Human Molecular Genetics Advance Access originally published online on April 6, 2005
Human Molecular Genetics 2005 14(10):1341-1349; doi:10.1093/hmg/ddi144
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Common chromosomal fragile site FRA16D mutation in cancer cells
1ARC Special Research Centre for the Molecular Genetics of Development, ARC-NHMRC Research Network in Genes and Environment in Development, School of Molecular and Biomedical Sciences, The University of Adelaide, Adelaide 5005, South Australia, 2Centre for Medical Genetics, Women's and Children's Hospital, North Adelaide 5006, South Australia, 3Queensland Institute for Medical Research, PO Royal Brisbane Hospital, Queensland 4029, Australia, 4Murdoch Children's Research Institute, Royal Children's Hospital, Parkville, Victoria 3050, Australia, 5Department of Paediatrics, The University of Adelaide, Adelaide 5005, South Australia and 6Department of Cytogenetics, King Edward Memorial Hospital, Subiaco, WA, Australia
* To whom correspondence should be addressed. Tel: +618 83037541; Fax: +618 83034362; Email: robert.richards{at}adelaide.edu.au
Received February 4, 2005; Accepted March 30, 2005
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSSUPPLEMENTARY MATERIALREFERENCES |
|---|
Neither the molecular basis for common fragile site DNA instability nor the contribution of this form of chromosomal instability to cancer is clearly understood. Fragile site FRA16D (16q23.2) is within regions of frequent loss-of-heterozygosity (LOH) in breast and prostate cancers, is associated with homozygous deletions in various adenocarcinomas and t(14;16) chromosomal translocations in multiple myeloma. The FOR (WWOX) gene spans FRA16D and encodes a partner of p53 that also has a role in apoptosis. Previously untested 53 cancer cell lines were screened for deletions within the FOR/WWOX gene. Deletions were detected in Co115, KM12C and KM12SM. Homozygous deletions in these and two previously identified tumour cell lines were intragenic on both alleles, indicating a distinct mutation mechanism from that causing LOH. Identical FRA16D deletions in two cell lines (one derived from the primary carcinoma and the other from a secondary metastasis) demonstrate that FRA16D DNA instability can be an early, transient event. Sequence analysis across one deletion locates one endpoint within a polymorphic AT-dinucleotide repeat and the other adjacent to an AT-rich mini-satellite repeat implicating AT-rich repeats in FRA16D DNA instability. Another deletion is associated with de novo repetition of the 9 bp AT-rich sequence at one of the deletion endpoints. FRA16D deleted cells retain cytogenetic fragile site expression indicating that the deletions are susceptible sites for breakage rather than regions that confer fragility. Most cell lines with FRA16D homozygous deletions also have FRA3B deletions, therefore common fragile sites represent highly susceptible genome-wide targets for a distinct form of mutation.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSSUPPLEMENTARY MATERIALREFERENCES |
|---|
Chromosomal fragile sites are non-staining gaps in metaphase chromosomes that are induced to appear under specific cell culture conditions (1
). There are more than 100 fragile sites in the human genome, distinguished by their frequency in the population and chemistry of induction as well as their physical location. Rare (or inherited) fragile sites are found in <5% of individuals and are induced by various chemicals, some of which perturb nucleotide levels and others that preferentially bind certain DNA sequences. The study of various rare chromosomal fragile sites has provided insight into the novel genetic mechanism of repeat expansion termed dynamic mutation (2). All rare fragile sites characterized to date are due to the expansion of the longest normal alleles of a polymorphic DNA repeat beyond a particular copy number threshold (3). Common (or constitutive) fragile sites are found in all individuals. Recently trans-acting factors ATR, BRCA1, SMC and the Fanconi Anaemia pathway have been shown to be involved in common fragile site expression (4–7). These factors and pathways further implicate replication stalling as the mechanism of cytogenetic expression. However, the DNA sequence requirements (cis-acting elements) of common fragile sites are not yet understood. Increased DNA flexibility at fragile site loci, manifesting as clustering of ‘FlexStab’ peaks, has been noted using a computer based algorithm (8,9). Whether the DNA sequences responsible for FlexStab peaks are necessary and sufficient for common fragile site expression has not been directly tested.
On the basis of the observation that common fragile sites are located at or near structural chromosome defects known in various cancers, Yunis and Soreng (10) proposed that fragile sites are susceptible to DNA instability in cancer and that such instability contributes to neoplasia by virtue of altered expression of the associated genes. A relationship (if any) between rare fragile sites and cancer is not clear. In general, individuals with rare chromosomal fragile sites are at no greater risk of cancer (11). The folate sensitive fragile site FRA11B is located within the 5'-untranslated region of the c-CBL proto-oncogene and despite predisposing to the 11q-breakage seen in some cases of Jacobsen syndrome, this fragile site does not appear to be associated with increased cancer risk (12,13). On the other hand, higher copy number alleles of the CCG repeat (that, when expanded, gives rise to folate sensitive rare fragile sites) are found at higher frequency in individuals with chronic myeloid leukaemia (CML) (14). Moreover, CML patients with these higher copy number alleles have a poorer prognosis.
