Human Molecular Genetics Advance Access originally published online on March 11, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Human Molecular Genetics, 2004, Vol. 13, No. 9 923-934
DOI: 10.1093/hmg/ddh108
Mutations in AAC2, equivalent to human adPEO-associated ANT1 mutations, lead to defective oxidative phosphorylation in Saccharomyces cerevisiae and affect mitochondrial DNA stability


1Department of Genetics Anthropology Evolution, University of Parma, 43100 Parma, Italy, 2Department of Pharmaco-Biology, Laboratory of Biochemistry and Molecular Biology, University of Bari, 70125 Bari, Italy, 3CNR Institute of Biomembranes and Bioenergetics, 70125 Bari, Italy and 4Division of Molecular Neurogenetics, National Neurological Institute C. Besta, 20126 Milano, Italy
Received December 16, 2003; Accepted March 2, 2004
| ABSTRACT |
|---|
|
|
|---|
Autosomal dominant and recessive forms of progressive external ophthalmoplegia (adPEO and arPEO) are mitochondrial disorders characterized by the presence of multiple deletions of mitochondrial DNA in affected tissues. Four adPEO-associated missense mutations have been identified in the ANT1 gene. In order to investigate their functional consequences on cellular physiology, we introduced three of them at equivalent positions in AAC2, the yeast orthologue of human ANT1. We demonstrate here that expression of the equivalent mutations in aac2-defective haploid strains of Saccharomyces cerevisiae results in (a) a marked growth defect on non-fermentable carbon sources, and (b) a concurrent reduction of the amount of mitochondrial cytochromes, cytochrome c oxidase activity and cellular respiration. The efficiency of ATP and ADP transport was variably affected by the different AAC2 mutations. However, irrespective of the absolute level of activity, the AAC2 pathogenic mutants showed a significant defect in ADP versus ATP transport compared with wild-type AAC2. In order to study whether a dominant phenotype, as in humans, could be observed, the aac2 mutant alleles were also inserted in combination with the endogenous wild-type AAC2 gene. The heteroallelic strains behaved as recessive for oxidative growth and petite-negative phenotype. In contrast, reduction in cytochrome content and increased mtDNA instability appeared to behave as dominant traits in heteroallelic strains. Our results indicate that S. cerevisiae is a suitable in vivo model to study the pathogenicity of the human ANT1 mutations and the pathophysiology leading to impairment of oxidative phosphorylation and damage of mtDNA integrity, as found in adPEO.
| INTRODUCTION |
|---|
|
|
|---|
Autosomal dominant or recessive external progressive ophthalmoplegia (adPEO or arPEO) is a mitochondrial disorder associated with the presence of multiple deletions of mtDNA (13). The disease is characterized by the presence of progressive external ophthalmoplegia, ptosis and myopathy. Bilateral cataract, tremor, ataxia and chronic sensorimotor peripheral neuropathy are found in some families. Serum lactate at rest is normal or moderately elevated. Examination of muscle biopsies shows ragged-red fibers (RRF), decreased histochemical reaction to cytochrome c oxidase and neurogenic changes. Southern blot analysis of muscle mtDNA shows the presence of heterogeneous mtDNA species. The accumulation of mtDNA lesions correlates with the age of onset and with the severity of the disease.
The disorder is genetically heterogeneous. Linkage analysis has demonstrated the presence of three loci: on chromosome 10q24 (MIM157640) (4), 4q3435 (MIM601227, recently changed to MIM103220) (5) and 15q (MIM174763) (6). However, the presence of families that are not linked to any of the known loci suggests the existence of at least a fourth locus. The gene on chromosome 10, C10ORF2, encodes TWINKLE, a putative mitochondrial helicase. The gene that maps on chromosome 15q25 encodes POLG1, the catalytic subunit of the mitochondrial DNA polymerase and has recently been associated with both adPEO and arPEO cases. The gene responsible for the adPEO form linked to the 4q locus encodes the muscle-heart specific isoform of the mitochondrial adenine nucleotide translocator (ANT1) (7). While TWINKLE and POLG1 are obviously connected to mtDNA metabolism, the relationship between ANT1 and mtDNA is less clear.
ANT1 is the most abundant protein of the inner mitochondrial membrane and works as a homodimer to create a channel through which ADP is transported inside, and ATP outside, mitochondria (8). ANT is also believed to be part of the mitochondrial permeability transition pore (MPTP) and could play a role in mitochondrion-mediated apoptosis (9). A few heterozygous missense mutations of ANT1 have been reported in adPEO families and in one sporadic case. The familial mutations are A114P, L98P and D104G (3,7,10,11). Two of them map in highly conserved or conservatively substituted residues throughout eukaryotes, while D104G does not (Fig. 1). The mutation present in the sporadic case is a V289M substitution (7).
|
Several mechanisms have been suggested to explain the pathogenesis of adPEO caused by mutant ANT1: (i) a disturbed intramitochondrial adenine nucleotide pool causing a high error rate of the mitochondrial DNA polymerase (7); (ii) the formation of an unregulated channel in the mitochondrial membranes (12); and (iii) the impairment of the import of the mutated forms into mitochondria (13). Other mechanisms are possible: for instance, mutations could induce protein misfolding that could make it more susceptible to oxidative inactivation (14); in turn, ANT1 dysfunction could lead to an increase of oxidative stress within mitochondria, and damage on mtDNA (15).
Human cell lines are not suitable to evaluate the functional consequences of ANT1 mutations, since ANT1 is not expressed in cultured fibroblasts or myoblasts, and its overexpression induces apoptosis (9).
However, genes encoding the ADP/ATP carrier are highly conserved in all eukaryotic organisms. In the yeast Saccharomyces cerevisiae three genes, AAC1, AAC2, AAC3, whose expression is differently regulated by environmental factors, encode isoforms of the mitochondrial ADP/ATP carrier (1618). AAC1 and AAC3 are not essential for growth on respiratory carbon sources and their disruption, either separately or together in the same cell, does not affect the mitochondrial ADP/ATP translocation (19). AAC2 encodes the major translocator protein related to oxidative phosphorylation, and is responsible for growth on non-fermentable carbon sources, such as glycerol, ethanol or lactate.
In order to validate the pathogenicity of the human mutations, and better understand their effects on mitochondrial metabolism, we performed complementation studies in AAC2-defective strains of the yeast S. cerevisiae. Mutations were introduced in the AAC2 gene, whose deduced amino acid sequence is 54% similar to hANT1 and the effects on energy metabolism and transport function were analysed for each mutation. In order to study whether these alleles behaved as dominant negative in yeast, the aac2 mutant alleles were also inserted in combination with the endogenous wild-type AAC2 allele and the effects on energy metabolism and mtDNA stability were analysed.
| RESULTS |
|---|
|
|
|---|
AAC2 alleles equivalent to hANT1 mutants responsible for adPEO cause a severe impairment in oxidative growth
We performed complementation studies by introducing AAC2 mutated alleles into the S. cerevisiae strain WB-12, which carries a double deletion abolishing both aac1 and aac2 genes. In addition to the A114P mutation, that was previously shown to determine a defective growth phenotype on glycerol (7), we analysed two other mutations identified in the hANT1 protein sequence of PEO patients: V289M (7) and L98P (3). Alanine (A)114 in the hANT1 protein sequence is highly conserved through eukaryotes, and corresponds to A128 in the yeast Aac2 protein. The other two missense mutations are not conserved between man and yeast (Fig. 1). In particular leucine (L)98 in hANT1 is conservatively substituted by methionine (M)114 in Aac2p and valine (V)289 in hANT1 corresponds to serine (S)303 in Aac2p. A fourth missense mutation, D104G (10), maps in a region where the sequence homology between hANT1 and yAAC2 is sparse, making the alignment predictions unreliable. Therefore the D104G mutation has not been investigated in the present work.
