Skip Navigation


Human Molecular Genetics Advance Access originally published online on March 11, 2004
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/9/935    most recent
ddh109v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (112)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Ekstrand, M. I.
Right arrow Articles by Larsson, N.-G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ekstrand, M. I.
Right arrow Articles by Larsson, N.-G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2004, Vol. 13, No. 9 935-944
DOI: 10.1093/hmg/ddh109
Human Molecular Genetics, Vol. 13, No. 9 © Oxford University Press 2004; all rights reserved

Mitochondrial transcription factor A regulates mtDNA copy number in mammals

Mats I. Ekstrand1,2, Maria Falkenberg1, Anja Rantanen1,2, Chan Bae Park1,2, Martina Gaspari1,2, Kjell Hultenby3, Pierre Rustin4, Claes M. Gustafsson1 and Nils-Göran Larsson1,2,*

1Department of Medical Nutrition and 2Department of Biosciences, 3Clinical Research Center, Karolinska Instititutet, Novum, S-141 86 Stockholm, Sweden and 4Unité de Recherches sur les Handicaps Génétiques de l'Enfant, INSERM U393, Hôpital des Enfants-Malades, Paris, France

Received January 28, 2004; Accepted March 2, 2004


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Mitochondrial DNA (mtDNA) copy number regulation is altered in several human mtDNA-mutation diseases and it is also important in a variety of normal physiological processes. Mitochondrial transcription factor A (TFAM) is essential for human mtDNA transcription and we demonstrate here that it is also a key regulator of mtDNA copy number. We initially performed in vitro transcription studies and determined that the human TFAM protein is a poor activator of mouse mtDNA transcription, despite its high capacity for unspecific DNA binding. Next, we generated P1 artificial chromosome (PAC) transgenic mice ubiquitously expressing human TFAM. The introduced human TFAM gene was regulated in a similar fashion as the endogenous mouse Tfam gene and expression of the human TFAM protein in the mouse did not result in down-regulation of the endogenous expression. The PAC-TFAM mice thus had a net overexpression of TFAM protein and this resulted in a general increase of mtDNA copy number. We used a combination of mice with TFAM overexpression and TFAM knockout and demonstrated that mtDNA copy number is directly proportional to the total TFAM protein levels also in mouse embryos. Interestingly, the expression of human TFAM in the mouse results in up-regulation of mtDNA copy number without increasing respiratory chain capacity or mitochondrial mass. It is thus possible to experimentally dissociate mtDNA copy number regulation from mtDNA expression and mitochondrial biogenesis in mammals in vivo. In conclusion, our results provide genetic evidence for a novel role for TFAM in direct regulation of mtDNA copy number in mammals.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The regulation of mammalian mitochondrial DNA (mtDNA) expression and copy number is poorly understood, despite the profound importance of these processes in human physiology and disease. We have recently made progress in this area by reconstituting the basal human mtDNA transcription machinery in a pure in vitro system (1). A combination of three different nucleus-encoded proteins, i.e. mitochondrial RNA polymerase (POLRMT) (2), mitochondrial transcription factor A (TFAM) (3) and mitochondrial transcription factor B1 or B2 (TFB1M or TFB2M) (1), is sufficient to obtain specific initiation of transcription from linear DNA templates containing the heavy and light strand promoters (HSP and LSP) of human mtDNA. TFAM fulfills the definition of a bona fide transcription factor because it displays sequence-specific binding to HSP and LSP (4) and it activates mtDNA transcription in a concentration-dependent manner in vitro (1,4). In addition, import of recombinant TFAM into isolated rat liver mitochondria stimulates in organello transcription of mtDNA (5).

Mammalian TFAM proteins have a molecular weight of ~25 kDa and consist of an amino-terminal HMG domain, a basic linker region, a second HMG domain and a basic carboxy-terminal tail (3,6). The TFAM protein is synthesized as a precursor form with a mitochondrial targeting peptide, which is removed by processing after import to mitochondria (3). Biochemical characterization of human TFAM has demonstrated that it can efficiently bind, unwind and bend DNA without sequence specificity, similar to other proteins of the HMG domain family (7). The yield of TFAM from biochemical purification procedures was used to estimate that there is a minimum of ~1 TFAM molecule per 1000 bp of mtDNA in human tissue culture cells (8). This estimate has been questioned by others who have reported a molar ratio of ~1 TFAM molecule per 10 bp of mtDNA (9,10). This very high molar ratio suggests that TFAM may fully coat mtDNA in mammalian cells (9,10), similar to the situation in budding yeast (11,12) and chicken cell lines (13). Biochemical fractionation and immunocytochemistry experiments have provided support for the idea that human TFAM is tightly associated with mtDNA and is involved in packaging mtDNA into protein–DNA aggregates referred to as nucleoids (10,14).

We have previously disrupted the Tfam gene in the mouse germ line and demonstrated that heterozygous knockouts (Tfam+/–) have ~35–40% reduction in mtDNA copy number, whereas homozygous knockouts (Tfam–/–) die in mid-gestation due to lack of mtDNA and severe respiratory chain deficiency (15). We have also exploited the conditional knockout system (cre–loxP) to disrupt Tfam in a variety of cell types in the mouse, e.g. cardiomyocytes (16,17), skeletal muscle cells (18), pancreatic ß-cells (19) and pyramidal neurons (20). In all of these cases, tissue-specific depletion of TFAM protein leads to depletion of mtDNA, depletion of mitochondrial transcripts (mtRNA) and severe respiratory chain deficiency (1620). These mouse knockout studies have thus led to the conclusion that TFAM is necessary for mtDNA maintenance in vivo. However, it has been unclear if TFAM regulates mtDNA copy number, because it can be anticipated that loss of any critical component of the mtDNA maintenance machinery will result in loss of mtDNA. We have now addressed this issue by creating transgenic mice containing large fragments of genomic DNA harboring the complete human TFAM gene. We chose to express the human TFAM protein in the mouse because it poorly activates transcription from mouse HSP and LSP in vitro despite its strong DNA binding activity. We have utilized a combination of mice with overexpression of TFAM and knockout mice with reduced TFAM expression to demonstrate that mtDNA copy number is directly proportional to the total TFAM protein levels in a variety of differentiated mouse tissues and in embryos. Our results also show that it is possible to dissociate mtDNA copy number control from mtDNA expression as the transgenic mice have increased mtDNA copy number without any increase in mitochondrial mass or respiratory chain capacity. These findings demonstrate that the TFAM protein is a key factor involved in directly regulating mtDNA copy number in mammals.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The human TFAM protein is a poor activator of mouse mtDNA transcription in vitro despite its highly non-specific DNA binding activity
We developed a pure in vitro transcription system for mouse mtDNA by expressing histidine-tagged versions of mouse POLRMT, TFB2M and TFAM in the baculovirus system. The proteins were purified to homogeneity and were >95% pure as determined by Coomassie staining of SDS–polyacrylamide gels. Similar to the human system, a combination of mouse POLRMT, TFB2M and TFAM was required for specific initiation of transcription from linear mouse mtDNA templates containing LSP and HSP (Fig. 1A). However, we obtained much lower transcription activation in the mouse in vitro transcription system when we used equal molar amounts of human TFAM instead of mouse TFAM (Fig. 1A). We also found that the addition of increasing amounts of human TFAM in the presence of mouse TFAM only had a mild stimulatory effect on transcription from LSP (Fig. 1B) and HSP (Fig. 1C) in vitro. Next, we mixed recombinant human and mouse TFAM with plasmid DNA and found that both proteins had a similar high DNA binding capacity (Fig. 1D). We also performed footprint analyses and found that the human TFAM protein, in contrast to the mouse TFAM protein, did not specifically bind mouse LSP (data not shown). In summary, our results show that human TFAM is a poor activator of mouse mtDNA transcription in vitro, despite its high capacity for non-specific interaction with mtDNA. These features make it attractive to express human TFAM in the mouse to determine whether its non-specific DNA binding activity is involved in mtDNA maintenance in vivo.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 1. Characterization of transcription activation and DNA binding activities of human TFAM. (A) Templates containing the light and heavy strand promoters (LSP and HSP; 85 fmol) of mouse mtDNA were used for in vitro run-off transcription assays. The reactions were performed with the following pure recombinant proteins: mouse POLRMT (300 fmol), mouse TFB2M (300 fmol) and mouse TFAM (mTFAM) or human TFAM (hTFAM) in increasing amounts (0.025, 0.1, 0.25, 1.0, 2.5, 10 and 25 pmol). (B) In vitro transcription from a mouse LSP template (85 fmol) with mouse POLRMT (300 pmol), mouse TFB2M (300 pmol) and increasing amounts of hTFAM (0.1, 1.0, 2.5 and 10 pmol) in the absence or presence (0.1 pmol) of mTFAM. (C) In vitro transcription from a mouse HSP template (85 fmol) with mouse POLRMT (300 pmol), mouse TFB2M (300 pmol) and increasing amounts of hTFAM (0.1, 1.0, 2.5 and 10 pmol) in the absence or presence (0.25 pmol) of mTFAM. (D) Gel retardation assays to assess unspecific DNA binding capacity of mouse and hTFAM. An end-labeled pUC18 fragment (10 fmol) was incubated with increasing amounts of mTFAM or hTFAM protein (0.1, 0.25, 1.0, 2.5, 10 and 25 pmol).

