Human Molecular Genetics Advance Access originally published online on April 20, 2005
Human Molecular Genetics 2005 14(12):1605-1611; doi:10.1093/hmg/ddi168
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gemins modulate the expression and activity of the SMN complex


Howard Hughes Medical Institute, Department of Biochemistry and Biophysics, University of Pennsylvania School of Medicine, Philadelphia, PA 19104-6148, USA
* To whom correspondence should be addressed. Tel: +1 2158980398; Fax: +1 2155732000; Email: gdreyfuss{at}hhmi.upenn.edu
Received February 18, 2005; Accepted April 17, 2005
| ABSTRACT |
|---|
|
|
|---|
Reduction in the expression of the survival of motor neurons (SMN) protein results in spinal muscular atrophy (SMA), a common motor neuron degenerative disease. SMN is part of a large macromolecular complex (the SMN complex) that includes at least six additional proteins called Gemins (Gemin27). The SMN complex is expressed in all cells and is present throughout the cytoplasm and in the nucleus where it is concentrated in Gems. The SMN complex plays an essential role in the production of spliceosomal small nuclear ribonucleoproteins (snRNPs) and likely other RNPs. To study the roles of the individual proteins, we systematically reduced the expression of SMN and each of the Gemins (26) by RNA interference. We show that the reduction of SMN leads to a decrease in snRNP assembly, the disappearance of Gems, and to a drastic reduction in the amounts of several Gemins. Moreover, reduction of Gemin2 or Gemin6 strongly decreases the activity of the SMN complex. These findings demonstrate that other components of the SMN complex, in addition to SMN, are critical for the activity of the complex and suggest that Gemin2 and Gemin6 are potentially important modifiers of SMA as well as potential disease genes for non-SMN motor neuron diseases.
| INTRODUCTION |
|---|
|
|
|---|
Spinal muscular atrophy (SMA) is an autosomal recessive neurodegenerative disease, which is characterized by the degeneration of motor neurons in the spinal cord (1
The SMN protein oligomerizes and forms a stable multi-protein complex that consists of SMN, Gemin2 (formerly SIP1), Gemin3 (a DEAD-box RNA helicase), Gemin4, Gemin5 (a WD-repeat protein), Gemin6 and Gemin7. SMN binds directly to Gemin2, 3, 5 and 7, whereas Gemin4 and 6 require Gemin3 and 7, respectively, for interaction with SMN (14
19
). In addition to these integral components of the SMN complex, numerous other proteins have been reported to bind to SMN. These proteins, referred to as SMN complex substrates, include Sm and Sm-like (LSm) proteins (14
,20
22
), RNA helicase A (23
), fibrillarin and GAR1 (24
,25
), the RNP proteins hnRNP U (26
), hnRNP Q (27
,28
) and hnRNP R (28
), as well as p80-coilin (29
), the protein marker for Cajal (coiled) bodies. A common feature among these substrates is the presence of a domain rich in arginine and glycine residues that is essential for the interaction with SMN. SMN, but not SMN mutants present in SMA patients, binds directly to these RG-rich substrates, indicating a strong correlation between the SMA phenotype and the defective interaction of SMN with its substrates (20
25
,27
29
). Strikingly, most of these substrates are associated with various types of RNP complexes, which suggests that SMN has a role in diverse aspects of RNA metabolism. Indeed, studies in Xenopus laevis oocytes and mammalian cells have shown that SMN is involved in several aspects of cellular RNA metabolism including snRNP assembly, pre-mRNA splicing, transcription and possibly the biogenesis of small nucleolar RNPs (snoRNPs) (21
,23
25
,30
35
). In addition, several other SMN-interacting proteins have been described that neither contain RG-rich motifs nor are they known to interact with RNPs such as ZPR1, profilin, p53 and the FUSE binding protein (36
39
).
The SMN complex is present in the cytoplasm as well as the nucleus, where it is enriched in Gems, nuclear structures that resemble Cajal bodies in number and size (26
). In adult tissues and most cell lines, Gems and Cajal bodies colocalize, whereas in fetal tissues and certain types of cell lines, such as HeLa PV cells, Gems and Cajal bodies are separate and distinct nuclear structures (26
,40
42
). Clearly, Gems and Cajal bodies are functionally related and often associated (31
,40
,43
). Although Cajal bodies are implicated in snRNP and snoRNP biogenesis, trafficking, processing and histone mRNA 3' processing, their precise function is still unknown (44
47
).