In a first series of constructs, we replaced the codon specific to the amino acid residue of the wild-type AAC2 yeast sequence with the codon corresponding to the amino acid residue of the wild-type ANT1 human sequence. In particular, M114 of AAC2 was mutated into L114 and S303 into V303 (Table 1). In order to maximize the expression of these variants, the preferred yeast codons were used in the sequences of the oligonucleotides for mutagenesis: GTT for V and TTG for L (20). Hereafter these modified species will be referred to as humanized wild-type Aac2p variants.
|
The humanized wild-type AAC2 variant alleles M114L and S303V were then introduced into WB-12 yeast mutant. Transformants aac2M114L and aac2S303V were tested for growth on YNB medium supplemented with 2% lactate (Fig. 2). Both alleles were able to complement the oxidative growth defect of the WB-12 strain. Similar results were obtained with ethanol or glycerol (data not shown).
|
We then prepared a second series of constructs by introducing the amino acid changes A128P, M114P and S303M. These changes correspond to allegedly pathogenic mutant residues in the ANT1 protein of adPEO patients. Again, the preferred codon CCA for proline, and the unique ATG codon for methionine were used for mutagenesis. Strain WB-12 was transformed with the mutated constructs (aac2A128P, aac2M114P and aac2S303M) and transformants were analysed for growth on 2% lactate. Growth was severely impaired in transformants carrying the A128P, M114P or S303M substitutions (Fig. 2). The M114P substitution had a more drastic effect than the others. Similar results were obtained with ethanol or glycerol (data not shown).
To check whether the reduced growth of the strains carrying the pathogenic alleles could result from a reduced expression of the mutant alleles and/or to a reduced content of the encoded protein in mitochondria, we performed northern and western blotting analyses. Northern analysis showed that the transcript level of the AAC2 gene expressed from the pFL38 plasmid (WB-12/AAC2) was very close to that derived from the endogenous nuclear allele (W303-1B) and that in all the aac2 mutants analysed, gene expression was comparable to the AAC2 wild-type allele (Fig. 3A). Western blotting analysis showed that all the mutations tested did not cause a significant alteration of the Aac2 protein content, with the exception of the A128P substitution (
30% of wild-type; Fig. 3B).
|
Taken together these results indicate that, with the possible exception of A128P (see below), the amino acid residues identified at equivalent positions in hANT1 mutants responsible for adPEO, but not those present at the same positions in the wild-type ANT1 protein, specifically altered the function of Aac2p.
AAC2 alleles equivalent to hANT1 mutants identified in adPEO patients fail to rescue growth after ethidium bromide treatment
Op1 is an oxidative phosphorylation defective yeast strain carrying an R96H substitution in the Aac2 protein (Aac2p) (17). This strain is unable to produce mitochondrial petite mutants (21), thus resembling petite-negative yeasts (22). Accordingly, the op1 mutant (VG1-5A), and the WB-12 strain, carrying double aac1 and aac2 disruption, both undergo growth arrest after treatment with ethidium bromide, that causes deletions of mitochondrial DNA (23). As expected, reintroduction of the wild-type AAC2 gene was able to complement this phenotype (data not shown). Similar results were obtained with WB-12 strain transformed with the humanized wild-type variants aac2M114L and aac2S303V. By contrast, no growth recovery was obtained when WB-12 strain was transformed with aac2A128P, aac2M114P or aac2S303M alleles, equivalent to hANT1 mutations responsible for adPEO (data not shown).
Cytochrome content and respiratory activity in AAC2 mutants
Measurement of the mitochondrial cytochrome content is an index of the structural integrity of the respiratory chain complexes. The WB-12 strain transformed with aac2M114L and aac2S303V humanized wild-type alleles exhibited a cytochrome profile similar to that of the strain transformed with the wild type AAC2 gene (Fig. 4). By contrast, the strains carrying allegedly pathogenic aac2A128P, aac2M114P and aac2S303M mutations displayed a significant reduction of cytochromes b and aa3, but not of cytochrome c (Fig. 4). The observed reduction of the cytochrome content corresponded to a reduction in the cytochrome c oxidase activity (Table 2). Specific activity of cytochrome c oxidase was found to be reduced to a variable extent in mitochondria isolated from strains carrying allegedly pathogenic mutations compared to wild-type mitochondria whereas expression of the humanized wild-type alleles resulted in a comparable activity. In the same transformants the respiration activity parallelized the cytochrome profile, indicating that the presence of the pathological alleles aac2A128P and aac2M114P severely reduced the respiration, whereas the aac2S303M mutation had a milder effect (Table 3).
|
|
|
Transport properties of AAC2 mutants
To directly test the functional capacity of the AAC2 mutants we carried out specific transport assays. The Aac2 protein was solubilized from mitochondria isolated from different WB-12 transformants. The yield of mitochondrial protein was lower for the WB-12 strain transformed with wild-type allele than for the WB-12 strain transformed with the allegedly pathogenic mutant variants aac2A128P, aac2M114P and aac2S303M (AAC2 wild-type, 0.23±0.03 mg/g cell wet weight; aac2A128P, 0.43±0.07; aac2M114P, 0.40±0.06; aac2S303M, 0.35±0.07). In contrast, the yields for the humanized mutant variants were not significantly different compared with wild-type (0.27±0.03 and 0.29±0.05 mg/g cell, for M114L and S303V, respectively). These results suggest that expression of the pathogenic alleles triggered mitochondrial proliferation in response to a decrease of cytochrome content and respiration. The inner membrane potential of mutant mitochondria measured in vitro was 7090% relative to wild-type mitochondria, indicating that the aac2 mutant alleles did not induce significant membrane disgregation (data not shown).
Homoexchange modes.
As shown in Figure 5, proteoliposomes reconstituted with extracts from A128P mitochondria showed a markedly reduced ATP homoexchange rate (
30%) compared with the wild-type transformant. Since protein analysis demonstrated a corresponding decrease in immunoreactivity of the Aac2 protein content (Fig. 3B), a decreased content of the A128P mutant in mitochondria, rather than impaired transport activity, accounts for the reduced ATP uptake. Given the normal level of expression of the aac2A128P allele (Fig. 3A), the reduction in the level of the A128P mutant in mitochondria is likely to depend on post-transcriptional factors, such as stability of the protein or import.
|
In contrast, the ATP homoexchange rates associated with the pathogenic substitutions M114P and S303M did not significantly differ from those of the corresponding humanized wild-type alleles, M114L and S303V, which were in turn close to the rate associated to wild-type Aac2p (Fig. 5). The increase of the mean rate value of the ATP homoexchange catalysed by the M114P mutant relative to M114L, can be explained partly by an increased number of mitochondria from which the reconstituted protein was extracted, as suggested by the higher citrate synthase activity (1448 versus 1025 nmoles/min/mg protein). No activity was observed in the absence of added protein or internal substrate. Likewise no transport was observed (99% inhibition) when proteoliposomes were pre-incubatated with 10 µM carboxyatractylate and 5 µM bongkrekic acid, the specific and powerful inhibitors of the mitochondrial ADP/ATP carrier (24), prior to the addition of labeled ATP or ADP.
