Skip Navigation


Human Molecular Genetics Advance Access originally published online on March 11, 2004
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/9/975    most recent
ddh106v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (15)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Fossdal, R.
Right arrow Articles by Stefansson, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fossdal, R.
Right arrow Articles by Stefansson, K.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, 2004, Vol. 13, No. 9 975-981
DOI: 10.1093/hmg/ddh106
Human Molecular Genetics, Vol. 13, No. 9 © Oxford University Press 2004; all rights reserved

A novel TEAD1 mutation is the causative allele in Sveinsson's chorioretinal atrophy (helicoid peripapillary chorioretinal degeneration)

Ragnheidur Fossdal1,*, Fridbert Jonasson2, Gudlaug T. Kristjansdottir1, Augustine Kong1, Hreinn Stefansson1, Shyamali Gosh1, Jeffrey R. Gulcher1,{dagger} and Kari Stefansson1,{dagger}

1deCODE Genetics, IS-101 Reykjavik, Iceland and 2Department of Ophthalmology, National University Hospital, IS-101 Reykjavik, Iceland

Received January 23, 2004; Revised February 24, 2004; Accepted March 2, 2004


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Sveinsson's chorioretinal atrophy (SCRA), also referred to as helicoid peripapillary chorioretinal degeneration or atrophia areata, is an autosomal dominant eye disease, characterized by symmetrical lesions radiating from the optic disc involving the retina and the choroid. Genome-wide linkage analysis mapped the SCRA gene to chromosome 11p15 in 81 patients from a large founder pedigree in Iceland. The parametric LOD score obtained was 18.9 using an autosomal dominant model with high penetrance. Crossover analysis of the linkage region with 51 markers identified a 593 kb segment shared by all patients. Sequencing exons of the only gene in this interval, the transcriptional enhancer TEAD1, revealed a novel missense mutation (Y421H) carried by all patients and none of the 502 controls. The mutation is in a conserved amino acid sequence in the C terminal of the protein, a potential binding site for YAP65 one of TEAD1's cofactors that is expressed in human retina as well as TEAD1 based on RT–PCR experiments. Therefore, we conclude that the mutation in the TEAD1 gene is the cause of Sveinsson's chorioretinal atrophy.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Sveinsson's chorioretinal atrophy (SCRA) (1–9) is a distinct autosomal dominant disease affecting both eyes (Fig. 1) and may be detected on fundoscopic examination as early as at birth. Its initial clinical description was made in 1939 by Icelandic ophthalmologist Kristjan Sveinsson who called the condition chorioiditis areata (1). In 1962, Franceschetti in Switzerland reported one case, included Sveinsson's cases and renamed the condition helicoid peripapillary chorioretinal degeneration (HPCD) (2). In 1979, Sveinsson reported a four-generation family demonstrating autosomal dominant transmission and the progression of the lesions with age. As there was no evidence of inflammation, Sveinsson withdrew the name chorioiditis areata in favor of HPCD (3). Magnusson later reported another SCRA family from Iceland, renaming the disease atrophia areata (AA; OMIM 108985) (4). Franceschetti's patient was re-examined by his successor (5), and later reported with his affected son (6). In 1995 we mapped the disease gene to chromosome 11 (7), and in 1998 reported the results of electrophysiological studies (8). We are aware of reports describing patients with this condition in Iceland, Switzerland and Canada (1–9). We have also received personal communications describing patients with this condition in the Faroes, Denmark, Germany, Norway, Sweden, UK and USA. These patients all had Icelandic ancestors and were members of the extended ancestral pedigree described in this paper.



View larger version (100K):
[in this window]
[in a new window]
  		Figure 1. A left fundus photograph of a 25-year-old woman in a large ancestral pedigree from Iceland (Family 9, Fig. 2). She has helicodal peripapillary atrophy including the retina and the choroid. Visual acuity is still 6/6 and visual field defects correspond to the location of the lesion. Central visual loss is likely within a few years as the lesion approaches the fovea. Arrows point to: (A) optic disc/papilla nervi optici; (B) SCRA tongue towards fovea; and (C) fovea—essential for central vision.

 
The vast majority of reported cases, and the only reports describing autosomal dominant inheritance, are Icelandic (3,4,7). Since the phenotype and inheritance was first reported by Sveinsson, and to prevent the ambiguity inherent to the term HPCD, we propose that this condition should be called Sveinsson's chorioretinal atrophy (SCRA); this terminology will be used hereafter in this paper.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Genealogy and inheritance
The SCRA phenotype defined by the fundoscopic examination is distinct and dramatic, and therefore the diagnosis is rarely in doubt (1,3,4,8) (Fig. 1). SCRA is inherited as an autosomal dominant trait with apparently complete penetrance in a large multigenerational Icelandic pedigree. The male to female ratio for SCRA is 38/43. Twenty-two of the SCRA patients (27.2%) also have anterior polar congenital cataract that shows autosomal dominant inheritance but with incomplete penetrance. No relatives of the SCRA patients in this research have been diagnosed with anterior polar congenital cataract. Using deCODE's encrypted genealogical database (10,11) for ancestral clustering of the 81 patients, all except three were traced to one individual born in 1540 (pedigree A, Fig. 2). The three patients without detectable connection to the founder, a father and his two children, constitute a separate family (pedigree B, pedigree not shown). The appropriate linkage clusters for the genome-wide linkage scan included families 1–9 in pedigree A (Fig. 2) and the family of pedigree B or a total of 79 SCRA cases. The affected father and son in family 10 in pedigree A were included in the fine mapping and haplotype analysis together with the other affected individuals.