To understand the function of the SMN complex, it is necessary to know the contribution of each of its components to the activity of the complex and to the expression of its other constituents. We have previously shown, using experiments in the chicken pre-B cell line DT40, that the level of Gemin2 protein decreases significantly upon the depletion of SMN (8
). However, using this cell line, it was not possible to determine whether other Gemins are also affected by the reduction of SMN due to the lack of antibodies that recognize the chicken orthologs of these proteins. Here, we used RNA interference (RNAi) to reduce the amounts of six of the seven components of the SMN complex, namely SMN and Gemin26, in an effort to further characterize the function and inter-dependence of these proteins in HeLa cells. To study the role of each of these components on the activity of the SMN complex, we used a sensitive and quantitative assay for snRNP assembly (48
). The findings reveal that the Gemins profoundly modulate the activity of the SMN complex.
| RESULTS |
|---|
|
|
|---|
Efficient reduction of SMN and Gemins by RNAi
siRNAs designed to target the mRNAs of SMN and Gemin26 were transfected into HeLa cells. To increase the likelihood of finding efficient siRNAs for each target and to ensure that the phenotype we observe upon reduction of each of them is specific, a large number of siRNAs were tested (at least five per target). Two days after transient transfection, whole cell lysates were prepared and specific proteins were analyzed by quantitative western blotting. As shown in Figures 1 and 2, the protein levels of SMN and Gemin26 were significantly reduced after transfection of the respective siRNAs. However, the extent of protein reduction varied somewhat depending on the target (Figs 1 and 2). The levels of SMN, Gemin2, 3, 5 and 6 were reduced by 7085%. RNAi of Gemin4 was less efficient and, although several different siRNAs were tested, Gemin4 could only be reduced by
57%. Indirect immunofluorescence microscopy further confirmed the reduction of the targeted proteins and demonstrated that at least 90% of cells were transfected and affected by the siRNAs (Fig. 3) (data not shown).
|
|
|
SMN is essential for the integrity of Gems and stabilizes the Gemins
Next, we asked whether the expression levels of the SMN complex components are inter-dependent. We have previously reported that the co-expression of SMN and Gemin2, but not of either protein alone, was sufficient to form a particle of a size similar to that of the native SMN particle (49
In contrast to the pronounced effects of SMN reduction on the nuclear Gems and on the levels of the Gemins, RNAi of Gemin2 had more moderate effects. The levels of SMN as well as Gemin4, 5 and 6 were not significantly affected by Gemin2 RNAi, and Gemin3 levels were only moderately reduced (Fig. 2B). Furthermore, reduction of Gemin2 did not alter the distribution of SMN complex proteins in Gems (data not shown). These observations imply that SMN and Gemin2 have distinct roles within the SMN particle, with SMN being essential for the formation of Gems and critical to the expression of Gemins.
RNAi of Gemin5 and Gemin6 had no significant effect on the appearance of Gems and the stability of the other SMN complex components examined here (Figs 13) (data not shown). In contrast, RNAi of Gemin3 reduced the levels of Gemin4 by almost 40% (Fig. 2C) and Gemin4 RNAi, in turn, reduced Gemin3 levels by >50% (Fig. 2D). It is thus likely that these two Gemins, which interact directly (16
), stabilize one another.
Reduction of SMN, Gemin2 and Gemin6 leads to a reduction in the capacity for snRNP assembly
Using antibody-depleted cytoplasmic extracts, recent studies demonstrated that SMN, and possibly Gemin2 and 4, play critical roles in the assembly of snRNPs (30
,35
,50
). To determine whether other components of the SMN complex also affect the activity of the complex in snRNP assembly, we carried out in vitro assembly reactions following RNAi-mediated knockdown of SMN and Gemin26 in HeLa cells.