We then measured ADP homoexchange rates. As shown in Figure 5, the ADP transport catalysed by all of the pathogenic substitutions was markedly decreased compared with wild-type Aac2p, whereas no significant abnormality was found in the rate of ADP homoexchange mediated by M114L and S303V humanized wild-type variants. These results suggest the presence of a defect in ADP transport specifically associated to the pathogenic mutations.
Heteroexchange modes.
For the ability of the yeast cell to carry out oxidative phosphorylation, not only the absolute Aac2p transport level is important, but also the prevalence of the productive mode (ADP import/ATP export) versus other transport modes. In vivo, Aac2p is inserted in the inner mitochondrial membrane in such a way that ADP import is more kinetically efficient than ADP export, whereas ATP is preferably transported in the opposite direction. Therefore, the ATP/ADP exchange is dependent on the orientation of the reconstituted Aac2p protein into de-energized liposomes (25).
To verify the possibility that the effect of the pathogenic mutations on the transport of ADP and ATP could be due to opposite orientation in the liposomal membrane compared with wild-type, we determined the rates of each heteroexchange mode, i.e. the rate of ATP uptake in exchange for intraliposomal ADP (ATP/ADP heteroexchange) and the rate of the ADP uptake in exchange for intraliposomal ATP (ADP/ATP heteroexchange). As shown in Figure 6A, no difference in the ratio between the rates of the ATP/ADP versus ADP/ATP heteroexchange modes were observed with the exception of the S303M, where the ratio between the heteroexchange rates was significantly lower than 1. These data suggest that under our conditions the wild-type protein, as well as the substitution mutants (except the S303M), are randomly incorporated in the liposomal membrane, with a (slight) preference for the inside-out orientation (i.e. opposite to the orientation of the native protein in the mitochondrial inner membrane). In agreement with this conclusion we found that carboxyatractylate, an impermeable ligand specific for the matrix-exposed face of the protein, inhibited the wild-type and the pathogenic substitutions A128P and M114P by 5565% (data not shown). By contrast, S303M activity was only inhibited by 1520%, indicating that most of the S303M protein has the same orientation in the liposomal membrane as the native Aac2p in vivo. This observation is in agreement with the low ATP/ADP versus ADP/ATP ratio found for the S303M variant. Altogether our results indicate that the different effects of the pathogenic mutations on the transport of ADP and ATP are not due to an opposite orientation in the liposomal membrane compared with wild-type.
|
We then compared the ATP/ATP homoexchange versus ATP/ADP heteroexchange rates. The proteoliposomes reconstituted with wild-type mitochondrial extracts were found to take up ATP in the heteroexchange mode at a 2-fold lower rate than in the homoexchange mode (Fig. 6B), as expected because of the electrogenic nature of the ATP exchange for ADP. Interestingly, the proteoliposomes reconstituted with extracts from the A128P, M114P and S303M mitochondria displayed a further 2-fold decrease of the ratio between the ATP/ADP exchange and the ATP/ATP exchange rates relative to wild-type mitochondria (Fig. 6B). The humanized wild-type variant M114L showed a ratio between the heteroexchange and the homoexchange rates not significantly different from wild-type Aac2p, while the humanized wild-type variant S303V showed a significant decrease.
Taken together, these data indicate that the pathogenic mutations as well as the S303V substitution have an ATP>ADP preference, relative to wild-type Aac2p.
Studies on heterozygous AAC2 wt/mutant strains
In humans, the A114P, L98P and V289M mutations are dominant. To mimic the human condition, the strain W303-1B AAC2 was transformed with plasmids carrying different aac2 alleles to obtain strains heteroallelic for the three different mutations AAC2/aac2A128P, AAC2/aac2M114P and AAC2/aac2S303M. The control strains were AAC2/AAC2, AAC2/aac2M114L and AAC2/aac2S303V, respectively.
The strains were tested for growth on YNB medium supplemented with 2% lactate, ethanol or glycerol. All the heteroallelic mutant strains failed to show a significant growth defect in comparison with control strains (data not shown). In addition, viable colonies were obtained after ethidium bromide treatment. These results suggest that the oxidative growth and petite-negative phenotypes for all of the mutant strains behaved as recessive traits.
We then analysed whether other OXPHOS features, such as the structure and function of the respiratory complexes, and mtDNA integrity, were affected by the heteroallelic conditions. As shown in Figure 7, the cytochrome content of the AAC2/aac2S303M heteroallelic strain was barely reduced compared with the strain carrying the humanized wild-type allele AAC2/aac2S303V. By contrast, the heteroallelic strains AAC2/aac2A128P and AAC2/aac2M114P showed a markedly reduced cytochrome content compared with control strains, in particular for cytochromes b and aa3. As expected, the respiratory activities parallelized the cytochromes profiles (Table 4). These results suggest that, at least for respiratory structure and function, the aac2A128P and aac2M114P mutations behaved as dominant traits. It should be noted that similar respiratory activities were not sufficient to sustain enough energy production for aerobic growth of the corresponding monoallelic mutants, indicating a reduced efficiency of coupling between respiration and ATP synthesis in the latter strains.
|
|
Spontaneous mtDNA mutability in heterozygous AAC2 wt/mutant strains.
Heteroallelic strains AAC2/aac2A128P, AAC2/aac2M114P and AAC2/aac2S303M are petite positive, i.e. are viable in the presence of multiple deletions or even complete loss of mtDNA. This enabled us to analyse whether the AAC2 gene mutations can affect the structural integrity of the mitochondrial genome. We first performed a Southern analysis on total genomic DNA extracted from massive liquid cultures of all our strains, using a yeast mtDNA-specific probe. No alteration in the hybridization pattern could be detected in any of them (data not shown).
In order to evaluate a possible accumulation of mtDNA rearrangements in single clones, all the heteroallelic strains (AAC2/aac2M114L, AAC2/aac2S303V and AAC2/aac2A128P, AAC2/aac2M114P, AAC2/aac2S303M) and the homoallelic strain (AAC2/AAC2) were grown for
15 generations and plated onto YNB medium supplemented with 2% glucose. The segregation of petite mutants was then estimated by the TTC overlay assay and by glycerol-negative phenotype. As shown in Table 5, heteroallelic strains AAC2/aac2A128P and AAC2/aac2S303M showed an accumulation of respiratory deficient (RD) mutants 3-fold higher than the corresponding control (AAC2/AAC2 and AAC2/aac2S303V, respectively). These results suggest that the combination of the two mutant alleles with the wild-type allele caused an increase of abnormal mtDNA genomes, indicating a dominant effect. By contrast, no significant increase was observed in AAC2/aac2M114P.