A clearer picture of the role of DNA instability at common fragile sites in cancer has begun to emerge (1,15). Homozygous deletion at the most readily inducible common fragile site, FRA3B, is very frequent in cancer cells, particularly in those from tissues exposed to highest levels of environmental mutagens (16,17). The FHIT gene spanning FRA3B is usually inactivated by such deletion resulting in loss of FHIT function. Mutation of one allele of the Fhit gene in transgenic mice renders these mice more susceptible to chemical mutagenesis (18). This susceptibility can be ‘rescued’ by means of Fhit gene therapy (19). Therefore loss of function of Fhit protein mediates the increased susceptibility to further mutation, rather than the alternative possibility that a chromosome-structure related role for the FRA3B fragile site contributes to mutagen susceptibility (e.g. via an effect on chromosomal stability).
Similarly, homozygous deletions at the second most readily induced common fragile site, FRA16D, at 16q23.2 have been detected in cell lines derived from adenocarcinomas of the stomach, lung, breast, ovary and colon (20–22). A gene (FOR, WWOX, WOX1) spanning FRA16D has been identified (9) and some of its functional characteristics determined (22–24). In addition, t(14;16) translocations have been found to map within the 16q23.2 region in 
25% of cases of multiple myeloma and breakpoints for four out of five of these are located within the FOR gene (20,25,26). FOR gene expression is reportedly elevated in some breast cancer cell lines (27) but reduced in breast tumour tissue (28), whereas the adjacent c-MAF proto-oncogene is increased in expression in t(14;16) translocated multiple myeloma cells (25). Therefore multiple genes may be affected by FRA16D associated DNA instability.
In this report, we address several key aspects of the mutation mechanism that gives rise to homozygous deletion at the FRA16D fragile site in cancer cells. First, the timing of the deletion event in the neoplastic process, as it is assumed that early events are more likely to be causal rather than consequential. Secondly, the relationship between FRA16D associated deletion and another form of deletion (loss-of-heterozygosity, LOH) known to occur at high frequency in certain cancers in the 16q23.2 region. Thirdly, the nature of the deletion endpoints and any identifiable characteristics of the sequences at or near these deletion endpoints. Fourthly, the extent of ‘genome-wide’ instability that occurs in FRA16D deleted cell lines. Finally, the effect of FRA16D associated deletions on the cytogenetic expression of the FRA16D fragile site.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSSUPPLEMENTARY MATERIALREFERENCES |
|---|
Timing and stability of FRA16D deletion in tumourigenesis
Various tumour cell lines have previously been identified as containing FRA16D associated homozygous deletions (20
,21). This included a screen of seven FRA3B containing cell lines in our laboratory of which one (AGS) had FRA16D deletions (20) and the HCT116 cell line identified by others (21). However, the relative frequency and timing of this form of mutation have not been characterized. Therefore we have screened an additional 53 tumour cell lines for FRA16D associated homozygous deletions and detected three new cell lines with homozygous deletions at FRA16D (Table 1). Detailed mapping of the FRA16D deletion endpoints in cancer cell lines was conducted using multiplex PCRs (see Supplementary Material) [refer Ried et al. (9) and Mangelsdorf et al.(20) for experimental details]. Two of these cell lines (KM12C and KM12SM) originated from a single patient (KM12) with colorectal cancer of Dukes' B2 stage (29). The KM12C cell line was derived from the primary tumour obtained by the injection of the parental (KM12) cells into the spleen of a nude mouse. The KM12SM cell line was derived from a spontaneous metastasis in the liver of the nude mouse. The KM12SM cell line, therefore, represents a metastatic derivative and the KM12C cell line a primary tumour derivative, both originating from the same primary human carcinoma. Karyotype and isoenzyme analysis of KM12SM has revealed that this cell line is predominantly tetraploid and has elevated type IV collagenolytic activity compared with the KM12C cell line (29). No evidence of ongoing instability at FRA16D was found despite marked differences in the karyotype of the KM12C and KM12SM cell lines (Fig. 1). The KM12SM line has at some point undergone the duplication of its chromosome complement, yet only eight chromosomes remain tetraploid, others having increased or decreased in number, and whereas the KM12C line appears more stable in terms of chromosome copy number, it has undergone chromosomal instability distinct from that of KM12SM, notably a t(2;16) translocation. The identical extent of FRA16D deletion in the KM12C and KM12SM cell lines (Fig. 2) demonstrates that this FRA16D fragile site associated deletion event occurred at an early stage in the progression of the carcinoma and remained stable in the presence of other forms of chromosomal instability.
|
|
|
The previously identified AGS and HCT116 cell lines were found by the analysis of a more detailed set of STS markers (Fig. 2 and Supplementary Material) to contain the presence of two or more distinct homozygous deletions (Fig. 2). We analysed HCT116 cells from three different sources and found that the homozygous deletion in these cells was identical; supporting the likelihood that the instability that causes the deletion is transient (unpublished results). In all FRA16D deleted cell lines described here, a common region of deletion was identified that included the previously described FlexStab1 AT peak (9
). FlexStab1 is the most flexible (FlexStab score 18) of six peaks of flexibility clustering in the FRA16D region, the other peaks having a score of 14, whereas most human chromosomal DNA scores between nine and 12 for the FlexStab algorithm (8,9).