 
Generation of transgenic mice containing large genomic fragments harboring the human TFAM gene
We used the human TFAM cDNA to screen a human genomic P1 artificial chromosome (PAC) library and identified 33 positive clones. We used PCR analysis and found that 14 of these clones contained both the first and last exons of the TFAM gene. The size of the insert in these clones was determined by pulsed-field gel electrophoresis. We used vectorette (bubble) PCR to clone the end-fragments from five clones and used these fragments as probes for Southern blot analyses of DNA from the 14 PAC clones. These results allowed us to construct a contig of overlapping PAC clones each containing the human TFAM gene. We selected three clones with different flanking sequences (PAC2, PAC9 and PAC19; Fig. 2A) to make transgenic mice by the pronuclear injection technique. Transgenic founders from all three PAC clones were identified by Southern blot analysis of tail DNA. A probe for the human TFAM gene demonstrated that the transgenic mice contained the same genomic fragments as those found in human DNA (Fig. 2B). We determined that the PAC2 transgenic line had the lowest human TFAM gene copy number by comparing the hybridization signal from the human TFAM cDNA probe with a loading control consisting of a mouse 18S rRNA gene probe (Fig. 2B).



View larger version (72K):
[in this window]
[in a new window]
 
Figure 2. Generation of P1 artificial chromosome (PAC) transgenic mice expressing human TFAM. (A) Contig of the three PAC clones used to create mice expressing human TFAM. The human TFAM gene region encompasses the gray box. The length of the clones is ~170 (PAC2), 120 (PAC9) and 170 kb (PAC19). (B) Southern blot analysis of EcoRI-digested DNA from PAC2, PAC9 and PAC19 transgenic mice, wild-type (wt) mice and human blood. Arrows indicate DNA fragments specific for the human TFAM gene. The blot was re-hybridized with a probe for the mouse nuclear 18S rRNA gene to assess loading.

 
PAC transgenic mice have ubiquitous net overexpression of TFAM
We performed western blot analyses of total tissue protein extracts from wild-type and PAC transgenic mice by using polyclonal antibodies against mouse and human TFAM. The human TFAM protein was ubiquitously expressed in the PAC transgenic mice (Fig. 3A). We quantified the levels of human and mouse TFAM protein in relation to total protein content in heart, kidney and skeletal muscle of PAC2, PAC9, PAC19 and wild-type mice (Fig. 3B). Both the human and mouse TFAM proteins had rather similar patterns of expression with high levels in heart and kidney and low levels in skeletal muscle (Fig. 3B). This suggest that the regulatory sequences of the human TFAM gene are functional in the mouse and generate an expression pattern similar to the pattern observed for the endogenous mouse Tfam gene. We also isolated mitochondria from heart, kidney and skeletal muscle from PAC19 mice and found that the levels of human and mouse TFAM protein were ~2–4 ng per µg of total mitochondrial protein (Fig. 3C and data not shown), which corresponds to ~50–100% increase of total TFAM protein levels. We found that the levels of the mouse TFAM protein levels were very similar in mitochondria from wild-type and PAC19 mice, which demonstrates that the expression of the human TFAM protein does not affect the expression of the endogenous mouse TFAM gene (Fig. 3C). We performed additional experiments to calculate the ratio of TFAM protein to mtDNA in isolated kidney mitochondria by using western and Southern blot analyses together with recombinant TFAM protein and plasmid DNA standards (data not shown). We found a molar ratio of total TFAM protein to mtDNA of ~977±454 (mean±standard deviation of the mean) in wild-type mice and 938±272 in PAC19 mice. Our data thus show both wild-type and transgenic mice have a fairly constant ratio of one TFAM molecule per ~15–20 bp of mtDNA, which is in good agreement with previous estimates (9,10).



View larger version (42K):
[in this window]
[in a new window]
 
Figure 3. Expression of mouse and human TFAM protein in transgenic mice. (A) Western blot analysis to determine the expression of human TFAM protein (hTFAM) and mouse TFAM protein (mTFAM) in various tissues from PAC19 transgenic and wt mice. The lower molecular weight band visible in skeletal muscle protein extracts is due to antibody cross reactivity with an extra-mitochondrial skeletal muscle-specific protein. (B) Western blot analysis of hTFAM and mTFAM levels in total protein extracts from heart, kidney and skeletal muscle of PAC2, PAC9, PAC19 and wt mice. (C) Western blot analysis of protein extracts from total kidney (T) or kidney mitochondria (M) to determine the levels of hTFAM, mTFAM and cytochrome c oxidase subunit II protein (COXII) in PAC19 and wt animals. The levels of hTFAM protein were determined by comparison with a standard of known amounts (10–80 ng) of recombinant hTFAM.

 
Mitochondrial DNA copy number is increased in TFAM transgenic animals
We performed Southern blot analyses to assess mtDNA levels in total DNA extracts from heart, kidney and skeletal muscle from wild-type, PAC2, PAC9 and PAC19 animals (Fig. 4A) and found a clear increase of mtDNA levels in all investigated tissues from the transgenic animals (Fig. 4B). The overall increase in mtDNA was ~30–40% in PAC2 and ~40–70% in PAC9 and PAC19 animals (Fig. 4B). The mtDNA copy number could thus be correlated with the copy number of the introduced TFAM gene (Fig. 2B), but not with the presence of specific flanking DNA sequences (Fig. 2A). We searched the Celera database and found no known mitochondrial genes in the 200 kb 3' and 5' flanking regions of human TFAM. These findings demonstrate that the introduced human TFAM gene is responsible for up-regulating mtDNA copy number in the transgenic mice. We also quantified the proportion of displacement loop (D-loop) strands, referred to as 7S DNA, in relation to total mtDNA and found no difference between wild-type and PAC19 mice (Fig. 4C and D). The increased amount of mtDNA in PAC19 mice thus results in an up-regulation of the absolute amount of 7S DNA so that a constant ratio between 7S DNA and mtDNA is maintained.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 4. Levels of mtDNA in transgenic mice. (A) Southern blot quantification of mtDNA levels in total DNA extracts from heart and kidney from PAC2, PAC9, PAC19 and wt animals. The blot was re-hybridized with a probe for the mouse 18S rRNA gene to assess loading. (B) Results from phosphorimager quantification of Southern blot analyses of mtDNA levels in heart, kidney and skeletal muscle from PAC2, PAC9, PAC19 and wt animals. All values are normalized to the nuclear 18S rRNA gene and are presented as percent of the mean levels in wt animals. The bars indicate ±SEM. Results from statistical analyses are indicated as follows *P<0.05; **P<0.01; ***P<0.001. (C) Southern blot analysis to determine the levels of nascent H strands (7S DNA) in PAC19 and wt mice. (D) The results from phosphorimager quantification of 7S DNA levels in relation to total mtDNA in wt and PAC19 mice. The levels are indicated as percent of the mean levels in wt animals. The bars indicate ±SEM. There is no statistically significant difference.