|
The petite mutants can be either
or
o. The
mutants contain deletion-carrying mtDNA, whereas
o are mtDNA-less mutants. To evaluate the nature of the petite mutations, we PCR-screened for the presence/absence of specific regions of mtDNA in respiratory-deficient clones derived from AAC2/aac2A128P and AAC2/aac2S303M strains. Four primer pairs were used, homologous to sequences of the following genes: COX1, COX3, 21S rRNA and COB (see Materials and Methods). All clones displayed the presence of one or more of these regions, indicating that these clones are not
o (data not shown). To confirm that mtDNA of the petite mutants contained deletions, Southern hybridization analysis of isolated mtDNA was carried out using a mtDNA specific oligonucleotide as a probe. The results reported in Figure 8 indicate that mtDNA from petite mutants contain large-scale rearrangements, whereas the mtDNA from the two
+ heteroallelic strains displayed a similar pattern which was also indistinguishable from the pattern obtained with wild-type strain (data not shown). The fact that we did not observe alterations in the mtDNA hybridization pattern by Southern analysis on total genomic DNA extracted from growing cultures of heteroallelic strains can be explained by the low number of petite mutants obtained and by the heterogeneous pattern of mtDNA deleted species, which could be diluted out, relative to the prevalent wild-type mtDNA species.
|
| DISCUSSION |
|---|
|
|
|---|
We have set up a yeast recombinant system to study the pathogenicity of various ANT1 mutations found in adPEO patients. A series of constructs, expressing mutant versions of AAC2, were generated and analysed for the ability to complement defective growth on non-fermentable carbon sources of WB-12, a mutant strain of S. cerevisiae carrying a double aac1aac2 deletion. The three mutants aac2A128P, aac2M114P and aac2S303M all showed a defective oxidative growth phenotype, being M114P the most affected and A128P the least affected. None of the three alleles was able to complement the petite negative phenotype of WB-12. Our results confirm the findings of Kaukonen et al. (7) on aac2A128P and extend to aac2M114P and aac2S303M alleles the association between these mutations, corresponding to hANT1 mutants responsible for adPEO, and oxidative growth phenotype in yeast. By contrast, the oxidative growths of the humanized wild-type variants M114L and S303V, were both similar to the WB-12 strain re-expressing the authentic yeast wild-type Aac2p. This result confirms the usefulness of the yeast S. cerevisiae for the validation of the pathogenicity of new ANT1 mutations in familial and sporadic PEO.
The respiratory analysis of the pathogenic mutants revealed that the mutations exerted a drastic effect on the level of cytochromes aa3 and b, and on the respiratory chain complexes activity, but not on the level of cytochrome c. Our data are consistent with previously reported results indicating a relative insensitivity of the cytochrome c content in response to different mutations in Aac2p (26). Interestingly enough, our analysis revealed that cells transformed with the pathogenic alleles displayed a markedly abnormal (i.e. reduced) cytochrome profile whereas the aac1aac2 null mutant displayed a cytochrome profile that was only partially reduced, compared with the wild-type. This result indicates that a structurally defective protein can cause more damage that the absence of the protein itself. A possible explanation is that, in addition to its function on ATP/ADP translocation, the Aac2 protein plays a structural role that contributes to maintain the integrity of respiratory complexes in the inner membrane of mitochondria. The fact that cytochromes b and aa3 were more affected than cytochrome c can be explained by the observation that the first two cytochromes are inserted in the inner membrane, while cytochrome c is loosely bound to the membrane (27,28). Direct evidence in support of an effect of AAC on the membrane structure was previously reported in bovine heart mitochondria (29).
In the present work, we report for the first time the effects on transport activity of mutations in AAC2 equivalent to adPEO-associated mutations in ANT1. All the aac2 pathogenic mutants retain the basic features of ANT/AAC proteins (e.g. high sensitivity to carboxyatractyloside and bongkrekic acid, obligatory counter-exchange mechanism, homoexchange preferred to heteroexchange). These data, together with the significant level of mitochondrial membrane potential of cells expressing different aac2 alleles, strongly argue against the hypothesis that the primary pathogenic role of ANT1 mutations associated with adPEO is to cause directly or indirectly the opening of an unregulated channel followed by structural disintegration of mitochondria (12). It should also be noted that the uncoupling effects reported by Chen (12) were observed in a strain over-expressing the aac2A128P mutant allele.
We did not observe a significantly reduced concentration of Aac2 mutated protein in mitochondria except for the A128P variant. This could be due to reduced import efficiency or to instability of the mutated proteins in the mitochondrial membrane. However, our results do not establish any direct correlation between import/stability efficiency and the observed phenotypes. De Marcos et al. (13) proposed that impairment of mitochondrial import is the primary cause of the pathogenicity of the A114P and V289M substitutions in S. cerevisiae. Our results did not confirm this hypothesis. Moreover, the fact that ANT mutations in adPEO pathology behave in a dominant manner strongly argues against the idea that the absence of the protein can be the cause of the human disease.
The pathogenic mutants displayed altered kinetic properties, since, markedly more than the wild-type strains, ATP is preferred to ADP as a substrate. Efficient ATP export is controlled by an equally efficient ADP uptake; therefore, the ATPout/ADPin heteroexchange should be faster than any other transport mode. In the light of our kinetic measurements, since yeast cells maintain a high cytosolic ATP/ADP ratio, mutant Aac2p could be engaged in a futile ATP/ATP homoexchange at the expense of productive ATPout/ADPin heteroexchange. In turn, the resulting decrease in mitochondrial ADP content could inhibit the process of intramitochondrial ATP synthesis, leading to the observed oxidative growth phenotype of cells expressing the pathogenic aac2 alleles. A similar explanation has been proposed to explain the effect on respiratory growth and oxidative phosphorylation in other mutant Aac2p (25,26). In addition, ATP/ADP imbalance may be responsible for the dysregulation of a number of mitochondrial enzymatic activities (30), including import and assembly of respiratory complexes. Interestingly, the ATP/ADP balance drives drastic structural changes of the F0F1ATP synthase complex of the thermophilic Bacillus PS3 (31).
The S303M pathological mutation displayed a transport dysfunction and oxidative growth phenotype similar to those of the other pathological mutants, but differed from the latter because respiration was reduced to only 50%. Also the S303V humanized wild-type allele behaved differently from both the wild-type and the other humanized wild-type M114L alleles, both in kinetic properties and in cytochrome content. This complex situation may be due to the sequence divergence between man and yeast at this position, suggesting for this residue (S303) a specific function in yeast Aac2p.
To mimic the human condition in adPEO, where the mutations in ANT1 are dominant, the aac2 mutant alleles were inserted in combination with the endogenous wild-type AAC2 gene. The heteroallelic strains AAC2/aac2A128P, AAC2/aac2M114P and AAC2/aac2S303M displayed a normal oxidative growth phenotype, a petite-positive phenotype and a normal membrane potential (data not shown) indicating that the three pathological mutations behaved as recessive for these phenotypes. However, when the respiratory cytochrome profiles and mtDNA mutability were analysed, we observed a dominant behaviour of the pathological mutations. In particular, the A128P mutation determined alterations of the cytochrome profile and an increase of mtDNA mutability. The M114P mutation caused alteration of respiratory cytochromes, whereas the S303M caused an increase of mtDNA mutability. The fact that mtDNA instability does not correlate to the reduction of respiratory cytochromes in the heteroallelic strains carrying the mutations M114P and S303M suggests that the two phenotypes can arise independently.