View larger version (18K):
[in this window]
[in a new window]
  		Figure 2. A 14 generation ancestral pedigree (pedigree A) from a male founder born in 1540 with the 78 of 81 SCRA patients participating in the present study (coloured symbols). The disease appears in every investigated generation, the male/female ratio is nearly 1, and there exists transmission from father to son, suggesting an autosomal dominant inheritance for the disease. Families 1–9 represent nine of 10 clusters used for genome-wide linkage scan. The tenth linkage cluster is pedigree B. Pseudo-genealogical connection was manually introduced between individuals in families 9 and 10 for linkage and crossover analysis with the fine mapping markers, microsatellites and SNPs. Crossover analysis for the numbered patients and one unaffected individual (Id. 3) resulted in the detection of the critical region holding the disease gene.

 
Linkage analysis
A genome-wide scan for linkage was performed using a framework map of 867 autosomal microsatellite markers which were used to genotype all patients and their unaffected relatives. The 81 markers genotyped for the sex chromosomes were not analysed because SCRA is transmitted equally through both sexes to daughters and sons. The genome-wide linkage scan resulted in signficant LOD scores for markers on chromosome 11p15 exclusively. The most prominent LOD score was 18.9 in a 2.7 Mb region between the markers D11S1349 and D11S4170 (Fig. 3). This supported our original work with a 20 patient subset of pedigree A, and a LOD score of 5.23 over the same location using MLINK single point linkage analysis (7).



View larger version (12K):
[in this window]
[in a new window]
  		Figure 3. The results of multi-point parametric linkage analysis are shown for the region with the highest LOD scores on chromosome 11p, between the markers D11S4149 and D11S928. The genome-wide linkage (solid lines) resulted in the highest LOD score of 18.9 in a 2.7 Mb region between the markers D11S1349 and D11S4170. The fine mapping linkage analysis (the dashed line), for the 51 markers in Figure 4 showed the highest LOD score of 22.4 for D11S4116, a marker within 10 kb of the last exon of TEAD1. The LOD score is on the left-hand vertical axis and the genome-wide markers and the genetic distance (cM) from the p end of the chromosome is on the horizontal axis.

 
Fine mapping and screening of candidate genes
Based on current linkage analysis and previous haplotyping, excluding the region centromeric to D11S902 (7), 35 microsatellites were added telomeric to the marker. Haplotype analysis of all family members revealed a large segment in this region shared by the patients and not their unaffected relatives. We have derived 19 haplotypes with crucial crossover events defining the candidate region (Fig. 4). The smallest region common to all patients was 1.1 Mb, between the markers DG11S262 and DG11S407, a clear founder region (Fig. 4). Five genes are located in the 1.1 Mb region: DKK3, FLJ14966, KIAA0750, PARVA and TEAD1 (Fig. 5). We selected one gene, PARVA, for mutational search because it belongs to a family of actin-binding focal adhesion proteins (12) and is expressed in eyes according to the SAGE Expression Database. No sequence changes in PARVA were exclusive to patients. Five SNPs redefined the telomeric boundary, narrowing it to 593 kb, in patient 15 (Fig. 4) from SNP5, immediately telomeric to the last exon of PARVA, to the marker DG11S407 (Fig. 5). Linkage for 51 fine mapping markers demonstrated an ultimate high score for D11S4116 (Figs 3 and 4), thus supporting the results of crossover analysis with the same markers. One gene, TEAD1, a widely expressed transcriptional enhancer, is located in the 593 kb region (13,14).