 
Unaltered respiratory chain function and mitochondrial mass despite up-regulation of mtDNA copy number in TFAM transgenic mice
We isolated total RNA from kidney from wild-type, PAC2, PAC9 and PAC19 mice and performed northern blot analysis of steady-state mitochondrial transcript levels (Fig. 5A and data not shown). The NADH dehydrogenase subunit 6 (ND6) transcript encoded on the light (L) strand was increased by ~50–60% in PAC9 and PAC19 animals and remained unchanged in PAC2 animals (Fig. 5B). In contrast, the levels of both cytochrome c oxidase subunit I (COXI) and NADH dehydrogenase subunit 4 (ND4) transcripts encoded on the heavy (H) strand were not changed (Fig. 5B and data not shown). In agreement with this observation we found similar levels of the mtDNA-encoded cytochrome c oxidase subunit II (COXII) protein in kidney mitochondria (Fig. 3C) as well as in heart, kidney and skeletal muscle tissue homogenates (data not shown) from wild-type and PAC19 mice. We assessed respiratory chain function in wild-type, PAC9 and PAC19 mice by measuring the activity of complex IV (cytochrome c oxidase), where the catalytic subunits are encoded by mtDNA, and complex II (succinate dehydrogenase), where all subunits are nucleus encoded. Neither of these two complexes demonstrated any significant changes in activity in transgenic mice in comparison with controls (Fig. 6A). We assessed mitochondrial mass by measuring the citrate synthase activity in PAC9 and PAC19 mice and found no significant differences in comparison with wild-type mice (Fig. 6B). We performed volume density measurements of mitochondria on electron micrographs of heart tissue and found no significant difference between wild-type and PAC19 animals (Fig. 6C). The mitochondrial morphology also appeared normal (Fig. 6C). It can thus be concluded that expression of human TFAM in the mouse does not increase overall mtDNA expression, respiratory chain function or mitochondrial mass.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 5. Levels of mtDNA transcripts in transgenic mice. (A) Northern blot analyses of the mtDNA encoded ND6 and COXI transcript levels in total RNA extracts of kidney from PAC9 and wt animals. The blots were re-hybridized with a probe for the nucleus-encoded 18S rRNA mouse transcript to assess loading. (B) Results from phosphorimager quantification of ND6 and COXI mRNA levels in kidney from PAC2, PAC9, PAC19 and wt animals. All values are normalized to 18S rRNA gene transcript levels and are presented as percent of the mean levels in wt animals. The bars indicate ±SEM. Results from statistical analyses are indicated as follows *P<0.05; **P<0.01.

 


View larger version (76K):
[in this window]
[in a new window]
 
Figure 6. Respiratory chain function and mitochondrial mass in transgenic mice. (A) Respiratory chain enzyme activities of complex II (succinate dehydrogenase) and complex IV (cytochrome c oxidase) in heart, kidney and skeletal muscle of wt, PAC9 and PAC19 animals. All values are indicated as percent of the mean activity in wt animals. The bars indicate ±SEM. (B) Measurements of citrate synthase activity, a marker of mitochondrial mass, in heart and skeletal muscle samples from wt, PAC9 and PAC19 animals. (C) Electron micrographs of heart tissue from wt and PAC19 animals (bar=1 µm). Values indicate mean±SD mitochondrial volume density in heart muscle. There is no statistically significant difference.

 
The human TFAM gene does not rescue Tfam knockout mouse embryos
We performed mouse crosses to investigate whether the human TFAM gene could rescue the embryonic lethality encountered in homozygous Tfam knockout embryos. We crossed heterozygous Tfam knockout mice (Tfam+/–) with mice that were heterozygous for both the Tfam knockout and the PAC–TFAM transgene (Tfam+/–, PAC-TFAM). This cross should theoretically result in 12.5% animals that are homozygous for the Tfam knockout and heterozygous for the PAC-TFAM transgene (Tfam–/–, PAC-TFAM). However, no pups with the Tfam–/–, PAC-TFAM genotype were born when we performed this cross with PAC2 (n=38 pups born and genotyped), PAC9 (n=68) or PAC19 mice (n=78), whereas all of the other expected genotypes (except the Tfam–/– genotype known to be embryonic lethal) were recovered at expected Mendelian frequencies (data not shown). In contrast, we recovered Tfam–/–, PAC-TFAM embryos at the expected frequency when we collected E8.5–E9.5 embryos from the same mating. These embryos had a gross morphological appearance that was very similar to the previously described mutant phenotype of E8.5 Tfam–/– embryos. We performed Southern blot analysis of individual E8.5–E9.5 embryos of different genotypes (Fig. 7A) and found a clear correlation between mtDNA copy number and Tfam/TFAM gene dosage. Surprisingly, the Tfam–/–, PAC-TFAM embryos contained ~30% of wild-type mtDNA levels (Fig. 7A and B), but were nevertheless not able to survive embryonic development. We analyzed mitochondrial transcripts and found low levels of the ND6 transcript and very low levels of the COXI transcript in Tfam–/–, PAC-TFAM embryos (Fig. 7C). We also performed western blots to confirm that the human and mouse TFAM proteins were expressed as expected in embryos of different genotypes (Fig. 7D). In summary, Tfam–/–, PAC-TFAM E8.5–E9.5 embryos contain mtDNA but it is poorly transcribed and can therefore not rescue the embryonic lethality.



View larger version (47K):
[in this window]
[in a new window]
 
Figure 7. Levels of mtDNA and mtDNA expression in E8.5–E9.5 mouse embryos. (A) Southern blot quantification of mtDNA levels in embryos of different genotypes. The blot was re-hybridized with a probe for the nuclear 18S rRNA gene to assess loading. (B) Results from phosphorimager quantification of Southern blot analyses of mtDNA levels in mouse embryos. All values are normalized to the nuclear 18S rRNA gene and are presented as percentage of the mean levels in wild-type (Tfam+/+) embryos. The bars indicate ±SEM. (C) Northern blot analyses of the mtDNA-encoded ND6 and COXI transcript levels in total RNA extracts from embryos of different genotypes. The blots were re-hybridized with a probe for the nucleus-encoded 18S rRNA gene transcript to assess loading. (D) Western blot analysis to determine mouse and human TFAM protein levels in total protein extracts from E8.5 embryos of different genotypes. Loading was normalized to levels of ß-actin protein.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
TFAM regulates mtDNA levels in mammals
We have demonstrated that mtDNA copy number regulation in vivo is directly dependent on the TFAM protein levels in a variety of differentiated mouse tissues and in mouse embryos. The transcriptional coactivator PGC1 acts upstream of TFAM and has the capacity to increase cellular mtDNA levels as well as mitochondrial mass in tissue-culture cells and in transgenic mice (2123). The expression of human TFAM is also dependent on the nuclear respiratory factors 1 and 2 (NRF1 and NRF2) (24). PGC1 has the dual action to stimulate induction of NRF1 and NRF2 expression and to coactivate the transcriptional function of NRF1 (22). It was previously thought that the induction of TFAM expression mainly would stimulate mtDNA transcription (24). However, our data show that the TFAM protein levels directly regulate mtDNA copy number in vivo. We utilized the finding that the human TFAM protein poorly activates transcription from mouse LSP and HSP in vitro despite its high non-specific DNA binding capacity, and found that expression of human TFAM in the mouse increases mtDNA copy number without altering respiratory chain capacity or mitochondrial mass. It is thus possible to experimentally dissociate mtDNA copy number regulation from regulation of oxidative phosphorylation capacity.