Correlations between frequency and extent of cytogenetic fragility and DNA instability
Chromosomal fragile sites are the in vitro consequences of culturing cells in the presence of certain chemicals. The relationship between this in vitro ‘fragility’ and the in vivo DNA instability observed as homozygous deletion, is as yet unclear. The common fragile sites are observed with differing frequencies—FRA3B being most frequently observed followed by FRA16D, FRAXB, FRA7G and FRA7H. We therefore investigated whether cell lines with known deletion at one of these fragile sites were also deleted for any of the other fragile sites for which locations of fragile site DNA sequences have been determined. The majority (4/5) of FRA16D deleted cell lines also have FRA3B deletion, whereas only a minority (4/10) of FRA3B deleted cell lines have FRA16D deletions (Table 1). Homozygous deletion at multiple fragile site loci suggests a common molecular mechanism with common trans-acting factor(s). The higher frequency of observed in vivo homozygous deletion at FRA3B compared with that at FRA16D is consistent with the higher frequency of observed in vitro cytogenetic fragility observed at FRA3B than at FRA16D, suggesting that there may be a causal relationship between in vitro fragility and in vivo DNA instability which is determined, at least in part, by cis-acting elements, i.e. the primary DNA sequences which constitute the respective fragile site regions of the genome.
Similarly, we sought to determine whether the extent of fragility at a fragile site locus, previously determined by high resolution in situ hybridization (20), correlated with the extent of homozygous deletion in cancer cell lines. Homozygous deletions were found as multiple events in three cell lines (AGS, Co115 and HCT116). In all cases, including those with multiple deletions, the extent of deletion is confined to the same 270 kb DNA within which the vast majority (942/972 of in situ hybridization signals or 97%) of chromosome breakage at FRA16D is found to map upon fragile site induction (20) (Fig. 2).
Relationship between FRA16D homozygous deletion and 16q23.2 LOH
LOH has been identified in the 16q23.2 region in prostate and breast cancers (30,31) and it was based on this LOH that Bednarek et al. (22) identified the WWOX gene also identified by others (9) as the FOR gene spanning FRA16D or the WOX1 gene induced by hyaluronidase (23). Two polymorphic markers (D16S518 and D16S504), that define the boundaries of the prostate and breast cancer regions of heterozygous loss, were found to be heterozygous in all cancer cells with homozygous FRA16D deletions (Fig. 2). As the D16S518 and D16S504 markers are intragenic to the FOR/WWOX gene, the homozygous deletions are therefore localized events that do not extend beyond the FOR/WWOX gene in contrast to the LOH deletions that can extend over very large regions spanning 16q23.2. Therefore, it is unlikely that the FRA16D fragile site represents a ‘boundary’ of the extensive LOH deletion events. The LOH and homozygous deletion events are quite distinct and therefore are likely to have different mutation mechanisms and/or genetic/environmental causes.
Deletion endpoints and the role of repeats in fragility
Previously, we have mapped the endpoints of several homozygous deletions by duplex PCR analysis to regions spanning peaks of DNA ‘flexibility’ (9). The exact position of 20 endpoints in the available cancer cell lines with FRA16D associated homozygous deletions was determined by detailed duplex PCR mapping (Fig. 2 and Supplementary Material). In only one case, it is possible for any two of the deletion endpoints in unrelated cell lines to coincide, therefore there are no common endpoints associated with FRA16D associated homozygous deletion in cancer cells and therefore no apparent ‘hotspots’ for breakage. Long range PCRs were established across three of these deletions enabling the DNA sequence spanning the deletion endpoints to be determined. The DNA endpoints at each end of one of the homozygous deletions in the HCT116 cell line are either within an AT-dinucleotide repeat [corresponding to FlexStab 1 in Ried et al. (9)] or adjacent to (1 kb away) an AT-rich mini-satellite (Fig. 3). The sequences giving rise to the FlexStab1 region (9) are either deleted or present at the endpoint boundary, in all of the cancer cell lines with FRA16D deletions analysed here. As the AT-dinucleotide repeat does appear to represent a preferred target for instability, we undertook PCR analysis of the repeat in order to determine whether there is variation in copy number between individuals and whether any such copy number variation might contribute to variation in cytogenetic expression of FRA16D. The PCR analysis of 78 individuals demonstrated an extremely high level of copy number polymorphism (PCR analysis for 35 individuals is shown in Fig. 4A) with an observed heterozygosity of 97% in 25 different alleles. This high level of copy number variation prompted an analysis of the transmission of the repeat through a CEPH pedigree to ascertain the degree of repeat instability. Mendelian inheritance was observed with no evidence of copy number instability through the three generations tested (unpublished results). Therefore, the AT dinucleotide is stable in germ-line transmission and does not represent a hyper-mutable sequence. We also looked for a relationship between the copy number of the repeat in an individual and the percentage of metaphases expressing the FRA16D fragile site. No correlation between fragile site expression level and AT-repeat copy number was observed (Fig. 4B), suggesting that if the variation in copy number of the AT-dinucleotide repeat does contribute to fragile site expression levels, then this contribution is not rate limiting and other factors (e.g. trans-acting factors) have a greater effect on fragile site expression levels.