View larger version (52K):
[in this window]
[in a new window]
  		Figure 4. The extended haplotype sharing and crossover analysis for 51 fine mapping markers in a 20 Mb region on chromosome 11p, from the telomere to the marker D11S928. Crossover analysis with the genome-wide markers (white) resulted in a haplotype sharing in the 2.7 Mb region yielding the highest genome-wide LOD score (Fig. 3). Adding the microsatellites (blue) narrowed the region to 1.1 Mb between the markers DG11S262 and DG11S407. The final resolution to a 593 Mb region was identified with five SNPs (green) within the PARVA gene. In the column on the left are personal identifiers compatible with identifiers in pedigree A, Figure 2, representing haplotypes and crossover sites detected for 18 patients and one unaffected sibling. The three patients in pedigree B, initially thought to be unrelated to the 78 patients (pedigree A), have identical haplotypes to the ones detected for pedigree A (yellow alleles) but without further refining the region. The crucial crossover that determined the telomeric boundary was detected in patient 15 and the centromeric boundary of the 593 kb region is supported by haplotype detected in patient 18. An unaffected individual (Id. 3) presents partial sharing of the haplotype inherited with the disease centromeric to D11S4116, thus supporting the crossover site detected in patient 18. The mutation (Y421H (white)) is between D11S4116 and DG11S407 where the allele 2 (base C) is exclusively detected in patients and not in the healthy individual (Id. 3). The three steps of haplotype and crossover analysis are summarized at the bottom of the figure, narrowing the region from 2.7 Mb to 593 kb. The vertical top rows list the markers and their physical location (Mb).

 


View larger version (17K):
[in this window]
[in a new window]
  		Figure 5. Five genes were detected within the 1.1 Mb SCRA interval between the markers DG11S262 and DG11S407 according to crossover analysis with microsatellite markers (blue). Sequencing the gene PARVA added five SNPs (green) and increased the resolution in one patient resulting in a 593 kb critical region and one candidate gene TEAD1. The missense mutation, Y421H, was detected by sequencing in the last exon of TEAD1.

 
All known TEAD1 exons were sequenced. We detected 19 SNPs and one T-to-C transition, at base pair 94 from the 5' end of the last exon of TEAD1, where all patients were heterozygous T/C, whereas all unaffected relatives and controls, totalling 502, were homozygous for the genotype T/T (Fig. 6). The transition is in the coding sequence and leads to a substitution of tyrosine with histidine (Y421H). The homozygous state C/C was not detected in the 583 samples sequenced. Furthermore, sequence and amino acid BLAST search gave no match for C at location 94 in the 3' exon or histidine at position 421 in the TEAD1 protein.



View larger version (58K):
[in this window]
[in a new window]
  		Figure 6. Sequencing analysis of a SCRA patient (upper sequence) and an unaffected sib (lower sequence) showing T-to-C transition in a patient compared to the homozygote T/T according to consensus sequence in the unaffected individual for base pair 94 in the last exon of the gene TEAD1. The base substitution is in the first position of the thyrosine codon TAC, resulting in a codon CAC for the amino acid histidine. The mutation Y421H is detected in all 81 SCRA patients and none of the 502 controls sequenced. No individual homozygous for the C allele was found.

 
The cofactor for TEAD1, YAP65 (Hs.170548) binds to the carboxyl end of TEAD1, the domain that harbours the novel Y421H mutation. Expressed sequence tags (ESTs) for TEAD1 and YAP65 are found in human cDNA libraries from eye in publicly available databases (UI-E-DX1 and UI-E-EO1). In order to verify the presence of TEAD1 and YAP65 transcripts in human retina, we carried out RT–PCR experiments using gene specific primers. The templates were from four human cDNA libraries from Clontech (retina, brain, heart and pancreas), cDNA isolated from EBV cell lines and from fresh whole blood. The results for the different libraries showed that the TEAD1 and YAP65 genes are widely expressed which is in keeping with previous reports (12–14). The RT–PCRs for all samples except the negative control resulted in one or two strong bands of the expected size on an agarose gel for both TEAD1 and YAP65 (490 and 717 bp, respectively, based on the location of the nested primers) in retina (Fig. 7).



View larger version (42K):
[in this window]
[in a new window]
  		Figure 7. RT–PCR detection of TEAD1 and YAP65 expression in human tissues by nested primers resulted in one to two clear bands on agarose gel. The templates used were four Marathon-Ready cDNA libraries from Clontech (He, heart; Pa, pancreas; Br, brain; and Re, retina), cDNA from two cell lines (Ly, EBV lymphocytes; and Bl, whole blood) and human genomic DNA (Neg) as negative control. Both genes are expressed in the six cDNA libraries and not in the negative control. TEAD1 expression analysis results in only one band of the expected size 490 bp. YAP65 expected RNA product was 717 bp, detected in all except in the RNA extracted from blood where we detected two splice variants, one smaller and the other larger than the expected product.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
We had previously mapped the SCRA gene to chromosome 11p15 by linkage analysis (7), and have now confirmed this linkage with four times the number of patients in the original study. Subsequently we used haplotype analysis to narrow the region of interest and searched for mutations in TEAD1, the only gene detected in the 593 kb candidate region, by sequencing all known exons of that gene. The mutation detected in a coding exon of TEAD1 is the first one in this gene to be associated with human eye disease. The missense mutation found in the SCRA patients is in a highly conserved amino acid sequence HHIYRLVKD at the C terminal domain of the protein where tyrosine is conserved among paralogues and orthologues of TEAD1 (Fig. 8) (15). The human TEAD1 paralogues have 79–84% amino acid identity and a highly homologous TEA DNA binding site in their N-terminal domain (16). The tyrosine at position 421 in TEAD1 is not an active phoshorylation site (17), but the C terminus is the connecting position to the protein's cofactor YAP65. The two proteins interact within the nucleus where YAP65 connected to TEAD1 activates the RNA polymerase II complex, while TEAD1 binds to an enhancer sequence of an unknown gene (18). The amino acid change, exclusively detected in patients, may affect the interaction between TEAD1 and YAP65 and thus modify the transcription of important structural genes expressed in the retina or the choroid. TEAD1 may also interact with another tissue-specific transcriptional partners in a similar way.