No feedback regulation of TFAM expression by mtDNA
The human and mouse TFAM protein was expressed at similar relative levels in different mouse tissues, indicating that important regulatory regions are conserved between the human TFAM gene and the mouse Tfam gene. The transgenic mice expressing human TFAM protein had ~40–70% increase of mtDNA copy number, but this did not result in down-regulation of the expression of the endogenous mouse TFAM protein. It can thus be concluded that the mtDNA copy number per se does not affect Tfam gene expression. Previous studies have shown that human cells lacking mtDNA ({rho}0 cells) express TFAM mRNA but lack TFAM protein (25). It is thus likely that the interaction between TFAM and mtDNA is dynamic and that the presence of one component increases the stability of the other component. This dynamic interaction is probably beneficial from a regulatory point of view because small changes in TFAM protein levels or mtDNA levels result in rapid adjustment to maintain a constant optimal ratio between TFAM and mtDNA.

TFAM may provide a scaffold for nucleoid formation
TFAM is abundant in mammalian mitochondria and our measurements demonstrate a molar ratio of TFAM to mtDNA of ~900–1000 : 1, which is in good agreement with other estimates (9,10). It is thus likely that mammalian mtDNA, similar to yeast (11,12) and vertebrate (26) mtDNA, is fully covered with TFAM protein. The most straightforward interpretation of our findings is therefore that TFAM increases mtDNA copy number by directly binding and stabilizing mtDNA. There are several reports presenting biochemical evidence that TFAM together with other proteins, e.g. mitochondrial single-strand DNA binding protein, the adenine nucleotide translocator 1, the lipoyl-containing E2 subunits of pyruvate dehydrogenase, branched chain {alpha}-ketoacid dehydrogenase and prohibitin 2, directly interacts with mtDNA to form nucleoids (9,10,14,27). Here we have shown that increased expression of the TFAM protein is sufficient to increase steady-state levels of mtDNA, which suggests that the TFAM protein is the limiting factor of the mtDNA-stabilizing protein scaffold constituting the nucleoid.

TFAM may also have a direct role in activating mtDNA replication
It is also possible that TFAM, in addition to the DNA packaging function, has a direct role in replicating mtDNA according to the strand-asymmetric model of mtDNA replication (4). This model is supported by biochemical evidence showing that an RNA primer synthesized by transcription from LSP is required for initiation of mtDNA replication at OH (4). A role for TFAM in mtDNA replication is further supported by the observation that import of TFAM into isolated mitochondria stimulates the synthesis of nascent DNA strands initiated at OH (28). However, this strand-asymmetric model has been questioned because two-dimensional agarose gel electrophoresis analyses indicate that a strand-coupled mode of mtDNA replication dominate in mammalian mitochondria (29,30). Recent data have even questioned the role of OH as a distinct initiation site for mtDNA replication (31). The different replication models are not easy to reconcile and there is currently an intense ongoing debate about mechanisms for mammalian mtDNA replication (3234). We found a correlation between increased levels of mtDNA and increased levels of the ND6 transcripts encoded on the L strand in the transgenic animals. In addition, the absolute levels of nascent H strands (D-loops) were increased in PAC transgenic mice so that a constant ratio of nascent H strands to mtDNA was maintained even though mtDNA copy number was increased. We will further address the important question of mtDNA replication mechanisms by reconstituting the mtDNA replication machinery in vitro to determine whether the replication can be coupled to transcription initiation. Characterization of the involved enzymes will also clarify if they can perform strand-coupled DNA replication. In addition, we will disrupt mouse genes encoding different components of the basal mtDNA transcription machinery to determine whether mtDNA can be maintained in the absence of mitochondrial transcription from LSP.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cloning, expression and purification of recombinant proteins
PCR amplification of cDNA templates was used to generate DNA fragments encoding mouse POLRMT, TFAM and TFB2M and these fragments were cloned into the vector pBacPAK9 (Clontech). In addition, pBacPAK9 plasmids encoding POLRMT with a 10xHis-tag at the N-terminus, TFAM with a 6xHis-tag at the C-terminus and TFB2M with a 6xHis-tag at the C-terminus were generated. The constructs for expressing human TFAM were as previously described (1). The plasmid constructs were used to generate Autographa californica nuclear polyhedrosis recombinant viruses as described in the BacPAK manual (Clontech). The recombinant proteins were expressed in Spodoptera frugiperda (Sf9) cells and whole cell protein extracts were generated as described (1). Mouse POLRMT, TFB2M and TFAM proteins were purified following the previously published protocols for the corresponding human proteins (1).

In vitro transcription
DNA fragments containing LSP and HSP, corresponding to nucleotides 15942–16260 and 16206–16341 of the mouse mtDNA sequence (35) were cloned into the pCR4 vector with the TOPO cloning kit (Invitrogen). The pCR4–LSP and pCR4–HSP plasmids were linearized with the PstI restriction endonuclease and used as templates for run-off transcription assays under the same conditions as previously described (1). Individual reaction mixtures (25 µl) contained 85 fmol of linearized DNA template, 10 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 1 mM DTT, 100 µg/ml bovine serum albumin, 400 µM ATP, 150 µM CTP and GTP, 10 µM UTP, 0.2 µM [{alpha}-32P] UTP (3000 Ci/mmol), 4 U of RNasin (APBiotech), 300 fmol POLRMT protein and 300 fmol TFB2M protein and varying concentrations (0.025–25 pmol) of human and mouse TFAM proteins.

Gel retardation
A DNA fragment of 584 bp was isolated by SspI–HindIII restriction enzyme digestion of the pUC18 plasmid and end-labeled at the HindIII site using [{alpha}-32P]-dCTP (3000 Ci/mmol). The radioactively labeled DNA fragment (10 fmol) was incubated with increasing concentrations (0.1–25 pmol) of mouse or human TFAM proteins. The individual reaction mixtures (15 µl) contained 10 mM Tris–HCl (pH 8.0), 10 mM MgCl2, 1 mM DTT, 100 µg/ml bovine serum albumin, 400 µM ATP and 10% glycerol. Reactions were incubated for 15 min at room temperature and subsequently analyzed by electrophoresis in 1% agarose gel with 1xTBE at 100 V for 90 min. The dried gels were used for autoradiography of films in cassettes with an intensifying screen.

Generation, genotyping and breeding of PAC transgenic mice
A human genomic PAC-library (RPCI) was screened with a human TFAM cDNA probe. A total of 33 positive clones were identified and 14 of these clones contained both the first and last exons of the human TFAM gene as determined by PCR analysis. PAC DNA from these 14 clones was prepared with CsCl2-gradient centrifugation. Vectorette PCR was used to clone the end-fragments of five of the 14 PAC clones thus generating 10 different end-fragments. The end fragments were radioactively labeled with [{alpha}-32P]-dCTP with the random-labeling method and used to probe Southern blots containing EcoRI-digested PAC DNA from the 14 clones. Insert sizes of the clones were determined with pulsed-field gel electrophoresis. These data were used to create a physical map of the extension of the 14 overlapping clones. Three clones with different flanking sequences (RPCI 1-107B19, RPCI 1-51I14 and RPCI 4-766J17), designated PAC2, PAC9 and PAC19, were chosen for pro-nuclear injection of FVB/N embryos. Founder mice were identified with Southern blot analysis of EcoRI-digested tail DNA probed with a [{alpha}-32P]-dCTP-labeled human TFAM cDNA probe. Germ line transmission was established from the founder mice and the offspring was kept as heterozygous stocks by breeding to wild-type FVB/N mice. A PCR assay was developed for rapid genotyping of transgenic mice by utilizing oligonucleotide primers (TFAM7A, CAAATTGTAGAAGCCACGGGTGT, and TFAM7B, GGCCATAGTTGGCTGTCTCTTA) specifically amplifying exon 7 of human TFAM.