|
|
Sequence analysis of the Co115 deletion no. 1 endpoints (Fig. 3) revealed that a 9 bp sequence located at the proximal endpoint has been the subject of de novo amplification to give six additional copies (seven in total) of the 9 bp repeat TTTCATATG. The molecular process responsible for the fragile site associated deletion of DNA is therefore able to facilitate the de novo generation of DNA repeat sequences upon repair of the damaged DNA.
Cytogenetic FRA16D expression in cells with FRA16D homozygous deletion
It has been proposed (32) that flexible DNA sequences, such as the FlexStab1 AT repeat, play a causative role in chromosomal fragile site expression. The large homozygous deletions in the FRA16D region afford the opportunity to assess whether any or all of the deleted sequences are necessary for the cytogenetic expression of the chromosomal fragile site. Therefore, we analysed those cell lines with homozygous FRA16D associated deletions that spanned the FlexStab1 AT-dinucleotide repeat deletion for cytogenetic expression of FRA16D. All of these cell lines still exhibit FRA16D cytogenetically and in two cell lines, FRA16D was observed on each of the chromosome 16s present (Fig. 5). These results indicate that the FlexStab1 sequences are not necessary for fragile site expression.
|
Similarly, those cell lines with FRA3B associated deletions were still able to express FRA3B (Fig. 5). This suggests that the deleted sequences are not necessary for cytogenetic expression and appear to be the most likely ‘high-risk’ targets for breakage when it is going to occur.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSSUPPLEMENTARY MATERIALREFERENCES |
|---|
Cytogenetically distinguishable, aphidicolin inducible common chromosomal fragile sites are located at >70 sites around the human genome (1
). These sites vary in their sensitivity to induction with FRA3B being the most frequently observed, followed by FRA16D then FRAXB, FRA7G and FRA7H. Homozygous deletion is normally a rare event in the human genome; however, the FRA3B fragile site has been found to be subjected to frequent homozygous deletion in cancer. In order to determine whether the events at FRA3B were generally applicable to other fragile sites in the ‘common’ or ‘constitutive’ category, we have undertaken a molecular analysis of the FRA16D fragile site and its associated DNA instability in cancer cells.
Mutation events that occur early in tumourigenesis are thought more likely to contribute to cancer cell biology than later mutation events. Later events may simply be a consequence of genome-wide DNA instability brought about by loss of DNA repair function. The timing of DNA instability at common fragile sites in cancer was determined by analysing FRA16D homozygous deletions in two cancer cell lines (KM12C and KM12SM) at different stages of cancer progression but originating from the same primary tumour. Indeed, the common clonal origin of these cell lines is demonstrated by their identical deletion endpoint boundaries at the FRA16D locus. Therefore, the FRA16D deletion in the KM12 derived cell lines preceded the genetic events that led to the metastatic KM12SM cell lineage. A great deal of chromosomal instability is evident in the KM12SM cell line (Fig. 1), whereas a distinct translocation event, t(2;16), has taken place in the relatively stable KM12C cell line. However, no additional mutation at the FRA16D locus is evident supporting an early role for this form of mutation and suggesting that once fragile site associated mutation does occur then the resultant sequences are able to remain stable even in the presence of other forms of extensive chromosomal instability. It is likely that the DNA instability is the result of some sort of environmental factor or stress under which the cell is temporarily placed and once this is relieved then no further mutation takes place. Corbin et al. (33) have found that additional FRA3B mutations have been found in somatic cell derivatives of cancer cells with FRA3B associated homozygous deletions. It may well be that such additional instability is a result of environmental factors associated with the derivation of these cell lines, or alternatively, that the higher incidence of FRA3B fragility may render it prone to substantially more DNA instability than the FRA16D locus.
If there is a direct causal relationship between chromosomal fragility and DNA instability at common fragile site loci, it would be expected that the likelihood of observing fragile site associated breakage in cancer cells would correlate with the frequency with which the various fragile sites are observed cytogenetically. As FRA3B is the most readily observed fragile site, it would therefore be expected to exhibit the highest frequency of homozygous deletion. The finding that FRA16D associated homozygous deletions are found in some, but not all, cancer cell lines exhibiting FRA3B associated homozygous deletions is consistent with a causal relationship between cytogenetic fragility and homozygous deletion in cancer cells.