View larger version (17K):
[in this window]
[in a new window]
  		Figure 8. The C-termini of the TEA transcription factors are highly conserved in at least four paralogues and numerous orthologues, as demonstrated by the alignment of the amino acid sequence of nine TEAD proteins for the residues 377–426 at the C-terminus to the human TEAD1 protein. In this region the TEAD1 protein is best conserved for amino acids 377–389 and again for the last nine amino acids except for the mutation HIS-421 (Y421H) only detected in SCRA patients. TEAD1's exact binding site to the cofactor YAP65 for this amino acid sequence is not known. The amino acid residues are colored according to chemical properties.

 
The chorioretinal atrophy in SCRA begins at the optic disc and progresses throughout life. TEAD1 and its partners may alter the expression of genes responsible for the structural and metabolic support of the photoreceptor cells in the peripapillary region. This is consistent with electrophysiological studies indicating normal function of the photoreceptors and neurons close to the affected areas where the retinal pigment epithelium and possibly Bruch's membrane and choriocapillaries are already affected (8). TEAD1 is expressed in most tissues, is most abundant in pancreas, placenta and heart (13) and is expressed in retina as well (Fig. 7). Disruption of the Tead1 gene in a mouse strain is lethal to the homozygote embryo (19) and this may also be true in humans since we did not find any individual homozygous for Y421H. The mouse embryo had cardiac abnormalities and dilation of the fourth ventricle of the brain. The development of the chorioretinal layers in the eyes of the mouse were not discussed (19) but the mouse mutants could add valuable information to the development of the chorioretinal layers.

There is a remote possibility that the missense mutation detected in all SCRA patients on the same haplotype background is not the contributing allele but in perfect linkage disequilibrium with the actual causative allele within the 593 kb critical interval identified by the linkage and crossover analysis. There is, however, considerable evidence in support of the notion that Y421H is the causative allele. First, most mutations for highly penetrant Mendelian diseases are in exons or regulatory elements close to exons. We have screened all exons for the TEAD1 gene and intronic sequences near the exons, where Y421H is the only mutation detected and is exclusively found in patients. Second, TYR-421 is within a sequence conserved in paralogues and orthologues of TEAD. Third, TYR-421 is located near or within the known protein–protein interaction site for TEAD1 and its cofactor and that interaction is necessary for proper function of TEAD1. Furthermore, available data for TEAD1 and YAP65 in SAGE and CGAP expression databases suggest expression of the transcription factor and its cofactor in retina, which we have confirmed by RT–PCR experiments on human retina library.

Discovering that the gene encoding TEA transcriptional factor is involved in SCRA is the first step towards revealing the pathophysiologic mechanisms in this condition. It will hopefully advance our understanding of the structure and function of normal and affected choroid and retina, which may eventually lead to therapeutic intervention for SCRA. Its apparent additional effect on the opacification of the lens, manifested as anterior polar congenital cataract, may also shed light on the biology of this rare cataract formation. The isolation of this disease-causing mutation tags a molecular pathway and a globally expressed protein, resulting in an altered activity within a particular tissue, possibly by means of tissue-specific cofactor. The identification of TEAD1 in the disease process will offer a simple PCR assay to confirm the diagnosis of infants and sporadic cases in adults.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Subjects
We obtained permission from the Data Protection Commission of Iceland and the National Bioethics Committee to approach patients having clinical records by one of us (F.J.); we also were allowed to approach their relatives. In the Icelandic population of 288 000 people we have a registry of 116 living SCRA patients. When the nature and the purpose of this research had been explained to the prospective participants, 81 patients and 107 of their relatives and spouses signed a consent form following the guidelines of the Declaration of Helsinki. Fundus photographs and records for patients, associated relatives and spouses were evaluated. All personal identifiers were encrypted by the Data Protection Commission of Iceland as described (20).

Genome-wide microsatellite markers and genotyping
All individuals were genotyped using a genome-wide framework marker set, of 936 microsatellites (P1100), developed at deCODE Genetics Inc. The P1100 microsatellite marker set has an initial genome wide average spacing of 3.8 cM. It contains markers from the ABI Linkage Marker set (version 2), ABI intercalating set and 500 additional markers. The marker order and genetic positions for the framework mapping set were obtained from the deCODE's High Resolution Genetic Map (21).