Southern blot analyses
DNA was prepared by SDS and proteinase K treatment as previously described (16). The DNA was purified by phenol : chloroform extraction, precipitated with ethanol and dissolved in TE pH 8.0. Total DNA (2 µg) from heart, kidney and skeletal muscle of adult mice (>10 weeks of age) and from whole E8.5–E9.5 embryos was digested overnight with the PstI restriction enzyme, precipitated with 0.2 M NaCl and ethanol and separated on 0.8% agarose gels. Kidney mitochondrial DNA was heated to 95°C for 10 min to dissociate the 7S DNA and separated on a 1% agarose gel. Separated DNA was transferred to nitrocellulose membranes by Southern blotting. The membranes were probed with [{alpha}-32P]-dCTP random-labeled COXI or 7S DNA probes. Phosphorimager analyses were used to assess total mtDNA levels normalized to the nuclear 18S rRNA gene and 7S DNA levels normalized to total mtDNA.

Biochemical measurement of respiratory chain enzyme activities
The activities of the respiratory chain complexes as well as citrate synthase were measured in frozen samples of heart, kidney and skeletal muscle from transgenic and control adult mice as described previously (36).

Isolation of mitochondria
Kidneys were collected from adult mice and crude mitochondrial preparations were performed as described (37). Briefly, two kidneys were homogenized in 6 ml buffer (0.32 M sucrose, 1 mM EDTA, 10 mM Tris–HCl, pH 7.4) using a teflon pestle homogenizer. Debris was pelleted for 5 min at 1000g and supernatants were collected and centrifuged for 2 min at 13 000 rpm in Eppendorf tubes. Mitochondrial pellets were washed three times in fresh homogenization buffer and resuspended in 20% sucrose–TE buffer. Samples were loaded on a 1.5/1.0 M sucrose gradient and centrifuged for 20 min at 22 000 rpm using a SW28 rotor.

Isolation of proteins and western blot analyses
Tissue homogenates, mitochondrial preparations and E8.5 embryos were suspended in protein buffer [equal parts of suspension buffer (0.1 M NaCl, 0.01 M Tris–HCl, pH 7.6, 0.001 M EDTA, pH 8.0, 1{per thousand} Aprotinin, 1% PMSF) and loading buffer (0.1 M Tris–HCl pH 6.8, 4% SDS, 20% glycerol, 200 mM DTT)]. Each sample was boiled for 10 min, sonicated and the supernatants containing the proteins were collected after centrifugation for 10 min at 10 000g. Western blot analyses to determine protein levels of mouse and human TFAM, mouse COXII and mouse ß-actin were performed as described (15). We quantified human TFAM protein levels by using a polyclonal antiserum against human TFAM and a standard of recombinant human TFAM protein. We quantified mouse TFAM protein levels by using a polyclonal antiserum against mouse TFAM and a standard of recombinant mouse TFAM protein.

Northern blot analysis
RNA from kidney of adult animals was isolated with the Trizol Reagent (GIBCO/BRL, Life Technology). RNA from whole embryos was isolated with the RNeasy mini kit (Qiagen). An antisense RNA probe was used to detect ND6 transcripts. Briefly, a DNA fragment corresponding to ND6 (~0.5 kb) was generated by PCR and cloned into the pCR2.1-TOPO plasmid. The recombinant plasmid was linearized with the restriction enzyme SpeI and used as a template for in vitro transcription by T7 RNA polymerase to generate the corresponding RNA probe. Double-stranded DNA fragments corresponding to COXI (~0.8 kb) and ND4 (~0.8 kb) were randomly labeled with [{alpha}-32P]-dCTP and used as probes to detect the transcripts. Phosphorimager analyses of northern blots were used to assess levels of mitochondrial transcripts in comparison with the nuclear 18S rRNA levels as described previously (20).

Transmission electron microscopy (TEM)
Wild-type (n=4) and PAC19 (n=4) animals were killed by carbon dioxide and the hearts were dissected. Small pieces of myocardium from the left ventricle were fixed in 2% glutaraldehyde +0.5% paraformaldehyde in 0.1 M sodiumcacodylate buffer containing 0.1 M sucrose and 3 mM CaCl2, pH 7.4, at room temperature for 30 min followed by 24 h at 4°C. Specimens were rinsed in 0.15 M sodiumcacodylate buffer containing 3 mM CaCl2 pH 7.4 post-fixed in 2% osmiumtetroxide in 0.07 M sodiumcacodylate buffer containing 1.5 mM CaCl2 pH 7.4 at 4°C for 2 h, dehydrated in ethanol followed by acetone and embedded in LX-112 (Ladd, Burlington, Vermont, USA) (38). Ultrathin sections (~40–50 nm) from longitudinal parts were cut and contrasted with uranyl acetate followed by lead citrate and examined in a Tecnai 10 transmission electron microscope (Fei company, Eindhoven, The Netherlands) at 80 kV.

Volume density measurements
Digital pictures at a final magnification of 6200x were randomly taken on myofibrils from longitudinal sections of the myocardium. Printed digital pictures were used and the volume density (Vv) of mitochondria was calculated using point counting using a 2 cm square lattice as described (39). A pilot study was performed to determine the number of blocks and pictures needed for an appropriate sample using cumulative mean plot for evaluation (39). Thus, two different blocks from one animal were sectioned and 10 randomly selected pictures were collected from each block. The point counting was done twice and the mean value from each picture was used.

Statistical analyses
Two-sided unpaired t-tests were used to assess statistical significance.


    ACKNOWLEDGEMENTS
 
We thank Greg Barsh, Stanford University for helpful discussions. N.-G.L. is supported by the Swedish Research Council, Funds of Karolinska Institutet, Torsten and Ragnar Söderbergs stiftelse, the Göran Gustafsson Foundation for Research in Natural Sciences and Medicine, the Swedish Heart and Lung Foundation and the Swedish Foundation for Strategic Research (Functional Genomics and INGVAR).


    FOOTNOTES
 
* To whom correspondence should be addressed. Tel: +46 858583724; Fax: +46 87795383; Email: nils-goran.larsson{at}mednut.ki.se


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Falkenberg, M., Gaspari, M., Rantanen, A., Trifunovic, A., Larsson, N.G. and Gustafsson, C.M. (2002) Mitochondrial transcription factors B1 and B2 activate transcription of human mtDNA. Nat. Genet., 31, 289–294.[CrossRef][Web of Science][Medline]

  2. Tiranti, V., Savoia, A., Forti, F., D'Apolito, M.F., Centra, M., Rocchi, M. and Zeviani, M. (1997) Identification of the gene encoding the human mitochondrial RNA polymerase (h-mtRPOL) by cyberscreening of the Expressed Sequence Tags database. Hum. Mol. Genet., 6, 615–625.[Abstract/Free Full Text]

  3. Parisi, M.A. and Clayton, D.A. (1991) Similarity of human mitochondrial transcription factor 1 to high mobility group proteins. Science, 252, 965–969.[Abstract/Free Full Text]

  4. Clayton, D.A. (1991) Replication and transcription of vertebrate mitochondrial DNA. A. Rev. Cell Biol., 7, 453–478.

  5. Garstka, H.L., Schmitt, W.E., Schultz, J., Sogl, B., Silakowski, B., Perez-Martos, A., Montoya, J. and Wiesner, R.J. (2003) Import of mitochondrial transcription factor A (TFAM) into rat liver mitochondria stimulates transcription of mitochondrial DNA. Nucl. Acids Res., 31, 5039–5047.[Abstract/Free Full Text]

  6. Rantanen, A., Jansson, M., Oldfors, A. and Larsson, N.G. (2001) Downregulation of Tfam and mtDNA copy number during mammalian spermatogenesis. Mamm. Genome, 12, 787–792.[CrossRef][Web of Science][Medline]

  7. Fisher, R.P., Lisowsky, T., Parisi, M.A. and Clayton, D.A. (1992) DNA wrapping and bending by a mitochondrial high mobility group-like transcriptional activator protein. J. Biol. Chem., 267, 3358–3367.[Abstract/Free Full Text]

  8. Fisher, R.P., Lisowsky, T., Breen, G.A.M. and Clayton, D.A. (1991) A rapid, efficient method for purifying DNA-binding proteins. J. Biol. Chem., 266, 9153–9160.[Abstract/Free Full Text]