FRA16D is located in the overlap between frequent LOH regions identified on 16q23 in breast and prostate cancers. Indeed Bednarek et al. (22) identified the FOR/WWOX gene on the basis of its location within the breast cancer 16q23 LOH region. The potential therefore exists that FRA16D acts as a frequent boundary for the deletions that give rise to LOH and that the homozygous deletions observed in some carcinomas are merely the manifestation of overlapping and more extensive LOH regions. Analysis of polymorphic markers flanking the FRA16D region demonstrates that in all the cell lines with a homozygous FRA16 deletion, the adjacent flanking sequences are still present for both parental chromosomes. Therefore, the mechanism giving rise to homozygous FRA16D deletions appears to be quite distinct from that giving rise to LOH deletion.
The homozygous deletion of DNA sequences in the FRA16D region affords the opportunity to assess the contribution of these deleted sequences to cytogenetic expression of the fragile site. If the deleted sequences either contribute to or are essential for fragile site expression then their deletion would be expected to either reduce the frequency of fragile site expression or abolish it altogether. No evidence of an impact of deletion on fragile site expression could be found. In the HCT116 cell line, the two chromosome 16s can be distinguished by a translocation onto 16p and both the normal and derivative chromosome 16s express the fragile site. This observation rules out the trivial explanation that the extent of deletion is sufficient to obliterate expression of only one of the two chromosome homologues. Levels of common fragile site expression vary markedly within the population and between different cell lines and therefore quantitative effects are extremely difficult to determine (34,35) [Fig. 4B which reveals 2-fold variation (29–59%) in the expression of FRA16D between individuals]. Although a quantitative effect on the level of expression cannot be ruled out, the frequency of cytogenetic expression in the cell lines was not remarkably below that observed in cell lines without FRA16D deletions. The deletions of the FlexStab regions (FlexStab1 in particular) are therefore noteworthy, because these regions have been proposed to play a causative role in fragile site expression (32). Given that chromosome fragility plays a causal role in the mechanism of homozygous deletion, then chromosomes with FRA16D deletions will still be able to undergo further deletion should the necessary environmental conditions again arise. This may explain the frequent observation of multiple homozygous deletions in single cancer cell lines (AGS, HCT116 and Co115), as each deletion could represent an independent event during the exposure of the cell to the conditions conducive to homozygous deletion.
Analysis of the homozygous deletion endpoints reveals a substantial degree of heterogeneity with only two of the 20 mapped endpoints possibly coinciding. This observation may be somewhat misleading given that the endpoints actually represent the outcomes of repair processes rather than the actual initial sites of breakage. The region spanning the previously described FlexStab1 region is commonly deleted in each of the cell lines with FRA16D homozygous deletion suggesting that this region is prone to instability, however, the relationship between the FlexStab1 AT repeat and this instability is unclear. No evidence of a causative role could be found. Indeed, it is noteworthy that despite the conservation of the relationship between a chromosomal fragile site and the FOR/WWOX gene between mouse and human, and the high level of sequence homology found in parts of the respective exon 8 sequences between mouse and human homologues, that the mouse does not have the corresponding FlexStab1 sequences conserved. In this regard, the deletion endpoint of particular note is that in Co115 cells where a sequence of nine bases is copied six times to give rise to a de novo repeat. This finding suggests that the mechanism of DNA instability caused by the presence of a chromosomal fragile site can actually lead to the formation of a DNA repeat sequence. This brings into question the relationship between repeat sequences and fragile sites, as instead of the presence of repeat sequences causing fragile site expression, it may well be that the presence of a fragile site can lead to the formation of repeat sequences.
In conclusion, a substantial body of evidence (presented here and elsewhere) suggests that common fragile sites are regions of particular sensitivity to DNA instability and that there is a correlation between the level of in vitro chromosomal fragility and in vivo DNA instability in cancer cells. The localized multiple-hit nature of the homozygous mutation together with its subsequent (relative) stability suggests that it is most likely that an interaction between environmental and trans-acting factors plays a determining role in the common fragile site associated mutation mechanism.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSSUPPLEMENTARY MATERIALREFERENCES |
|---|
Cell lines
The AGS, HCT116, LoVo, HT29, KatoIII, SW480, MDA-MB436 and LS180 tumour cell lines were from the collection of the Centre for Medical Genetics, Women's and Children's Hospital and were grown as previously described (18
). Co115, KM12C and KM12SM and other tumour cell lines (mainly derived from colon carcinomas) were from the collection of the Queensland Institute for Medical Research, Royal Brisbane Hospital.