For each marker the forward primer is fluorescently labelled. The primer-pairs have been extensively tested for optimizing multiplex PCR reactions for cost benefits. PCR amplifications were set up on Zymark ALH 400, run on MJR TetradTM and pooled on Gilson Cyberlab robots. The reaction volume was 5 µl, and for each PCR 20 ng of genomic DNA was amplified in the presence of 2 pmol of each primer, 0.25 U AmpliTaq Gold, 0.2 mM dNTPs and 2.5 mM MgCl2 (buffer was supplied by the manufacturer, Applera). Cycling conditions were as follows: 95°C for 10 min, followed by 37 cycles of 94°C for 15 s, annealing for 30 s at 55°C, and 1 min extension at 72°C. The PCR products were supplemented with the internal size standard GS500-LIZ, and the pools were separated and detected on 3730 Sequencers. Alleles were automatically called using DAC, an allele-calling program developed at deCODE genetics Inc. (22) and the program deCODE GT was used to fractionate called genotypes, according to quality, and to edit when necessary (23).

Linkage analysis
We analysed the data using an autosomal dominant parametric model. All linkage results presented were based on ‘affected only’ analyses, i.e. an individual was classified either as a patient or as having unknown disease status. For affected-only analyses, only penetrance ratios are relevant, and here, carriers of the mutation were assumed to have 10 000 times the risk of non-carriers for getting the disease. The population frequency of the mutation was assumed to be 0.0004. The LOD scores, log10 of likelihood ratios, were based on multipoint calculations using all markers simultaneously and computed using the Allegro program (24).

Physical mapping and crossover analysis
High-resolution physical map for microsatellites markers, genes and SNPs was generated using the BLAT algorithm on the Human Genome Assembly (Build33) (25). The marker order was also in keeping with markers available in the deCODE's High Resolution Genetic Map (21). Additional in-house (novel) microsatellite markers were designed using the Sputnik program (26). The Allegro program was used to derive haplotypes and crossover events, with additional editing when phase information was not adequate for automatic analysis (24). The region selected for fine mapping and to increase the marker density for haplotype analysis in the chromosome 11p the telomeric region was based on the results of the genome-wide linkage analysis. The increase resulted in 14 novel and 21 public markers to the 11 previously genotyped (from the P1100 marker set) in the 20 Mb region between D11S928 and chromosome 11ptel. Thus 46 microsatellite markers were genotyped in this region, with the highest density in the 2.7 Mb region between D11S1349 and D11S4170 (average marker density 1/134 kb). Furthermore five SNPs detected by sequencing PARVA, a gene in a 1.1 Mb critical region, detected by crossover analysis with microsatellite markers, increased the average marker density to 1/107 kb.

Genes
Two genes were sequenced in order to find polymorphic markers and in search for the causative allele: PARVA (alpha parvin Hs.44077) and TEAD1 [TEA domain family member 1 (SV40 transcriptional enhancer factor); OMIM 189967, Hs.153408]. The other genes located in the 1.1 Mb candidate region are: DKK3 (dickkopf homolog 3) Hs.4909 or Hs.130865, KIAA0750 (Hs.314434) or MICAL2 (Flavoprotein oxidoreductase Hs.309674) and FLJ14966 (hypothetical protein) Hs.187055 or Hs.128196. TEAD1 and YAP65 were selected for expression analysis by RT–PCR in human tissues, YAP65 (Hs.170548) or YAP1 Yes-associated protein 1, 65kDa. Online electronic information for all DNA and protein reference sequences was from the NCBI and ExPASy web sites (27).

Sequencing analysis
All known exons for the genes sequenced are according to NCBI reference sequence. Based on the size of each exon and GC content of the region, the primers were 18–30 bp long. The amplimers were selected from 200 to 750 bp, amplifying a minimum of 60–200 bp of the intronic sequence flanking the exons. PCR and cycle sequencing primers were designed by WinSeq, a deCODE software based on the Primer3 software (28). PCR amplifications were set up on Zymark ALH 400 and run on MJR TetradTM. PCR products were verified for correct length on agarose gel before being purified using Millipore MultiScreenTM384PCR filters. Cycle sequencing reactions were set up on Zymark ALH 400, run on MJR TetradTM and excess dye terminators were removed using Millipore MultiScreenTM384Seq filters. Amplimers were sequenced directly on an Applied Biosystems 3700 Capillary DNA Sequencer using an ABI PRISM® Fluorescent Dye Terminator System (Perkin–Elmer, Foster City, CA, USA). The sequence analysis was conducted with Clinical GenomeMinerTM 1.5, a deCODE software based on assembly comparable to Consed (29) and Sequencer software version 4.0 (GeneCodes Corporation, Ann Arbor, MI, USA) and the sequence editing was according to Sequencer software with Gene View as conventional Genome Browsers (Sanger, Ensembl Genome Browser and UCSC Genome Browser Software).