  9. Takamatsu, C., Umeda, S., Ohsato, T., Ohno, T., Abe, Y., Fukuoh, A., Shinagawa, H., Hamasaki, N. and Kang, D. (2002) Regulation of mitochondrial D-loops by transcription factor A and single-stranded DNA-binding protein. EMBO Rep., 3, 451–456.[CrossRef][Web of Science][Medline]

  10. Alam, T.I., Kanki, T., Muta, T., Ukaji, K., Abe, Y., Nakayama, H., Takio, K., Hamasaki, N. and Kang, D. (2003) Human mitochondrial DNA is packaged with TFAM. Nucl. Acids Res., 31, 1640–1645.[Abstract/Free Full Text]

  11. Diffley, J.F.X. and Stillman, B. (1992) DNA binding properties of an HMG1-related protein from yeast mitochondria. J. Biol. Chem., 267, 3368–3374.[Abstract/Free Full Text]

  12. Parisi, M.A., Xu, B. and Clayton, D.A. (1993) A human mitochondrial transcriptional activator can functionally replace a yeast mitochondrial HMG-box protein both in vivo and in vitro. Mol. Cell. Biol., 13, 1951–1961.[Abstract/Free Full Text]

  13. Matsushima, Y., Matsumura, K., Ishii, S., Inagaki, H., Suzuki, T., Matsuda, Y., Beck, K. and Kitagawa, Y. (2003) Functional domains of chicken mitochondrial transcription factor A (c-TFAM) for the maintenance of mitochondrial DNA copy number in lymphoma cell line DT40. J. Biol. Chem., 278, 31149–31158.[Abstract/Free Full Text]

  14. Garrido, N., Griparic, L., Jokitalo, E., Wartiovaara, J., van der Bliek, A.M. and Spelbrink, J.N. (2003) Composition and dynamics of human mitochondrial nucleoids. Mol. Biol. Cell., 14, 1583–1596.[Abstract/Free Full Text]

  15. Larsson, N.G., Wang, J., Wilhelmsson, H., Oldfors, A., Rustin, P., Lewandoski, M., Barsh, G.S. and Clayton, D.A. (1998) Mitochondrial transcription factor A is necessary for mtDNA maintenance and embryogenesis in mice. Nat. Genet., 18, 231–236.[CrossRef][Web of Science][Medline]

  16. Wang, J., Wilhelmsson, H., Graff, C., Li, H., Oldfors, A., Rustin, P., Brüning, J.C., Kahn, C.R., Clayton, D.A., Barsh, G.S. et al. (1999) Dilated cardiomyopathy and atrioventricular conduction blocks induced by heart-specific inactivation of mitochondrial DNA gene expression. Nat. Genet., 21, 133–137.[CrossRef][Web of Science][Medline]

  17. Li, H., Wang, J., Wilhelmsson, H., Hansson, A., Thoren, P., Duffy, J., Rustin, P. and Larsson, N.G. (2000) Genetic modification of survival in tissue-specific knockout mice with mitochondrial cardiomyopathy. Proc. Natl Acad. Sci. USA, 97, 3467–3472.[Abstract/Free Full Text]

  18. Wredenberg, A., Wibom, R., Wilhelmsson, H., Graff, C., Wiener, H.H., Burden, S.J., Oldfors, A., Westerblad, H. and Larsson, N.G. (2002) Increased mitochondrial mass in mitochondrial myopathy mice. Proc. Natl Acad. Sci. USA, 99, 15066–15071.[Abstract/Free Full Text]

  19. Silva, J.P., Kohler, M., Graff, C., Oldfors, A., Magnuson, M.A., Berggren, P.O. and Larsson, N.G. (2000) Impaired insulin secretion and beta-cell loss in tissue-specific knockout mice with mitochondrial diabetes. Nat. Genet., 26, 336–340.[CrossRef][Web of Science][Medline]

  20. Sorensen, L., Ekstrand, M., Silva, J.P., Lindqvist, E., Xu, B., Rustin, P., Olson, L. and Larsson, N.G. (2001) Late-onset corticohippocampal neurodepletion attributable to catastrophic failure of oxidative phosphorylation in MILON mice. J. Neurosci., 21, 8082–8090.[Abstract/Free Full Text]

  21. Puigserver, P., Wu, Z., Park, C.W., Graves, R., Wright, M. and Spiegelman, B.M. (1998) A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell, 92, 829–839.[CrossRef][Web of Science][Medline]

  22. Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Adelmant, G., Mootha, V., Troy, A., Cinti, S., Lowell, B., Scarpulla, R.C. et al. (1999) Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell, 98, 115–124.[CrossRef][Web of Science][Medline]

  23. Lin, J., Wu, H., Tarr, P.T., Zhang, C.Y., Wu, Z., Boss, O., Michael, L.F., Puigserver, P., Isotani, E., Olson, E.N. et al. (2002) Transcriptional co-activator PGC-1 alpha drives the formation of slow-twitch muscle fibres. Nature, 418, 797–801.[CrossRef][Medline]

  24. Virbasius, J.V. and Scarpulla, R.C. (1994) Activation of the human mitochondrial transcription factor A gene by nuclear respiratory factors: a potential regulatory link between nuclear and mitochondrial gene expression in organelle biogenesis. Proc. Natl Acad. Sci. USA, 91, 1309–1313.[Abstract/Free Full Text]

  25. Larsson, N.-G., Oldfors, A., Holme, E. and Clayton, D.A. (1994) Low levels of mitochondrial transcription factor A in mitochondrial DNA depletion. Biophys. Biochem. Res. Commun., 200, 1374–1381.

  26. Antoshechkin, I. and Bogenhagen, D.F. (1995) Distinct roles for two purified factors in transcription of Xenopus mitochondrial DNA. Mol. Cell. Biol., 15, 7032–7042.[Abstract]

  27. Bogenhagen, D.F., Wang, Y., Shen, E.L. and Kobayashi, R. (2003) Protein components of mitochondrial DNA nucleoids in higher eukaryotes. Mol. Cell. Proteomics, 2, 1205–1216.[Abstract/Free Full Text]

  28. Gensler, S., Weber, K., Schmitt, W.E., Perez-Martos, A., Enriquez, J.A., Montoya, J. and Wiesner, R.J. (2001) Mechanism of mammalian mitochondrial DNA replication: import of mitochondrial transcription factor A into isolated mitochondria stimulates 7S DNA synthesis. Nucl. Acids Res., 29, 3657–3663.[Abstract/Free Full Text]

  29. Holt, I.J., Lorimer, H.E. and Jacobs, H.T. (2000) Coupled leading- and lagging-strand synthesis of mammalian mitochondrial DNA. Cell, 100, 515–524.[CrossRef][Web of Science][Medline]

  30. Yang, M.Y., Bowmaker, M., Reyes, A., Vergani, L., Angeli, P., Gringeri, E., Jacobs, H.T. and Holt, I.J. (2002) Biased incorporation of ribonucleotides on the mitochondrial L-strand accounts for apparent strand-asymmetric DNA replication. Cell, 111, 495–505.[CrossRef][Web of Science][Medline]

  31. Bowmaker, M., Yang, M.Y., Yasukawa, T., Reyes, A., Jacobs, H.T., Huberman, J.A. and Holt, I.J. (2003) Mammalian mitochondrial DNA replicates bidirectionally from an initiation zone. J. Biol. Chem., 278, 50961–50969.[Abstract/Free Full Text]

  32. Bogenhagen, D.F. and Clayton, D.A. (2003) Concluding remarks: the mitochondrial DNA replication bubble has not burst. Trends Biochem. Sci., 28, 404–405.[CrossRef][Web of Science][Medline]

  33. Bogenhagen, D.F. and Clayton, D.A. (2003) The mitochondrial DNA replication bubble has not burst. Trends Biochem. Sci., 28, 357–360.[CrossRef][Web of Science][Medline]

  34. Holt, I.J. and Jacobs, H.T. (2003) Response: the mitochondrial DNA replication bubble has not burst. Trends Biochem. Sci., 28, 355–356.[CrossRef][Web of Science][Medline]