PCR and DNA sequence analysis
Duplex PCR was performed on DNA isolated from cultured cell lines according to the methods of Mangelsdorf et al. (18) and Ried et al. (21). Primers used in deletion mapping are indicated in Supplementary Material, Table S1. Most of the PCR primer oligonucleotide sequences are as reported in Ried et al. (9). Additional primer sequences may be obtained upon request. DNA sequence analysis of PCR products was performed at the Institute of Medical and Veterinary Science (Adelaide, South Australia) DNA sequencing facility using Applied Biosystems chemistry and equipment. The software program Lasergene (DNASTAR Inc., Madison, WI, USA) was used to analyse DNA sequences. FlexStab1 AT repeat allele copy numbers were determined by incorporating 
32P-dCTP into the PCR products and then electrophoresis on acrylamide gels. Oligodeoxynucleotide primers for FlexStab1 AT-repeat copy number genotyping were GCATGAGTGGTGATGGATGT and GGACAGAACTAACCCAGAGA.
Metaphase preparation and fragile site induction
Metaphases were prepared by standard methods. Briefly, cultures were grown for 72 h in Eagle's essential medium, minus folic acid, supplemented with 5% FCS. Induction of FRA16D was with 0.4 µM aphidicolin dissolved in DMSO added 24 h before harvest. Fifty metaphases were scored for the percentage of chromosome 16s expressing FRA16D in all but one individual in whom 100 metaphases were scored.
|
SUPPLEMENTARY MATERIAL |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSSUPPLEMENTARY MATERIALREFERENCES |
|---|
Supplementary Material is available at HMG Online.
|
ACKNOWLEDGEMENTS |
|---|
We wish to thank Donna Crack, Louise O'Keefe and Amanda Lumsden for constructive criticism of drafts of this manuscript. R.I.R. thanks Shelley Richards for support and encouragement. This work was supported in part by grants to R.I.R. from the Cancer Council of South Australia and the National Health and Medical Research Council of Australia.
Conflict of Interest statement: None declared.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSSUPPLEMENTARY MATERIALREFERENCES |
|---|
- Richards, R.I. (2001) Fragile and unstable chromosomes in cancer: causes and consequences. Trends Genet., 17, 339–345.[CrossRef][ISI][Medline]
- Richards, R.I. and Sutherland, G.R. (1997) Dynamic mutation: possible mechanism and significance in human disease. Trends Biochem. Sci., 22, 432–436.[CrossRef][ISI][Medline]
- Sarafidou, T., Kahl, C., Martinez-Garay, I., Mangelsdorf, M., Gesk, S., Baker, E., Kokkinaki, M., Talley, P., Maltby, E.L., French, L. et al. (2004) Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein. Genomics, 84, 69–81.[CrossRef][ISI][Medline]
- Casper, A.M., Nghiem, P., Arlt, M.F. and Glover, T.W. (2002) ATR regulates fragile site stability. Cell, 111, 779–789.[CrossRef][ISI][Medline]
-
Arlt, M.F., Xu, B., Durkin, S.G., Casper, A.M., Kastan, M.B. and Glover, T.W. (2004) BRCA1 is required for common-fragile-site stability via its G2/M checkpoint function. Mol. Cell. Biol., 24, 6701–6709.
[Abstract/Free Full Text] -
Musio, A., Montagna, C., Mariani, T., Tilenni, M., Focarelli, M.L., Brait, L., Indino, E., Benedetti, P.A., Chessa, L., Albertini, A., Ried, T. and Vezzoni, P. (2005) SMC involvement in fragile site expression. Hum. Mol. Genet., 14, 525–533.
[Abstract/Free Full Text] -
Howlett N.G., Taniguchi T., Durkin S.G. and D'Andrea A Glover T.W. (2005) The Fanconi anemia pathway is required for the DNA replication stress response and for the regulation of common fragile site stability. Hum. Mol. Genet., 14, 693–701.
[Abstract/Free Full Text] -
Mishmar, D., Rahat, A., Scherer, S.W., Nyakatura, G., Hinzman, B., Kowi, Y., Mandel-Gutfroind, Y., Lee, J.R., Drescher, B., Sas, D.E. et al. (1998) Molecular characterisation of a common fragile site (FRA7H) on human chromosome 7 by the cloning of an SV40 integration site. Proc. Natl Acad. Sci. USA, 95, 8141–8146.
[Abstract/Free Full Text] -
Ried, K., Finnis, M., Hobson, L., Mangelsdorf, M., Dayan, S., Nancarrow, J.K., Woollatt, E., Kremmidiotis, G., Gardner, A., Venter, D., Baker, E. and Richards, R.I. (2000) Common chromosomal fragile site FRA16D DNA sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells. Hum. Mol. Genet., 9, 1651–1663.
[Abstract/Free Full Text] -
Yunis, J.J. and Soreng, A.L. (1984) Constitutive fragile sites and cancer. Science, 226, 1199–1204.
[Abstract/Free Full Text] - Sutherland, G.R. and Baker, E. (2000) The clinical significance of fragile sites on human chromosomes. Clin. Genet., 58, 157–161.[CrossRef][ISI][Medline]
-
Jones, C., Slijepcevic, P., Marsh, S., Baker, E., Langdon, W.Y., Richards, R.I. and Tunnacliffe, A. (1994) Physical linkage of the fragile site FRA11B and a Jacobsen syndrome chromosome deletion breakpoint in 11q23.3. Hum. Mol. Genet., 3, 2123–2130.