In S. cerevisiae, petite mutations occur spontaneously at a strain-dependent frequency, giving rise to respiratory deficiency. Conditions that cause increased mtDNA mutability lead to an increase of respiratory deficient cells, since after a limited number of cell divisions the vast majority of mitochondria are homoplasmic, as the heteroplasmic state is always transient in S. cerevisiae (32). The analysis of petite mutants in the heteroallelic strains AAC2/aac2A128P and AAC2/aac2S303M showed that all of them were
, indicating that neither the synthesis of mtDNA nor its segregation was inhibited. Thus, the mtDNA alteration associated with pathogenic aac2 alleles was similar in yeast to that observed in adPEO patients. In our experimental conditions, we observed a 3-fold increase of accumulation of petite mutants only with two out of three pathological alleles. Given the low absolute level of mitochondrial mutability detected with the dominant heteroalleles, it cannot be excluded that a lower increase of mtDNA mutability in AAC2/aac2M114P mutant can be masked by the background mutability of the wild-type strain. Further work is required to address this issue. Since heteroplasmy is stably maintained in man, but not in yeast, the increase in the rate of petite colonies observed in our mutant strains can account for the slow, progressive accumulation of multiple deletions in human mtDNA which is proposed to lead to adPEO.
Our results validate the yeast S. cerevisiae as a model system suitable for further study of the early biochemical and cellular consequences of mutations in the human ANT1 gene.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Yeast strains and culture media
Yeast strains used were W303-1B (MAT
ade2-1 leu2-3,112 ura3-1 his3-22,15 trp1-1 can1-100 AAC1 AAC2) and its isogenic aac1 aac2 mutant WB-12 (MAT
ade2-1 trp1-1 ura3-1 can1-100 aac1::LEU2 aac2::HIS3) (33). Cells were cultured in YNB medium, composed of 0.67% yeast nitrogen base without amino acids (Difco), supplemented with the appropriate amino acids and bases to a final concentration of 40 µg/ml. Various carbon sources were added at 2% (w/v). Lactate was a commercial racemic product (Fluka). For the isolation of mitochondria, cells were grown to mid-log phase in SC medium (34) supplemented with 2% galactose.
Vectors
Plasmid pBN38 containing the wild-type AAC2 gene was constructed by inserting the 1.9 kb BamHINheI region of the AAC2 gene in the BamHIXbaI sites of the centromeric vector pFL38 (35). This construct was used as template for mutagenesis of the AAC2 gene.
Site-directed mutagenesis and sequence analysis
The QuikChange site-directed mutagenesis Kit (Stratagene) was used to introduce five different point mutations in the S. cerevisiae AAC2 gene. The list of base changes, and corresponding modified primers used to generate mutated vectors, is reported in Table 1. After mutagenesis, the inserts from each different construct were first sequenced to check for the presence of the correct base change, using suitable primers, close to the mutagenized nucleotide. The sequences of the oligonucleotide primers were as follows: MSEQ, GATGATGACCTCCGGTCAAGC; MSEQ2, CCTCTCATAAGCTATTCATTTG; MSEQ3, GGTGTTATCTCATTCTGGAGAG. Mutagenized inserts were then completely sequenced on both strands.
Ethidium bromide treatment and TTC staining
Ethidium bromide treatment has been performed as previously described (23). Triphenyltetrazolium chloride (TTC) overlay on colonies was used to analyse the respiratory competence of cells (36). TTC is used as a redox indicator because it accepts electrons from succinate dehydrogenase during the oxidation of succinate to fumarate in the Krebs cycle. When reduced, TTC, a water-soluble, colourless compound, becomes a water-insoluble, red formazan product. After TTC overlay respiration-competent colonies turn reddish, whilst non-respiring colonies remain colourless.
Cytochrome spectra and respiration
Differential spectra between reduced and oxidized cells of a suspension of cells at 60 mg/ml (wet weight) were recorded at room temperature, using a Cary 219 spectrophotometer. Oxygen uptake rate was measured at 30°C using a Clark electrode in a reaction vessel of 3 ml of air-saturated respiration buffer (0.1 M phthalateNaOH, pH 5.0), 10 mM glucose, starting the reaction with the addition of 20 mg of wet weight of cells as previously described (37).
RNA preparation and northern analysis
Total RNA was prepared by extraction with hot acidic phenol (38), from cells grown in YNB supplemented with 2% galactose. Northern analysis was carried out as previously described (39). The AAC2 probe was a 700 bp fragment obtained by PCR amplification with pBN38 plasmid as template. The primers used for the amplification were MSEQ3 and A2 (CAAGATCATTTGCAGTTGGTCG). The amount of RNA loaded on the gel was estimated by hybridization with an actin gene probe (ACT1). All the probes were labeled with [
-32P]dCTP using the rediprime DNA labelling system (Amersham).
Reconstitution of Aac2p into liposomes and transport measurements
Organelles from yeast lysates were harvested by centrifugation according to standard procedures (40). Isolated mitochondria were solubilized in a buffer containing 1.6% Triton X-114 (w/v), 2.2 mg/ml cardiolipin (Sigma), 10 mM Na2SO4, 1 mM EDTA, 10 mM Hepes, pH 7.5, at a final concentration of 200 µg protein/ml. After incubation for 20 min at 4°C, the mixture was spun at 40 000g for 10 min. The supernatant (Triton-solubilized extract) was immediately incorporated into phospholipid vesicles by cyclic removal of the detergent with a hydrophobic column (41), as described below. The composition of the initial mixture used for reconstitution was: 50 µl of Triton-solubilized extract; 70 µl of 10% Triton X-114; 100 µl of 10% phospholipids in the form of sonicated liposomes, 0.6 mg cardiolipin (Sigma), 20 mM ATP or ADP, 10 mM Hepes, pH 7.5, and water to a final volume of 700 µl. These components were mixed thoroughly, and the mixture was recycled 13 times through an Amberlite (Bio-Rad) column (3.2x0.5 cm) pre-equilibrated with the same buffer and the same concentration of the substrate present in the reconstitution mixture. All operations were performed at 4°C, except the passages through Amberlite, which were carried out at room temperature.
External substrate was removed from proteoliposomes on a Sephadex G-75 column preequilibrated with a buffer containing 50 mM NaCl and 10 mM Hepes, pH 7.5. Transport at 25°C was started by adding 0.1 mM [14C]-ATP (Amersham) or [14C]-ADP (NEN) to the proteoliposomes and terminated at predetermined time intervals by addition of 30 mM pyridoxal 5'-phosphate and 10 mM bathophenanthroline (the inhibitor-stop method) (41). The external radioactivity was removed on Sephadex G-75 and the internal radioactivity was measured. In controls, transport was inhibited by the addition of the inhibitors together with the labeled substrate. The transport activity was the difference between experimental and control values. No activity was observed in the absence of added protein or internal substrate. Likewise no transport was observed (99% inhibition) when proteoliposomes were pre-incubated with carboxyatractylate and bongkrekic acid, the specific and powerful inhibitors of the mitochondrial ADP/ATP carrier (24), prior to the addition of labelled ATP or ADP. The initial rate of transport was calculated from the time course of isotope equilibration (41) evaluated to a first order equation using a computerized program. For all reconstituted extracts, it was checked in preliminary experiments that the amount of the protein added to the reconstitution mixture determined by the Lowry method modified as described (42) was within the range in which the ATP transport rate varied in a linear manner with respect to the amount of reconstituted protein.