  35. Bibb, M.J., VanEtten, R.A., Wright, C.T., Walberg, M.W. and Clayton, D.A. (1981) Sequence and organization of mouse mitochondrial DNA. Cell, 26, 167–180.[CrossRef][Web of Science][Medline]

  36. Rustin, P., Chretien, D., Bourgeron, T., Gerard, B., Rotig, A., Saudubray, J.M. and Munnich, A. (1994) Biochemical and molecular investigations in respiratory chain deficiencies. Clin. Chim. Acta, 228, 35–51.[CrossRef][Web of Science][Medline]

  37. Fernandez-Vizarra, E., Lopez-Perez, M.J. and Enriquez, J.A. (2002) Isolation of biogenetically competent mitochondria from mammalian tissues and cultured cells. Methods, 26, 292–297.[CrossRef][Web of Science][Medline]

  38. Forster, C., Makela, S., Warri, A., Kietz, S., Becker, D., Hultenby, K., Warner, M. and Gustafsson, J.A. (2002) Involvement of estrogen receptor beta in terminal differentiation of mammary gland epithelium. Proc. Natl Acad. Sci. USA, 99, 15578–15583.[Abstract/Free Full Text]

  39. Weibel, E. (1979) Stereological Methods: Practical Methods for Biological Morphometry. Academic Press, London.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
L. Mao, K. J. Wertzler, S. C. Maloney, Z. Wang, N. S. Magnuson, and R. Reeves
HMGA1 Levels Influence Mitochondrial Function and Mitochondrial DNA Repair Efficiency
Mol. Cell. Biol., October 15, 2009; 29(20): 5426 - 5440.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J.-Y. Park, P.-y. Wang, T. Matsumoto, H. J. Sung, W. Ma, J. W. Choi, S. A. Anderson, S. C. Leary, R. S. Balaban, J.-G. Kang, et al.
p53 Improves Aerobic Exercise Capacity and Augments Skeletal Muscle Mitochondrial DNA Content
Circ. Res., September 25, 2009; 105(7): 705 - 712.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Di Re, H. Sembongi, J. He, A. Reyes, T. Yasukawa, P. Martinsson, L. J. Bailey, S. Goffart, J. D. Boyd-Kirkup, T. S. Wong, et al.
The accessory subunit of mitochondrial DNA polymerase {gamma} determines the DNA content of mitochondrial nucleoids in human cultured cells
Nucleic Acids Res., September 1, 2009; 37(17): 5701 - 5713.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. L. O. Pohjoismaki, S. Goffart, H. Tyynismaa, S. Willcox, T. Ide, D. Kang, A. Suomalainen, P. J. Karhunen, J. D. Griffith, I. J. Holt, et al.
Human Heart Mitochondrial DNA Is Organized in Complex Catenated Networks Containing Abundant Four-way Junctions and Replication Forks
J. Biol. Chem., August 7, 2009; 284(32): 21446 - 21457.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
A. Fukuoh, K. Ohgaki, H. Hatae, I. Kuraoka, Y. Aoki, T. Uchiumi, H. T. Jacobs, and D. Kang
DNA conformation-dependent activities of human mitochondrial RNA polymerase
Genes Cells, August 1, 2009; 14(8): 1029 - 1042.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. Cotney, S. E. McKay, and G. S. Shadel
Elucidation of separate, but collaborative functions of the rRNA methyltransferase-related human mitochondrial transcription factors B1 and B2 in mitochondrial biogenesis reveals new insight into maternally inherited deafness
Hum. Mol. Genet., July 15, 2009; 18(14): 2670 - 2682.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
T. A. Gangelhoff, P. S. Mungalachetty, J. C. Nix, and M. E. A. Churchill
Structural analysis and DNA binding of the HMG domains of the human mitochondrial transcription factor A
Nucleic Acids Res., June 1, 2009; 37(10): 3153 - 3164.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
H. Tsutsui, S. Kinugawa, and S. Matsushima
Mitochondrial oxidative stress and dysfunction in myocardial remodelling
Cardiovasc Res, February 15, 2009; 81(3): 449 - 456.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. Iacovino, C. Granycome, H. Sembongi, M. Bokori-Brown, R. A. Butow, I. J. Holt, and J. M. Bateman
The conserved translocase Tim17 prevents mitochondrial DNA loss
Hum. Mol. Genet., January 1, 2009; 18(1): 65 - 74.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
A. Saitoh, R. H. Haas, R. K. Naviaux, N. G. Salva, J. K. Wong, and S. A. Spector
Impact of Nucleoside Reverse Transcriptase Inhibitors on Mitochondrial DNA and RNA in Human Skeletal Muscle Cells
Antimicrob. Agents Chemother., August 1, 2008; 52(8): 2825 - 2830.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
X. Zhou, N. Solaroli, M. Bjerke, J. B. Stewart, B. Rozell, M. Johansson, and A. Karlsson
Progressive loss of mitochondrial DNA in thymidine kinase 2-deficient mice
Hum. Mol. Genet., August 1, 2008; 17(15): 2329 - 2335.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
E. Dufour, M. Terzioglu, F. H. Sterky, L. Sorensen, D. Galter, L. Olson, J. Wilbertz, and N.-G. Larsson
Age-associated mosaic respiratory chain deficiency causes trans-neuronal degeneration
Hum. Mol. Genet., May 15, 2008; 17(10): 1418 - 1426.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
R. C. Scarpulla
Transcriptional Paradigms in Mammalian Mitochondrial Biogenesis and Function
Physiol Rev, April 1, 2008; 88(2): 611 - 638.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Franko, S. Mayer, G. Thiel, L. Mercy, T. Arnould, H.-T. Hornig-Do, R. J. Wiesner, and S. Goffart
CREB-1{alpha} Is Recruited to and Mediates Upregulation of the Cytochrome c Promoter during Enhanced Mitochondrial Biogenesis Accompanying Skeletal Muscle Differentiation
Mol. Cell. Biol., April 1, 2008; 28(7): 2446 - 2459.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. D. Bruton, N. Place, T. Yamada, J. P. Silva, F. H. Andrade, A. J. Dahlstedt, S.-J. Zhang, A. Katz, N.-G. Larsson, and H. Westerblad
Reactive oxygen species and fatigue-induced prolonged low-frequency force depression in skeletal muscle fibres of rats, mice and SOD2 overexpressing mice
J. Physiol., January 1, 2008; 586(1): 175 - 184.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
J. M. Facucho-Oliveira, J. Alderson, E. C. Spikings, S. Egginton, and J. C. St. John
Mitochondrial DNA replication during differentiation of murine embryonic stem cells
J. Cell Sci., November 15, 2007; 120(22): 4025 - 4034.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
Y.-F. Chou, C.-C. Yu, and R.-F. S. Huang
Changes in Mitochondrial DNA Deletion, Content, and Biogenesis in Folate-Deficient Tissues of Young Rats Depend on Mitochondrial Folate and Oxidative DNA Injuries
J. Nutr., September 1, 2007; 137(9): 2036 - 2042.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
P. J. Adhihetty, T. Taivassalo, R. G. Haller, D. R. Walkinshaw, and D. A. Hood
The effect of training on the expression of mitochondrial biogenesis- and apoptosis-related proteins in skeletal muscle of patients with mtDNA defects
Am J Physiol Endocrinol Metab, September 1, 2007; 293(3): E672 - E680.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
B. A. Kaufman, N. Durisic, J. M. Mativetsky, S. Costantino, M. A. Hancock, P. Grutter, and E. A. Shoubridge
The Mitochondrial Transcription Factor TFAM Coordinates the Assembly of Multiple DNA Molecules into Nucleoid-like Structures
Mol. Biol. Cell, September 1, 2007; 18(9): 3225 - 3236.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
E. L. Bell, T. A. Klimova, J. Eisenbart, C. T. Moraes, M. P. Murphy, G.R. S. Budinger, and N. S. Chandel
The Qo site of the mitochondrial complex III is required for the transduction of hypoxic signaling via reactive oxygen species production
J. Cell Biol., July 30, 2007; 177(6): 1029 - 1036.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
E. J. Bowles, J.-H. Lee, R. Alberio, R. E. I. Lloyd, D. Stekel, K. H. S. Campbell, and J. C. St. John
Contrasting Effects of in Vitro Fertilization and Nuclear Transfer on the Expression of mtDNA Replication Factors
Genetics, July 1, 2007; 176(3): 1511 - 1526.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. Cotney, Z. Wang, and G. S. Shadel
Relative abundance of the human mitochondrial transcription system and distinct roles for h-mtTFB1 and h-mtTFB2 in mitochondrial biogenesis and gene expression
Nucleic Acids Res., June 18, 2007; (2007) gkm424v2.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
A. Amaral, J. Ramalho-Santos, and J. C. St John
The expression of polymerase gamma and mitochondrial transcription factor A and the regulation of mitochondrial DNA content in mature human sperm
Hum. Reprod., June 1, 2007; 22(6): 1585 - 1596.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
K. Ohgaki, T. Kanki, A. Fukuoh, H. Kurisaki, Y. Aoki, M. Ikeuchi, S. H. Kim, N. Hamasaki, and D. Kang
The C-terminal Tail of Mitochondrial Transcription Factor A Markedly Strengthens its General Binding to DNA
J. Biochem., February 1, 2007; 141(2): 201 - 211.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. I. Ekstrand, M. Terzioglu, D. Galter, S. Zhu, C. Hofstetter, E. Lindqvist, S. Thams, A. Bergstrand, F. S. Hansson, A. Trifunovic, et al.
Progressive parkinsonism in mice with respiratory-chain-deficient dopamine neurons
PNAS, January 23, 2007; 104(4): 1325 - 1330.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. L. O. Pohjoismaki, S. Wanrooij, A. K. Hyvarinen, S. Goffart, I. J. Holt, J. N. Spelbrink, and H. T. Jacobs
Alterations to the expression level of mitochondrial transcription factor A, TFAM, modify the mode of mitochondrial DNA replication in cultured human cells
Nucleic Acids Res., November 6, 2006; 34(20): 5815 - 5828.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Wiederkehr and C. B. Wollheim
Minireview: Implication of Mitochondria in Insulin Secretion and Action
Endocrinology, June 1, 2006; 147(6): 2643 - 2649.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Roberti, F. Bruni, P. L. Polosa, M. N. Gadaleta, and P. Cantatore
The Drosophila termination factor DmTTF regulates in vivo mitochondrial transcription
Nucleic Acids Res., May 3, 2006; 34(7): 2109 - 2116.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
G. D. Appleyard, G. W. Forsyth, L. M. Kiehlbauch, K. N. Sigfrid, H. L. J. Hanik, A. Quon, M. E. Loewen, and B. H. Grahn
Differential Mitochondrial DNA and Gene Expression in Inherited Retinal Dysplasia in Miniature Schnauzer Dogs
Invest. Ophthalmol. Vis. Sci., May 1, 2006; 47(5): 1810 - 1816.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
K. Sugimoto, N. R. Qi, L. Kazdova, M. Pravenec, T. Ogihara, and T. W. Kurtz
Telmisartan But Not Valsartan Increases Caloric Expenditure and Protects Against Weight Gain and Hepatic Steatosis
Hypertension, May 1, 2006; 47(5): 1003 - 1009.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
L.J.A.M. Jacobs, G. de Wert, J.P.M. Geraedts, I.F.M. de Coo, and H.J.M. Smeets
The transmission of OXPHOS disease and methods to prevent this
Hum. Reprod. Update, March 1, 2006; 12(2): 119 - 136.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Beve, G.-Z. Hu, L. C. Myers, D. Balciunas, O. Werngren, K. Hultenby, R. Wibom, H. Ronne, and C. M. Gustafsson
The Structural and Functional Role of Med5 in the Yeast Mediator Tail Module
J. Biol. Chem., December 16, 2005; 280(50): 41366 - 41372.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Trifunovic, A. Hansson, A. Wredenberg, A. T. Rovio, E. Dufour, I. Khvorostov, J. N. Spelbrink, R. Wibom, H. T. Jacobs, and N.-G. Larsson
From the Cover: Somatic mtDNA mutations cause aging phenotypes without affecting reactive oxygen species production
PNAS, December 13, 2005; 102(50): 17993 - 17998.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M. Ikeuchi, H. Matsusaka, D. Kang, S. Matsushima, T. Ide, T. Kubota, T. Fujiwara, N. Hamasaki, A. Takeshita, K. Sunagawa, et al.
Overexpression of Mitochondrial Transcription Factor A Ameliorates Mitochondrial Deficiencies and Cardiac Failure After Myocardial Infarction
Circulation, August 2, 2005; 112(5): 683 - 690.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
F. Li, Y. Wang, K. I. Zeller, J. J. Potter, D. R. Wonsey, K. A. O'Donnell, J.-w. Kim, J. T. Yustein, L. A. Lee, and C. V. Dang
Myc Stimulates Nuclearly Encoded Mitochondrial Genes and Mitochondrial Biogenesis
Mol. Cell. Biol., July 15, 2005; 25(14): 6225 - 6234.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
N. Hance, M. I. Ekstrand, and A. Trifunovic
Mitochondrial DNA polymerase gamma is essential for mammalian embryogenesis
Hum. Mol. Genet., July 1, 2005; 14(13): 1775 - 1783.
[Abstract] [Full Text] [PDF]