All exons in PARVA and TEAD1 were sequenced for six affected and five confirmed unaffected adult siblings, presuming that the same highly penetrant mutation would be detected in all patients and none of the healthy controls. The T-to-C transition in the last exon of TEAD1 (Y421H) was sequenced for all 81 SCRA patients, 92 unaffected family members, 267 unrelated Icelandic controls and 143 foreign controls, using the relevant primer pair, F, TAACAGGTGGTAACAAACAGGGATA and R, ATGGCAAATGCTCTGTCTCAA, with the annealing temperature at 62°C.

SNPs
The five SNPs detected by sequencing in PARVA and used for crossover analysis are reported in public databases: SNP1, rs2288291; SNP2, rs4456243; SNP3, rs2243707; SNP4, rs2288293; and SNP5, rs2114389

RT–PCR of human cell lines and libraries
The RNeasy Midi Kit from Qiagen (75144) with on-column DNA digestion was used to isolate and clean RNA from EBV cell lines and the RNeasy protocol from Qiagen (52304) for the isolation of total cellular RNA from whole blood. The quality and quantity of RNA were assessed using Agilent 2001 Bioanalyser. We prepared cDNA from total RNA using random hexamers with RevertAidTM H Minus First Strand cDNA Synthesis Kit from Fermentas (K1631). Primer Express® software (Applied Biosystems, Foster City, CA, USA) was used to make two sets of cDNA-specific primers for each gene. The primary and nested primers were designed to confirm the transcripts for TEAD1 and YAP65 in the four Marathon-Ready cDNA libraries from Clontech [He: Human Heart Marathon-Ready cDNA (7404-1); Pa: Human Pancreas Marathon-Ready cDNA (7410-1); Br: Human Brain, whole Marathon-Ready cDNA (7400-1); and Re: Human Retina Marathon-Ready cDNA (7449-1)], the two deCODE cDNA libraries (EBV transformed lymphocytes and whole blood) in addition to the negative control (human whole blood DNA). The primary and nested PCR was carried out according to manual for Advantage® 2 PCR Enzyme System (PT3281-1) from BD Biosciences and the products were verified on agarose gel by standard methods. The primers for TEAD1 are TF, ACATCAAACTCAGGACAGGCAAGAC, and TR, CGAGGAAGAAGGCATTTTGAGG, resulting in 636 bp product, a product consequently diluted 1 : 50 for the second PCR by the nested primers TFnested, AGGCAAGACGAGGACCAGAAAA, and TRnested, ATGCCCAATGTGCACGAAGA, resulting in a final PCR product of 490 bp. Compatible primer pairs for YAP65 are YF, CCCAGCAGCTACACCCACAG, and YR, TCTGGGGTTCGAGGGACACT, resulting in 792 bp product and YFnested, CTGCCAGCAGGTTGGGAGAT, and YRnested, TCGAGGGACACTGTAGCTGCTC, resulting in the 717 bp product. The size marker used on the agarose gel was Amersham Bioscience ReadyToRun DNA Marker, 1 (80-6485-65).

GenBank protein accession numbers
H. sapiens TEAD1 P28347, M. musculus Tead1 S40779, R. norvegicus TEAD1 ENSRNOG00000015488, F. rubripes TEAD1 SINFRUG00000125828, D. melanogaster Scalloped A42136, H. sapiens TEAD2 Q15562, H. sapiens TEAD3 Q99594 and H. sapiens TEAD4 Q15561.


   ACKNOWLEDGEMENTS
 
We are grateful to the Icelandic patients and their families and to the Icelandic ophthalmologists who provided clinical information, the nurses at the Genetic Research Service Center for pursuing the sample collection with their personal touch but according to all rules and regulations and to all employees at deCODE genetics contributing to this research. With this article we also pay tribute to late Professor Olafur Jensson, who initiated the genetic research on SCRA and still inspires us to keep on going.


   FOOTNOTES
 
* To whom correspondence should be addressed at: deCODE Genetics, Sturlugata 8, IS-101 Reykjavik, Iceland. Tel: +354 5701977; Fax: +354 5701903; E-mail: ragnheidur.fossdal{at}decode.is

{dagger} These authors contributed equally to this work. Back


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Sveinsson, K. (1939) Chorioiditis areata. Acta Ophthal., 17, 73–80.

  2. Franceschetti, A. (1962) A curious affection of the fundus oculi: helicoid peripapillar chorioretinal degeneration. Its relation to pigmentary paravenous chorioretinal degeneration. Docum. Ophthal., 16, 81–110.

  3. Sveinsson, K. (1979) Helicoidal peripapillary chorioretinal degeneration. Acta Ophthal. (Copenh.), 57, 69–75.

  4. Magnusson, L. (1981) Atrophia areata. A variant of peripapillary chorioretinal degeneration. Acta Ophthal. (Copenh.), 59, 659–664.