Southern analysis
Total genomic DNA was extracted by rapid genomic preps method (43), mitochondrial DNA was extracted by rapid mitochondrial preparation (44) from cells grown in YNB supplemented with 2% glucose. Aliquots of 30 µg of total genomic DNA and 5 µg of mitochondrial DNA, respectively, were digested with AccI (Amersham). Southern analysis was carried out as previously described (45). Hybridization was performed by standard methods, with a 5'-[
-32P]ATP end-labelled yeast mtDNA-specific sequence repeat (5'-CTCCTTTCGGGGTTCCGGCTCCCGTGGCCGGGCCCCGG-3') as a probe.
PCR-based mtDNA analysis
Oligonucleotide primers were designed as follows: subunit I cytochrome c oxidase gene (COX1 exon 4, chromosomal coordinates 2050820984), forward (OXI3A), 5'-CCATTAATAATTGGAGCTACAG-3', reverse (OXI3B), 5'-GCTCGTATAAGATTGGGTCAC-3'; subunit III cytochrome c oxidase gene (COX3 chromosomal coordinates 7921380022): forward (OXI2A), 5'-GCCTTCACCATGACCTATTG-3', reverse (OXI2B), 5'-CATATCCAACATGATGTCCAG-3'; 21S rRNA gene (chromosomal coordinates 5800960724): forward (21SA), 5'-CACCGCACTTTGCAGAAACG-3', reverse (21SB), 5'-GGTGTGAACCCCCACCGAG-3'; cytochrome b gene (COB exon 1, chromosomal coordinates 3654036954): forward (COBA), 5'-GATTCACCACAACCATCATC-3', reverse (COBB), 5'-GTCCATAAACACAACAATAACC-3'. Chromosomal coordinates and genes sequences are reported in Foury et al. (46). Each sample contained 2 µl of genomic DNA, 1 unit of Taq DNA polymerase, 1 µM of each primers, 200 µM of each deoxynucleoside triphosphate, 1.6 mM of MgCl2 and 2.5 µl of 10x PCR buffer (Invitrogen) in a total volume of 25 µl. DNA amplifications were carried out in a Perkin Elmer PCR thermal cycler. The following PCR conditions were used: 94°C for 3 min, followed by 25 cycles of 1 min at 94°C, 40 s at 53°C, 40 s+2 s/cycle at 72°C. Ten microlitres of each amplification product were then analysed by agarose gel electrophoresis. The fragments size were 447 bp for COX1, 677 bp for COX3, 807 bp for 21S rRNA and 358 bp for COB.
Miscellaneous
Transformation of yeast strain was obtained by the lithium chloride method (47). Yeast DNA was prepared as previously described (48). Restriction enzyme digestions, E. coli transformation and plasmid extractions, were performed using standard methods (45). The membrane potential of freshly isolated yeast mitochondria was assessed by recording the fluorescence changes of the voltage-sensitive dye 3,3'-dipropylthiadicarbocyanine iodide [DiSC3(5); Molecular Probes] as previously described (49) without adding exogenous substrates. Proteins were separated by SDSPAGE in 17.5% gels as previously described (50), transferred to nitrocellulose membranes and immunodecorated with a rabbit antiserum raised against the bacterially expressed ADP/ATP carrier from Neurospora crassa. Immunoreactive complexes were visualized using anti-rabbit IgG-coupled horseradish peroxidase in combination with the ECL system from Amersham Pharmacia Biotech. Cytochrome c oxidase and citrate synthase activities were measured in isolated yeast mitochondria as previously described (51).
| ACKNOWLEDGEMENTS |
|---|
We thank Dr T. Hatanaka (Tokushima University, Japan) for the strain WB-12, Roberto Silva for skillful technical assistance and Mrs Barbara Geehan for revising the manuscript. Supported by grants from the Ministero Università e Ricerca Scientifica e Tecnologica (MIUR)-PRIN 2002 and 2003, MIUR L.488/92 C03 and C04, Centro di Eccellenza Geni in campo Biosanitario ed Agroalimentare (CEGBA), Fondazione Telethon-Italy, Fondazione Pierfranco and Luisa Mariani (Ricerca 2000), Ricerca Finalizzata Ministero della Salute RF-2002/158 and RF-2003, and a MitEuro network grant from the European Union Framework Program 5.
| FOOTNOTES |
|---|
* To whom correspondence should be addressed at: Department of Genetics Anthropology Evolution, University of Parma, Parco Area delle Scienze 11/A, 43100 Parma, Italy. Tel: +39 521905600/601; Fax: +39 521905604; Email: iferrero{at}unipr.it
The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors. ![]()
| REFERENCES |
|---|
|
|
|---|
- Zeviani, M., Bonilla, E., De Vivo, D.C. and Di Mauro, S. (1989) Mitochondrial diseases. Neurol. Clin., 7, 123156.[Web of Science][Medline]
-
Bohlega, S., Tanji, K., Santorelli, F.M., Hirano, M., al-Jishi, A. and DiMauro, S. (1996) Multiple mitochondrial DNA deletions associated with autosomal recessive ophthalmoplegia and severe cardiomyopathy. Neurology, 46, 13291334.
[Abstract/Free Full Text] -
Napoli, L., Bordoni, A., Zeviani, M., Hadjigeorgiou, G.M., Sciacco, M., Tiranti, V., Terentiou, A., Moggio, M., Papadimitriou, A., Scarlato, G. et al. (2001) A novel missense adenine nucleotide translocator-1 gene mutation in a Greek adPEO family. Neurology, 57, 22952298.
[Abstract/Free Full Text] - Suomalainen, A., Kaukonen, J., Amati, P., Timonen, R., Haltia, M., Weissenbach, J., Zeviani, M., Somer, H. and Peltonen, L. (1995) An autosomal locus predisposing to deletions of mitochondrial DNA. Nat. Genet., 9, 146151.[CrossRef][Web of Science][Medline]
- Kaukonen, J., Zeviani, M., Comi, G.P., Piscaglia, M.G., Peltonen, L. and Suomalainen, A. (1999) A third locus predisposing to multiple deletions of mtDNA in autosomal dominant progressive external ophthalmoplegia. Am. J. Hum. Genet., 65, 256261.[CrossRef][Web of Science][Medline]
- Van Goethem, G., Dermaut, B., Lofgren, A., Martin, J.J. and Van Broeckhoven, C. (2001) Mutation of POLG is associated with progressive external ophthalmoplegia characterized by mtDNA deletions. Nat. Genet., 28, 211212.[CrossRef][Web of Science][Medline]
-
Kaukonen, J., Juselius, J.K., Tiranti, V., Kyttälä, A., Zeviani, M., Comi, G.P., Keränen, S., Peltonen, L. and Suomalainen, A. (2000) Role of adenine nucleotide translocator 1 in mtDNA maintenance. Science, 289, 782785.
[Abstract/Free Full Text] - Klingenberg, M. (1979) The ADP, ATP shuttle of the mitochondrion. Trends Biochem. Sci., 4, 249252.[CrossRef]
-
Bauer, M.K.A., Schubert, A., Rocks, O. and Grimm, S. (1999) Adenine nucleotide translocase-1, a component of the permeability transition pore, can dominantly induce apoptosis. J. Cell. Biol., 147, 14931502.
