kinase of MKK and IKK. Nature, 412, 346–351.[CrossRef][Medline]

  16. Bach, I. and Ostendorff, H.P. (2003) Orchestrating nuclear functions: ubiquitin sets the rhythm. Trends Biochem. Sci., 28, 189–195.[CrossRef][ISI][Medline]

  17. Wu-Baer, F., Lagrazon, K., Yuan, W. and Baer, R. (2003) The BRCA1/BARD1 heterodimer assembles polyubiquitin chains through an unconventional linkage involving lysine residue K6 of ubiquitin. J. Biol. Chem., 278, 34743–34746.[Abstract/Free Full Text]

  18. Nishikawa, H., Ooka, S., Sato, K., Arima, K., Okamoto, J., Klevit, R.E., Fukuda, M. and Ohta, T. (2003) Mass spectrometric and mutational analyses reveal Lys-6-linked polyubiquitin chains catalyzed by BRCA1-BARD1 ubiquitin ligase. J. Biol. Chem., 279, 3916–3924.[Medline]

  19. Fujimuro, M., Sawada, H. and Yokosawa, H. (1994) Production and characterization of monoclonal antibodies specific to multi-ubiquitin chains of polyubiquitinated proteins. FEBS Lett., 349, 173–180.[CrossRef][ISI][Medline]

  20. Anton, L.C., Schubert, U., Bacik, I., Princiotta, M.F., Wearsch, P.A., Gibbs, J., Day, P.M., Realini, C., Rechsteiner, M.C., Bennink, J.R. et al. (1999) Intracellular localization of proteasomal degradation of a viral antigen. J. Cell. Biol., 146, 113–124.[Abstract/Free Full Text]

  21. Everett, R.D. (2000) ICP0 induces the accumulation of colocalizing conjugated ubiquitin. J. Virol., 74, 9994–10005.[Abstract/Free Full Text]

  22. Scully, R., Ganesan, S., Brown, M., De Caprio, J.A., Cannistra, S.A., Feunteun, J., Schnitt, S. and Livingston, D.M. (1996) Location of BRCA1 in human breast and ovarian cancer cells. Science, 272, 123–126.[ISI][Medline]

  23. Celis, J.E., Madsen, P., Nielsen, S. and Celis, A. (1986) Nuclear patterns of cyclin (PCNA) antigen distribution subdivide S-phase in cultured cells—some applications of PCNA antibodies. Leuk. Res., 10, 237–249.[CrossRef][ISI][Medline]

  24. Ward, I.M. and Chen, J. (2001) Histone H2AX is phosphorylated in an ATR-dependent manner in response to replicational stress. J. Biol. Chem., 276, 47759–47762.[Abstract/Free Full Text]

  25. Kennedy, B.K., Barbie, D.A., Classon, M., Dyson, N. and Harlow, E. (2000) Nuclear organization of DNA replication in primary mammalian cells. Genes Dev., 14, 2855–2868.[Abstract/Free Full Text]

  26. Kuzminov, A. (2001) DNA replication meets genetic exchange: chromosomal damage and its repair by homologous recombination. Proc. Natl Acad. Sci. USA, 98, 8461–8468.[Abstract/Free Full Text]

  27. Paull, T.T., Rogakou, E.P., Yamazaki, V., Kirchgessner, C.U., Gellert, M. and Bonner, W.M. (2000) A critical role for histone H2AX in recruitment of repair factors to nuclear foci after DNA damage. Curr. Biol., 10, 886–895.[CrossRef][ISI][Medline]

  28. Rogakou, E.P., Pilch, D.R., Orr, A.H., Ivanova, V.S. and Bonner, W.M. (1998) DNA double-stranded breaks induce histone H2AX phosphorylation on serine 139. J. Biol. Chem., 273, 5858–5868.[Abstract/Free Full Text]

  29. Joukov, V., Chen, J., Fox, E.A., Green, J.B. and Livingston, D.M. (2001) Functional communication between endogenous BRCA1 and its partner, BARD1, during Xenopus laevis development. Proc. Natl Acad. Sci. USA, 98, 12078–12083.[Abstract/Free Full Text]

  30. McCarthy, E.E., Celebi, J.T., Baer, R. and Ludwig, T. (2003) Loss of Bard1, the heterodimeric partner of the Brca1 tumor suppressor, results in early embryonic lethality and chromosomal instability. Mol. Cell. Biol., 23, 5056–5063.[Abstract/Free Full Text]

  31. Brzovic, P.S., Keeffe, J.R., Nishikawa, H., Miyamoto, K., Fox, D., 3rd, Fukuda, M., Ohta, T. and Klevit, R. (2003) Binding and recognition in the assembly of an active BRCA1/BARD1 ubiquitin-ligase complex. Proc. Natl Acad. Sci. USA, 100, 5646–5651.[Abstract/Free Full Text]

  32. Friedman, L.S., Ostermeyer, E.A., Szabo, C.I., Dowd, P., Lynch, E.D., Rowell, S.E. and King, M.C. (1994) Confirmation of BRCA1 by analysis of germline mutations linked to breast and ovarian cancer in ten families. Nat. Genet., 8, 399–404.[CrossRef][ISI][Medline]