  5. Babel, J. (1983) [Geographic and helicoid choroidopathies. Clinical and angiographic study; attempted classification]. J. Fr. Ophthal., 6, 981–993.

  6. Brazitikos, P.D. and Safran, A.B. (1990) Helicoid peripapillary chorioretinal degeneration. Am. J. Ophthal., 109, 290–294.[Web of Science][Medline]

  7. Fossdal, R., Magnusson, L., Weber, J.L. and Jensson, O. (1995) Mapping the locus of atrophia areata, a helicoid peripapillary chorioretinal degeneration with autosomal dominant inheritance, to chromosome 11p15. Hum. Mol. Genet., 4, 479–483.[Abstract/Free Full Text]

  8. Eysteinsson, T., Jonasson, F., Jonsson, V. and Bird, A.C. (1998) Helicoidal peripapillary chorioretinal degeneration: electrophysiology and psychophysics in 17 patients. Br. J. Ophthal., 82, 280–285.[Abstract/Free Full Text]

  9. Wong, A.M. and Heon, E. (1998) Helicoid peripapillary chorioretinal degeneration in abetalipoproteinemia. Arch. Ophthal., 116, 250–251.[Free Full Text]

  10. Gulcher, J. and Stefansson, K. (1998) Population genomics: laying the groundwork for genetic disease modeling and targeting. Clin. Chem. Lab. Med., 36, 523–527.[CrossRef][Web of Science][Medline]

  11. Sigurgardottir, S., Helgason, A., Gulcher, J.R., Stefansson, K. and Donnelly, P. (2000) The mutation rate in the human mtDNA control region. Am. J. Hum. Genet., 66, 1599–1609.[CrossRef][Web of Science][Medline]

  12. Korenbaum, E., Olski, T.M. and Noegel, A.A. (2001) Genomic organization and expression profile of the parvin family of focal adhesion proteins in mice and humans. Gene, 279, 69–79.[CrossRef][Web of Science][Medline]

  13. Stewart, A.F., Richard, C.W. III, Suzow, J., Stephan, D., Weremowicz, S., Morton, C.C. and Adra, C.N. (1996) Cloning of human RTEF-1, a transcriptional enhancer factor-1-related gene preferentially expressed in skeletal muscle: evidence for an ancient multigene family. Genomics, 37, 68–76.[CrossRef][Web of Science][Medline]

  14. Thompson, M., Andrade, V.A., Andrade, S.J., Pusl, T., Ortega, J.M., Goes, A.M. and Leite, M.F. (2003) Inhibition of the TEF/TEAD transcription factor activity by nuclear calcium and distinct kinase pathways. Biochem. Biophys. Res. Commun., 301, 267–274.[CrossRef][Web of Science][Medline]

  15. Kaneko, K.J. and DePamphilis, M.L. (1998) Regulation of gene expression at the beginning of mammalian development and the TEAD family of transcription factors. Dev. Genet., 22, 43–55.[CrossRef][Web of Science][Medline]

  16. Jacquemin, P., Martial, J.A. and Davidson, I. (1997) Human TEF-5 is preferentially expressed in placenta and binds to multiple functional elements of the human chorionic somatomammotropin-B gene enhancer. J. Biol. Chem., 272, 12928–12937.[Abstract/Free Full Text]

  17. Jiang, S.W., Dong, M., Trujillo, M.A., Miller, L.J. and Eberhardt, N.L. (2001) DNA binding of TEA/ATTS domain factors is regulated by protein kinase C phosphorylation in human choriocarcinoma cells. J. Biol. Chem., 276, 23464–23470.[Abstract/Free Full Text]

  18. Vassilev, A., Kaneko, K.J., Shu, H., Zhao, Y. and DePamphilis, M.L. (2001) TEAD/TEF transcription factors utilize the activation domain of YAP65, a Src/Yes-associated protein localized in the cytoplasm. Genes Dev., 15, 1229–1241.[Abstract/Free Full Text]

  19. Chen, Z., Friedrich, G.A. and Soriano, P. (1994) Transcriptional enhancer factor 1 disruption by a retroviral gene trap leads to heart defects and embryonic lethality in mice. Genes Dev., 8, 2293–2301.[Abstract/Free Full Text]

  20. Gulcher, J.R., Kristjansson, K., Gudbjartsson, H. and Stefansson, K. (2000) Protection of privacy by third-party encryption in genetic research in Iceland. Eur. J. Hum. Genet., 8, 739–742.[CrossRef][Web of Science][Medline]

  21. Kong, A., Gudbjartsson, D.F., Sainz, J., Jonsdottir, G.M., Gudjonsson, S.A., Richardsson, B., Sigurdardottir, S., Barnard, J., Hallbeck, B., Masson, G. et al. (2002) A high-resolution recombination map of the human genome. Nat. Genet., 31, 241–247.[CrossRef][Web of Science][Medline]

  22. Fjalldal, J.B., Sigurdsson, J., Benediktsson, K. and Ellingssen, L.M. (2001) Automated genotyping: combining neural networks and decision trees to perform robust allele calling. Proceedings of the International Joint Conference Neural Networks, pp. A1–A6.