[Abstract/Free Full Text] - Komaki, H., Fukazawa, T., Houzen, H., Yoshida, K., Nonaka, I. and Goro, Y. (2002) A novel D104G mutation in the adenine nucleotide translocator 1 gene in autosomal dominant progressive external ophthalmoplegia patients with mitochondrial DNA with multiple delections. Ann. Neurol., 51, 645648.[CrossRef][Web of Science][Medline]
- Siciliano, G., Tessa, A., Petrini, S., Mancuso, M., Bruno, C., Grieco, G.S., Malandrini, A., De Florio, L., Martini, B., Federico, A., Nappi, G., Santorelli, F.M. and Murri, L. (2003) Autosomal dominant external ophthalmoplegia and bipolar affective disorder associated with a mutation in the ANT1 gene. Neuromusc. Disord., 13, 162165.[CrossRef][Web of Science][Medline]
-
Chen, X.J. (2002) Induction of an unregulated channel by mutations in adenine nucleotide translocase suggests an explanation for human ophthalmoplegia. Hum. Mol. Genet., 11, 18351843.
[Abstract/Free Full Text] - De Marcos Lousa, C., Trezeguet, V., Dianoux, A.C., Brandolin, G. and Lauquin, G.J. (2002) The human mitochondrial ADP/ATP carriers: kinetic properties and biogenesis of wild-type and mutant proteins in the yeast S. cerevisiae. Biochemistry, 41, 1441214420.[CrossRef][Medline]
-
Yan, L.J. and Sohal, R.S. (1998) Mitochondrial adenine nucleotide translocase is modified oxidatively during aging. Proc. Natl Acad. Sci. USA, 95, 1289612901.
[Abstract/Free Full Text] -
Esposito, L.A., Melov, S., Panov, A., Cottrell, B.A. and Wallace, D.C. (1999) Mitochondrial disease in mouse results in increased oxidative stress. Proc. Natl Acad. Sci. USA, 96, 48204825.
[Abstract/Free Full Text] -
Adrian, G., McCammon, M., Montgomery, D. and Douglas, M. (1986) Sequences required for delivery and localization of the ADP/ATP translocator to the mitochondrial inner membrane. Mol. Cell. Biol., 6, 626634.
[Abstract/Free Full Text] -
Lawson, J.E. and Douglas, M.G. (1988) Separate genes encode functionally equivalent ADP/ATP carrier proteins in Saccharomyces cerevisiae. J. Biol. Chem., 263, 1481214818.
[Abstract/Free Full Text] -
Kolarov, J., Kolarova, N. and Nelson, N. (1990) A third ADP/ATP translocator gene in yeast. J. Biol. Chem., 265, 1271112716.
[Abstract/Free Full Text] - Drgon, T., Sabova, L., Gavurnikova, G. and Kolarov, J. (1992) Yeast ADP/ATP carrier (AAC) proteins exhibit similar enzymatic properties but their deletion produces different phenotypes. FEBS Lett., 304, 277280.[CrossRef][Web of Science][Medline]
-
Bennetzen, J.L. and Hall, B.D. (1982) Codon selection in yeast J. Biol. Chem., 257, 30263031.
[Abstract/Free Full Text] - Kovácova, V., Irmlerová, J. and Kovác, L. (1968) Oxidative phosphorylation in yeast. IV. Combination of a nuclear mutation affecting oxidative phosphorylation with a cytoplasmic mutation to respiratory deficiency. Biochim. Biophys. Acta, 162, 157162.[Medline]
- Bulder, C.J.E.A. (1964) Lethality of the petite mutation in petite-negative yeasts. Antonie Van Leeuwenhoek, 30, 442454.[CrossRef][Web of Science][Medline]
- Slonimski, P.P., Perrodin, G. and Croft, J.H. (1968) Ethidium bromide induced mutation of yeast mitochondria: Complete transformation of cells into respiratory deficient nonchromosomal petites. Biochem. Biophys. Res. Commun., 30, 232239.[CrossRef][Web of Science][Medline]
- Kramer, R. and Klingenberg, M. (1979) Reconstitution of adenine nucleotide transport from beef heart mitochondria. Biochemistry, 18, 42094215.[CrossRef][Medline]
- Häidkamper, D., Muller, V., Nelson, D.R. and Klingenberg, M. (1996) Probing the role of positive residues in the ADP/ATP carrier from yeast. The effect of six arginine mutations on transport and the four ATP versus ADP exchange modes. Biochemistry, 35, 1614416152.[CrossRef][Medline]
- Muller, V., Basset, G., Nelson, D.R. and Klingenberg, M. (1996). Probing the role of positive residues in the ADP/ATP carrier from yeast. The effect of six arginine mutations of oxidative phosphorylation and AAC expression. Biochemistry, 35, 1613216143.[CrossRef][Medline]
- Chen, Y.S. and Beattie, D.S. (1981) Two forms of cytochrome b in yeast mitochondria: purification, characterization, and localization in the inner mitochondrial membrane. Biochemistry, 20, 75577565.[CrossRef][Medline]
-
Tzagoloff, A. and Dieckmann, C.L. (1990) PET genes of Saccharomyces cerevisiae. Microbiol. Rev., 54, 211225.
[Abstract/Free Full Text] - Scherer, B. and Klingenberg, M. (1974) Demonstration of the relationship between the adenine nucleotide carrier and the structural changes of mitochondria as induced by adenosine 5'-diphosphate. Biochemistry, 13, 161170.[CrossRef][Medline]
- Aprille, J.R. (1988) Regulation of the mitochondrial adenine nucleotide pool size in liver: mechanism and metabolic role. FASEB J., 2, 25472556.[Abstract]
-
Suzuki, T., Murakami, T., Iino, R., Suzuki, J., Ono, S., Shirakihara, Y. and Yoshida, M. (2003) F0F1-ATPase/synthase is geared to the synthesis mode by conformational rearrangement of {
} subunit in response to proton motive force and ADP/ATP balance. J. Biol. Chem., 21, 4684046846. - Dujon, B. (1981) Mitochondrial genetics and functions. In The Molecular Biology of the Yeast Saccharomyces, Life Cycle and Inheritance. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp. 505635.
- Hashimoto, M., Shinohara, Y., Majima, E., Hatanaka, T., Yamazaki, N. and Terada, H. (1999) Expression of the bovine heart mitochondrial ADP/ATP carrier in yeast mitochondria: significantly enhanced expression by replacement of the N-terminal region of the bovine carrier by the corresponding regions of the yeast carriers. Biochim. Biophys. Acta, 1409, 113124.[Medline]
- Sherman, F. (1991) Getting started with yeast. Meth. Enzymol., 194, 321.[CrossRef][Web of Science][Medline]
- Bonneaud, N., Ozier-Kalogeropoulos, O., Li, G.Y., Labouesse, M., Minvielle-Sebastia, L. and Lacroute, F. (1991) A family of low and high copy replicative, integrative and single-stranded S. cerevisiae/E. coli shuttle vectors. Yeast, 7, 609615.[CrossRef][Web of Science][Medline]
-
Ogur, M., St.John, R. and Nagai, S. (1957) Tetrazolium overlay technique for population studies of respiratory deficiency in yeast. Science, 125, 928929.