  33. Wu, L.C., Wang, Z.W., Tsan, J.T., Spillman, M.A., Phung, A., Xu, X.L., Yang, M.C., Hwang, L.Y., Bowcock, A.M. and Baer, R. (1996) Identification of a RING protein that can interact in vivo with the BRCA1 gene product. Nat. Genet., 14, 430–440.[CrossRef][ISI][Medline]

  34. Fabbro, M., Rodriguez, J.A., Baer, R. and Henderson, B.R. (2002) BARD1 induces BRCA1 intranuclear foci formation by increasing RING-dependent BRCA1 nuclear import and inhibiting BRCA1 nuclear export. J. Biol. Chem., 277, 21315–21324.[Abstract/Free Full Text]

  35. Mimnaugh, E.G., Chen, H.Y., Davie, J.R., Celis, J.E. and Neckers, L. (1997) Rapid deubiquitination of nucleosomal histones in human tumor cells caused by proteasome inhibitors and stress response inducers: effects on replication, transcription, translation, and the cellular stress response. Biochemistry, 36, 14418–14429.[CrossRef][Medline]

  36. Morris, J.R., Keep, N.H. and Solomon, E. (2002) Identification of residues required for the interaction of BARD1 with BRCA1. J. Biol. Chem., 277, 9382–9386.[Abstract/Free Full Text]

  37. Peng, J., Schwartz, D., Elias, J.E., Thoreen, C.C., Cheng, D., Marsischky, G., Roelofs, J., Finley, D. and Gygi, S.P. (2003) A proteomics approach to understanding protein ubiquitination. Nat. Biotechnol., 21, 921–926.[CrossRef][ISI][Medline]

  38. Lam, Y.A., DeMartino, G.N., Pickart, C.M. and Cohen, R.E. (1997) Specificity of the ubiquitin isopeptidase in the PA700 regulatory complex of 26 S proteasomes. J. Biol. Chem., 272, 28438–28446.[Abstract/Free Full Text]

  39. Kentsis, A., Gordon, R.E. and Borden, K.L. (2002) Control of biochemical reactions through supramolecular RING domain self-assembly. Proc. Natl Acad. Sci. USA, 99, 15404–15409.[Abstract/Free Full Text]

  40. Kessler, B.M., Tortorella, D., Altun, M., Kisselev, A.F., Fiebiger, E., Hekking, B.G., Ploegh, H.L. and Overkleeft, H.S. (2001) Extended peptide-based inhibitors efficiently target the proteasome and reveal overlapping specificities of the catalytic beta-subunits. Chem. Biol., 8, 913–929.[CrossRef][ISI][Medline]

  41. Boddy, M.N., Howe, K., Etkin, L.D., Solomon, E. and Freemont, P.S. (1996) PIC 1, a novel ubiquitin-like protein which interacts with the PML component of a multiprotein complex that is disrupted in acute promyelocytic leukaemia. Oncogene, 13, 971–982.[ISI][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Cell Biol.Home page
L. Postow, C. Ghenoiu, E. M. Woo, A. N. Krutchinsky, B. T. Chait, and H. Funabiki
Ku80 removal from DNA through double strand break-induced ubiquitylation
J. Cell Biol., August 11, 2008; 182(3): 467 - 479.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. D. Beck, S.-J. Park, Y.-J. Lee, Y. Roman, R. A. Hromas, and S.-H. Lee
Human Pso4 Is a Metnase (SETMAR)-binding Partner That Regulates Metnase Function in DNA Repair
J. Biol. Chem., April 4, 2008; 283(14): 9023 - 9030.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Laufer, S. V. Nandula, A. P. Modi, S. Wang, M. Jasin, V. V. V. S. Murty, T. Ludwig, and R. Baer
Structural Requirements for the BARD1 Tumor Suppressor in Chromosomal Stability and Homology-directed DNA Repair
J. Biol. Chem., November 23, 2007; 282(47): 34325 - 34333.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Murakawa, E. Sonoda, L. J. Barber, W. Zeng, K. Yokomori, H. Kimura, A. Niimi, A. Lehmann, G. Y. Zhao, H. Hochegger, et al.
Inhibitors of the Proteasome Suppress Homologous DNA Recombination in Mammalian Cells
Cancer Res., September 15, 2007; 67(18): 8536 - 8543.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. A. Bish and M. P. Myers
Werner Helicase-interacting Protein 1 Binds Polyubiquitin via Its Zinc Finger Domain
J. Biol. Chem., August 10, 2007; 282(32): 23184 - 23193.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Tembe and B. R. Henderson
BARD1 Translocation to Mitochondria Correlates with Bax Oligomerization, Loss of Mitochondrial Membrane Potential, and Apoptosis
J. Biol. Chem., July 13, 2007; 282(28): 20513 - 20522.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
B. Sobhian, G. Shao, D. R. Lilli, A. C. Culhane, L. A. Moreau, B. Xia, D. M. Livingston, and R. A. Greenberg
RAP80 Targets BRCA1 to Specific Ubiquitin Structures at DNA Damage Sites
Science, May 25, 2007; 316(5828): 1198 - 1202.
[Abstract] [Full Text] [PDF]