Home page
Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
V. Pesce, A. Cormio, F. Fracasso, A. M. S. Lezza, P. Cantatore, and M. N. Gadaleta
Age-Related Changes of Mitochondrial DNA Content and Mitochondrial Genotypic and Phenotypic Alterations in Rat Hind-Limb Skeletal Muscles
J. Gerontol. A Biol. Sci. Med. Sci., June 1, 2005; 60(6): 715 - 723.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. D. Taylor, H. Zhang, J. S. Eaton, M. S. Rodeheffer, M. A. Lebedeva, T. W. O'Rourke, W. Siede, and G. S. Shadel
The Conserved Mec1/Rad53 Nuclear Checkpoint Pathway Regulates Mitochondrial DNA Copy Number in Saccharomyces cerevisiae
Mol. Biol. Cell, June 1, 2005; 16(6): 3010 - 3018.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
H. P. J. Buermans, E. M. Redout, A. E. Schiel, R. J. P. Musters, M. Zuidwijk, P. P. Eijk, C. van Hardeveld, S. Kasanmoentalib, F. C. Visser, B. Ylstra, et al.
Microarray analysis reveals pivotal divergent mRNA expression profiles early in the development of either compensated ventricular hypertrophy or heart failure
Physiol Genomics, May 11, 2005; 21(3): 314 - 323.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
E. Hervouet, J. Demont, P. Pecina, A. Vojtiskova, J. Houstek, H. Simonnet, and C. Godinot
A new role for the von Hippel-Lindau tumor suppressor protein: stimulation of mitochondrial oxidative phosphorylation complex biogenesis
Carcinogenesis, March 1, 2005; 26(3): 531 - 539.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
H. Tyynismaa, H. Sembongi, M. Bokori-Brown, C. Granycome, N. Ashley, J. Poulton, A. Jalanko, J. N. Spelbrink, I. J. Holt, and A. Suomalainen
Twinkle helicase is essential for mtDNA maintenance and regulates mtDNA copy number
Hum. Mol. Genet., December 15, 2004; 13(24): 3219 - 3227.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
K. Maniura-Weber, S. Goffart, H. L. Garstka, J. Montoya, and R. J. Wiesner
Transient overexpression of mitochondrial transcription factor A (TFAM) is sufficient to stimulate mitochondrial DNA transcription, but not sufficient to increase mtDNA copy number in cultured cells
Nucleic Acids Res., November 16, 2004; 32(20): 6015 - 6027.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/9/935    most recent
ddh109v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (112)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Ekstrand, M. I.
Right arrow Articles by Larsson, N.-G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ekstrand, M. I.
Right arrow Articles by Larsson, N.-G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?