[Abstract/Free Full Text] - Jones, C., Penny, L., Mattina, T., Yu, S., Baker, E., Voullaire, L., Langdon, W.Y., Sutherland, G.R., Richards, R.I. and Tunnacliffe, A. (1995) Association of a chromosome deletion syndrome with a fragile site within the proto-oncogene CBL2. Nature, 376, 145–149.[CrossRef][Medline]
-
Auer, R.L., Jones, C., Mullenbach, R.A., Syndercombe-Court, D., Milligan, D.W., Fegan, C.D. and Cotter, F.E. (2001) Role for CCG-trinucleotide repeats in the pathogenesis of chronic lymphocytic leukemia. Blood, 97, 509–515.
[Abstract/Free Full Text] - Huebner K. and Croce C.M. (2002) FRA3B and other common fragile sites: the weakest links. Nat. Rev. Cancer, 1, 214–221.
- Ohta, M., Inoue, H., Cotticelli, M.G., Kastury, K., Baffa, R., Palazzo, J., Siprashvilli, Z., Mori, M., McCue, P., Druck, T., Croce, C.M. and Huebner, K. (1996) The FHIT gene, spanning the chromosome 3p14.2 fragile site and renal carcinoma-associated t(3;8) breakpoint, is abnormal in digestive tract cancers. Cell, 84, 587–597.[CrossRef][ISI][Medline]
- Huebner, K., Garrison, P.N., Barnes, L.D. and Croce, C.M. (1998) The role of the FHIT/FRA3B locus in cancer. Ann. Rev. Genet., 32, 7–31.[CrossRef][ISI][Medline]
-
Fong, L.Y.Y., Fidanza, V., Zanesi, N., Lock, L.F., Siracusa, L.D., Mancini, R., Siprashvili, Z., Ottey, M., Martin, S.E., Druck, T. et al. (2000) Muir–Torre-like syndrome in Fhit-deficient mice. Proc. Natl Acad. Sci. USA, 97, 4742–4747.
[Abstract/Free Full Text] -
Dumon, K.R., Ishii, H., Fong, L.Y., Zanesi, N., Fidanza, V., Mancini, R., Vecchione, A., Baffa, R., Trapasso, F., During, M.J., Huebner, K. and Croce, C.M. (2001) FHIT gene therapy prevents tumor development in Fhit-deficient mice. Proc. Natl Acad. Sci. USA, 98, 3346–3351.
[Abstract/Free Full Text] -
Mangelsdorf, M., Ried, K., Woollatt, E., Dayan, S., Eyre, H., Finnis, M., Hobson, L., Nancarrow, J., Venter, D., Baker, E. and Richards, R.I. (2000) Chromosomal fragile site FRA16D and DNA instability in cancer. Cancer Res., 60, 1683–1689.
[Abstract/Free Full Text] -
Paige, A.J.W., Taylor, K.J., Stewart, A., Sgouros, J., Gabra, H., Smyth, J.F., Porteous, D.J.and Watson, J.E.V. (2000) A 700 kb physical map of a region of 16q23.2 homozygously deleted in multiple cancers and spanning the common fragile site FRA16D. Cancer Res., 60, 1690–1696.
[Abstract/Free Full Text] -
Bednarek, A.K., Laflin, K.J., Daniel, R.L., Liao, Q., Hawkins, K.A. and Aldaz, C.M. (2000) WWOX, a novel WW domain-containing protein mapping to human chromosome 16q23.3-24.1, a region frequently affected in breast cancer. Cancer Res., 60, 2140–2145.
[Abstract/Free Full Text] -
Chang, N.S., Pratt, N., Heath, J., Schultz, L., Sleve, D., Carey, G.B. and Zevotek, N. (2001) Hyaluronidase induction of a WW domain-containing oxidoreductase that enhances tumor necrosis factor cytotoxicity. J. Biol. Chem., 276, 3361–3370.
[Abstract/Free Full Text] - Chang N.S., Doherty J., Ensign A., Lewis J., Heath J., Schultz L., Chen S.T. and Oppermann U. (2003) Molecular mechanisms underlying WOX1 activation during apoptotic and stress responses. Biochem. Pharmacol., 66, 1347–1354.[CrossRef][ISI][Medline]
-
Chesi, M., Bergsagel, P.L., Shonukan, O.O., Martelli, M.L., Brents, L.A., Chen, T., Schrok, E., Ried, T. and Kuehl, W.M. (1998) Frequent dysregulation of the c-MAF proto-oncogene at 16q23 by translocation to an Ig locus in multiple myeloma. Blood, 91, 4457–4463.