  23. Palsson, B., Palsson, F., Perlin, M., Gudbjartsson, H., Stefansson, K. and Gulcher, J. (1999) Using quality measures to facilitate allele calling in high-throughput genotyping. Genome Res., 9, 1002–1012.[Abstract/Free Full Text]

  24. Gudbjartsson, D.F., Jonasson, K., Frigge, M.L. and Kong, A. (2000) Allegro, a new computer program for multipoint linkage analysis. Nat. Genet., 25, 12–13.[CrossRef][Web of Science][Medline]

  25. Kent, W.J. (2002) BLAT—the BLAST-like alignment tool. Genome Res., 12, 656–664.[Abstract/Free Full Text]

  26. Makalowska, I., Ryan, J.F. and Baxevanis, A.D. (2001) GeneMachine: gene prediction and sequence annotation. Bioinformatics, 17, 843–844.[Abstract/Free Full Text]

  27. Boeckmann, B., Bairoch, A., Apweiler, R., Blatter, M.C., Estreicher, A., Gasteiger, E., Martin, M.J., Michoud, K., O'Donovan, C., Phan, I. et al. (2003) The SWISS-PROT protein knowledgebase and its supplement TrEMBL in 2003. Nucl. Acids Res., 31, 365–370.[Abstract/Free Full Text]

  28. Rozen, S. and Skaletsky, H. (2000) Primer3 on the WWW for general users and for biologist programmers. Meth. Mol. Biol., 132, 365–386.[Medline]

  29. Gordon, D., Abajian, C. and Green, P. (1998) Consed: a graphical tool for sequence finishing. Genome Res., 8, 195–202.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Genes Dev.Home page
B. Zhao, X. Ye, J. Yu, L. Li, W. Li, S. Li, J. Yu, J. D. Lin, C.-Y. Wang, A. M. Chinnaiyan, et al.
TEAD mediates YAP-dependent gene induction and growth control
Genes & Dev., July 15, 2008; 22(14): 1962 - 1971.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
A. Sawada, H. Kiyonari, K. Ukita, N. Nishioka, Y. Imuta, and H. Sasaki
Redundant Roles of Tead1 and Tead2 in Notochord Development and the Regulation of Cell Proliferation and Survival
Mol. Cell. Biol., May 15, 2008; 28(10): 3177 - 3189.
[Abstract] [Full Text] [PDF]

Home page
 Mult SclerHome page
P. Datta, H.F. Harbo, L.P. Ryder, E. Akesson, J. Benedikz, E.G. Celius, O. Andersen, K.-M. Myhr, M. Sandberg-Wollheim, J. Hillert, et al.
A follow-up study of Nordic multiple sclerosis candidate gene regions
Multiple Sclerosis, June 1, 2007; 13(5): 584 - 589.
[Abstract] [PDF]

Home page
 BrainHome page
L. L. Thomsen, M. Kirchmann, A. Bjornsson, H. Stefansson, R. M. Jensen, A. C. Fasquel, H. Petursson, M. Stefansson, M. L. Frigge, A. Kong, et al.
The genetic spectrum of a population-based sample of familial hemiplegic migraine
Brain, February 1, 2007; 130(2): 346 - 356.
[Abstract] [Full Text] [PDF]

Home page
 GeneticsHome page
A. Garg, A. Srivastava, M. M. Davis, S. L. O'Keefe, L. Chow, and J. B. Bell
Antagonizing Scalloped With a Novel Vestigial Construct Reveals an Important Role for Scalloped in Drosophila melanogaster Leg, Eye and Optic Lobe Development
Genetics, February 1, 2007; 175(2): 659 - 669.
[Abstract] [Full Text] [PDF]

Home page
 NeurologyHome page
M. Kirchmann, L. L. Thomsen, and J. Olesen
Basilar-type migraine: Clinical, epidemiologic, and genetic features
Neurology, March 28, 2006; 66(6): 880 - 886.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
A. V. Cideciyan, M. Swider, T. S. Aleman, A. Sumaroka, S. B. Schwartz, M. I. Roman, A. H. Milam, J. Bennett, E. M. Stone, and S. G. Jacobson
ABCA4-Associated Retinal Degenerations Spare Structure and Function of the Human Parapapillary Retina
Invest. Ophthalmol. Vis. Sci., December 1, 2005; 46(12): 4739 - 4746.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
13/9/975    most recent
ddh106v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (15)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Fossdal, R.
Right arrow Articles by Stefansson, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fossdal, R.
Right arrow Articles by Stefansson, K.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?