[Free Full Text] - Ferrero, I., Viola, A.M., and Goffeau, A. (1981) Induction by glucose of an antimycin-insensitive, azide-sensitive respiration in the yeast Kluyveromyces lactis. Antonie Van Leeuwenhoek, 47, 1124.[CrossRef][Web of Science][Medline]
- Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. (1994) Saccharomyces cerevisiae. In Current Protocols in Molecular Biology, Vol. 2, Section 13. Wiley, New York.
- Sherman, F., Fink, G.R. and Hicks, J.B. (1986) Laboratory Course Manual For Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
-
Daum, G., Gasser, S.M. and Schatz, G. (1982) Import of protein into mitochondria. Energy-dependent, two-step processing of the intermembrane space enzyme cytochrome b2 by isolated yeast mitochondria. J. Biol. Chem., 257, 1307513080.
[Abstract/Free Full Text] - Palmieri, F., Indiveri, C., Bisaccia, F. and Iacobazzi, V. (1995) Mitochondrial metabolite carrier proteins: purification, reconstitution, and transport studies. Meth. Enzymol., 260, 349369.[Web of Science][Medline]
- Capobianco, L., Bisaccia, F., Mazzeo, M. and Palmieri, F. (1996). The mitochondrial oxoglutarate carrier: sulfhydryl reagents bind to cysteine-184, and this interaction is enhanced by substrate binding. Biochemistry, 35, 89748980.[CrossRef][Medline]
- Hoffman, C.S. and Winston, F. (1987) A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of Escherichia coli. Gene, 57, 267272.[CrossRef][Web of Science][Medline]
- Defontaine, A., Lecocq, F.M. and Hallet, J.N. (1991) A rapid miniprep method for the preparation of yeast mitochondrial DNA. Nucl. Acids Res., 11, 185.
- Sambrook, J. and Russel, D.W. (2001) Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- Foury, F., Roganti, T., Lecrenier, N. and Purnelle, B. (1998) The complete sequence of the mitochondrial genome of Saccharomyces cerevisiae. FEBS Lett., 440, 325231.[CrossRef][Web of Science][Medline]
-
Ito, H., Fukuda, Y., Murata, K. and Kimura, A. (1983) Transformation of intact yeast cells treated with alkali cations. J. Bacteriol., 153,163168.
[Abstract/Free Full Text] -
Nasmyth, K.A. and Reed, S.I. (1980) Isolation of genes by complementation in yeast: molecular cloning of a cell-cycle gene. Proc. Natl Acad. Sci. USA, 77, 21192123.
[Abstract/Free Full Text] - Zara, V., Dietmeier, K., Palmisano, A., Vozza, A., Rassow, J., Palmieri, F. and Pfanner, N. (1996) Yeast mitochondria lacking the phosphate carrier/p32 are blocked in phosphate transport but can import preproteins after regeneration of a membrane potential. Mol. Cell. Biol., 16, 65246531.[Abstract]
- Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680685.[CrossRef][Medline]
-
Darley-Usmar, V.M, Rickwood, D. and Wilson, M.T. 1987 (eds), Mitochondria, a Practical Approach. IRL Press, Washington, DC.
This article has been cited by other articles:
![]() |
R. El-Khoury and A. Sainsard-Chanet Suppression of Mitochondrial DNA Instability of Autosomal Dominant Forms of Progressive External Ophthalmoplegia-Associated ANT1 Mutations in Podospora anserina Genetics, November 1, 2009; 183(3): 861 - 871. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Goffrini, T. Ercolino, E. Panizza, V. Giache, L. Cavone, A. Chiarugi, V. Dima, I. Ferrero, and M. Mannelli Functional study in a yeast model of a novel succinate dehydrogenase subunit B gene germline missense mutation (C191Y) diagnosed in a patient affected by a glomus tumor Hum. Mol. Genet., May 15, 2009; 18(10): 1860 - 1868. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, K. Salinas, X. Zuo, B. Kucejova, and X. J. Chen Dominant membrane uncoupling by mutant adenine nucleotide translocase in mitochondrial diseases Hum. Mol. Genet., December 15, 2008; 17(24): 4036 - 4044. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Claypool, Y. Oktay, P. Boontheung, J. A. Loo, and C. M. Koehler Cardiolipin defines the interactome of the major ADP/ATP carrier protein of the mitochondrial inner membrane J. Cell Biol., September 9, 2008; 182(5): 937 - 950. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Dienhart and R. A. Stuart The Yeast Aac2 Protein Exists in Physical Association with the Cytochrome bc1-COX Supercomplex and the TIM23 Machinery Mol. Biol. Cell, September 1, 2008; 19(9): 3934 - 3943. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Smith and P. E. Thorsness The Molecular Basis for Relative Physiological Functionality of the ADP/ATP Carrier Isoforms in Saccharomyces cerevisiae Genetics, July 1, 2008; 179(3): 1285 - 1299. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Fernandez-Vizarra, M. Bugiani, P. Goffrini, F. Carrara, L. Farina, E. Procopio, A. Donati, G. Uziel, I. Ferrero, and M. Zeviani Impaired complex III assembly associated with BCS1L gene mutations in isolated mitochondrial encephalopathy Hum. Mol. Genet., May 15, 2007; 16(10): 1241 - 1252. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Baruffini, T. Lodi, C. Dallabona, A. Puglisi, M. Zeviani, and I. Ferrero Genetic and chemical rescue of the Saccharomyces cerevisiae phenotype induced by mitochondrial DNA polymerase mutations associated with progressive external ophthalmoplegia in humans Hum. Mol. Genet., October 1, 2006; 15(19): 2846 - 2855. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Dahout-Gonzalez, H. Nury, V. Trezeguet, G. J.-M. Lauquin, E. Pebay-Peyroula, and G. Brandolin Molecular, Functional, and Pathological Aspects of the Mitochondrial ADP/ATP Carrier. Physiology, August 1, 2006; 21: 242 - 249. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mori, Y. Ishiba, S. Kubota, A. Kobayashi, T. Higashide, M. J. McLaren, and G. Inana Truncation Mutation in HRG4 (UNC119) Leads to Mitochondrial ANT-1-Mediated Photoreceptor Synaptic and Retinal Degeneration by Apoptosis. Invest. Ophthalmol. Vis. Sci., April 1, 2006; 47(4): 1281 - 1292. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Stuart, J. H. Santos, M. K. Strand, B. Van Houten, and W. C. Copeland Mitochondrial and nuclear DNA defects in Saccharomyces cerevisiae with mutations in DNA polymerase {gamma} associated with progressive external ophthalmoplegia Hum. Mol. Genet., January 15, 2006; 15(2): 363 - 374. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Palmieri, S. Alberio, I. Pisano, T. Lodi, M. Meznaric-Petrusa, J. Zidar, A. Santoro, P. Scarcia, F. Fontanesi, E. Lamantea, et al. Complete loss-of-function of the heart/muscle-specific adenine nucleotide translocator is associated with mitochondrial myopathy and cardiomyopathy Hum. Mol. Genet., October 15, 2005; 14(20): 3079 - 3088. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||