[Abstract/Free Full Text] - Krummel, K.A., Denison, S.R., Calhoun, E., Phillips, L.A. and Smith, D.I. (2002) The common fragile site FRA16D and its associated gene WWOX are highly conserved in the mouse at Fra8E1. Genes Chrom. Cancer., 34, 154–167.[CrossRef][ISI][Medline]
-
Bednarek, A.K., Keck-Waggoner, C.L., Daniel, R.L., Laflin, K.J., Bergsagel, P.L., Kiguchi, K., Brenner, A.J. and Aldaz, C.M. (2001) WWOX, the FRA16D gene, behaves as a suppressor of tumor growth. Cancer Res., 61, 8068–8073.
[Abstract/Free Full Text] - Driouch, K., Prydz, H., Monese, R., Johansen, H., Lidereau, R. and Frengen, E. (2002) Alternative transcripts of the candidate tumor suppressor gene, WWOX, are expressed at high levels in human breast tumors. Oncogene, 21, 1832–1840.[CrossRef][ISI][Medline]
-
Morikawa, K., Walker, S.M., Nakajima, M., Pathak, S., Jessup, J.M. and Fidler, I.J. (1988) Influence of organ environment on the growth, selection, and metastasis of human colon carcinoma cells in nude mice. Cancer Res., 48, 6863–6871.
[Abstract/Free Full Text] -
Latil, A., Cussenot, O., Fournier, G., Driouch, K. and Lidereau, R. (1997) Loss of heterozygosity at chromosome 16q in prostate adenocarcinoma: identification of three independant regions. Cancer Res., 57, 1058–1062.
[Abstract/Free Full Text] - Driouch, K., Dorion-Bonnet, F., Briffod, M., Champeme, M.H., Longy, M. and Lidereau, R. (1997) Loss of heterozygosity on chromosome arm 16q in breast cancer metastases. Genes Chrom. Cancer, 19, 185–191.[CrossRef][ISI][Medline]
-
Zlotorynski E., Rahat A., Skaug J., Ben-Porat N., Ozeri E., Hershberg R., Levi A., Scherer S.W., Margalit H. and Kerem B. (2003) Molecular basis for expression of common and rare fragile sites. Mol. Cell. Biol., 23, 7143–7151.
[Abstract/Free Full Text] -
Corbin, S., Neilly, M.E., Espinosa, R., III, Davis, E.M., McKeithan, T.W. and Le Beau, M.M. (2002) Identification of unstable sequences within the common fragile site at 3p14.2: implications for the mechanism of deletions within fragile histidine triad gene/common fragile site at 3p14.2 in tumors. Cancer Res., 62, 3477–3484.
[Abstract/Free Full Text] - Rao, P.N., Heerema, N.A. and Palmer, C.G. (1988) Fragile sites induced by FudR, caffeine and aphidicolin. Their frequency, distribution and analysis. Hum. Genet., 78, 21–26.[CrossRef][ISI][Medline]
- Tunca, B., Egeli, U., Zorluoglu, A., Yilmazlar, T., Yerci, O. and Kizil, A. (2000) The expression of fragile sites in lymphocytes of patients with rectum cancer and their first-degree relatives. Cancer Lett., 152, 201–209.[CrossRef][ISI][Medline]
-
Arlt, M.F., Miller, D.E., Beer, D.G. and Glover, T.W. (2002) Molecular characterization of FRAXB and comparative common fragile site instability in cancer cells. Genes Chrom. Cancer, 33, 8292.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  A. Varshavsky From the Cover: Targeting the absence: Homozygous DNA deletions as immutable signposts for cancer therapy PNAS, September 18, 2007; 104(38): 14935 - 14940. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Nymark, H. Wikman, S. Ruosaari, J. Hollmen, E. Vanhala, A. Karjalainen, S. Anttila, and S. Knuutila Identification of Specific Gene Copy Number Changes in Asbestos-Related Lung Cancer Cancer Res., June 1, 2006; 66(11): 5737 - 5743. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N.-S. Chang, J. Doherty, A. Ensign, L. Schultz, L.-J. Hsu, and Q. Hong WOX1 Is Essential for Tumor Necrosis Factor-, UV Light-, Staurosporine-, and p53-mediated Cell Death, and Its Tyrosine 33-phosphorylated Form Binds and Stabilizes Serine 46-phosphorylated p53 J. Biol. Chem., December 30, 2005; 280(52): 43100 - 43108. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. W. Glover, M. F. Arlt, A. M. Casper, and S. G. Durkin Mechanisms of common fragile site instability Hum. Mol. Genet., October 15, 2005; 14(suppl_2): R197 - R205. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F.-J. Lai, C.-L. Cheng, S.-T. Chen, C.-H. Wu, L.-J. Hsu, J. Y.-Y. Lee, S.-C. Chao, M.-C. Sheen, C.-L. Shen, N.-S. Chang, et al. WOX1 Is Essential for UVB Irradiation-Induced Apoptosis and Down-Regulated via Translational Blockade in UVB-Induced Cutaneous Squamous Cell Carcinoma In vivo Clin. Cancer Res., August 15, 2005; 11(16): 5769 - 5777. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||