After transfection of siRNAs against SMN or Gemin26 mRNAs, cytoplasmic HeLa extracts were prepared and used for snRNP assembly on biotin-labeled U1 snRNA (48
). Assembly activity was measured following Y12 immunoprecipitations of the assembled U1 snRNPs (Fig. 4). Western blotting of the RNAi-treated cytoplasmic extracts used in the assembly reactions confirmed that all siRNAs had indeed reduced the levels of their respective targets as anticipated (data not shown). As shown in Figure 4, the efficiency of snRNP assembly was decreased between 50 and 60% upon reduction of SMN, Gemin2 and Gemin6. These findings confirm the requirement of SMN and Gemin2 for efficient snRNP assembly and identify Gemin6 as an additional key component in this assembly process. Indeed, a similar reduction in the capacity for snRNP assembly is also observed in cells from SMA type I patients (48
). In contrast, RNAi of Gemin3, 4 and 5 did not affect the efficiency of snRNP assembly. It is possible that the reduction of Gemin3, 4 and 5 that could be attained by RNAi in this system was too transient or, especially in the case of Gemin4, not sufficient to reflect their involvement in snRNP assembly in this in vitro assay.
|
To further examine the inhibitory effects of Gemin6 reduction on snRNP assembly, we tested whether the inhibitory effects of SMN and Gemin6 reduction on snRNP assembly were additive. To do so, we treated HeLa cells simultaneously with siRNAs to both SMN and Gemin6 and measured the snRNP assembly activity in extracts prepared from these cells. As expected, the activity measures showed a strong reduction, but this was not lower than that observed in cells in which either SMN or Gemin6 were each reduced alone (Fig. 4). The amount of SMN and Gemin6 proteins in the double-knockdown cells, monitored by quantitative immunoblots, showed no further reduction in either protein compared with the reduction observed for each protein when it is targeted directly alone (data not shown). It is therefore likely that the extent of reduction in activity, which is seen when each of these proteins is strongly decreased, is close to the maximal reduction achievable in these cells under the conditions of the experiments, or that the two proteins are required for (a) similar step(s) in the same pathway.
| DISCUSSION |
|---|
|
|
|---|
Except for SMN itself, little has been so far known about the contribution of the various components of the SMN complex to its activity and about the influence that each of them may have on the expression and on the cellular localization of the other proteins. To better understand the cellular roles of the proteins of the SMN complex, we used RNAi to systematically reduce the amount of individual components, namely SMN and Gemin26, in vivo. Gemin7, which is also part of the SMN complex, was not included in this study because we currently do not have a suitable antibody for this protein with which to assess its expression levels. In each case, we measured the activity of the SMN complex, the amount of each of the proteins and their cellular localization. These experiments were facilitated by a new quantitative assay for the activity of the SMN complex in snRNP assembly (48
A particularly interesting observation is that the reduction of either Gemin2 or Gemin6 decreases the activity of (or the number of active) SMN complexes. The observation that Gemin2 is important for the activity of the SMN complex is consistent with its tight association with SMN (14
); the notion that it is important for the activity of SMN is not unexpected. Previous experiments showing inhibition or depletion of snRNP assembly activity with anti-Gemin2 antibodies in X. laevis oocytes (21
) are consistent with this. However, unlike specific reduction of Gemin2, these experiments could not exclude the possibility that the loss in activity resulted simply from removal of the entire SMN complex or from large steric interference of the anti-Gemin2 antibody. Our data are also in accord with a study on double heterozygous Smn+//Gemin2+/ mice that show some decrease in the nuclear pool of Sm proteins and, by implication, in snRNP assembly in motor neurons of Smn+//Gemin2+/ mice compared to Smn+//Gemin2+/+ mice and wild-type mice (53
). Taken together, these observations and our findings here suggest that reduction in the amount of functional Gemin2 or Gemin6 could give rise to a phenotype similar to SMA, or that their reduction in SMA patients may aggravate the SMA phenotype. In the case of Gemin2, this is in agreement with the exacerbations in motor neuron degeneration observed in double heterozygous Smn+//Gemin2+/ mice versus Smn+//Gemin2+/+ mice (53
). Although a previous screen for Gemin2 mutations in approximately 50 SMA patients has not revealed any mutations or reduced mRNA levels for Gemin2 (54
), it will be of interest to determine Gemin2 and Gemin6 protein levels and possible mutations in a large cohort of patients with motor neuron disease, including SMA. The finding that Gemin6 plays an important role in snRNP assembly is particularly interesting in light of the recent determination of the crystal structure of Gemin6 and Gemin7 (55
). The structure revealed that Gemin6 and 7 each contains a domain that highly resembles the conserved domain, the Sm domain, common to all the Sm and LSm proteins, despite the lack of a canonical Sm sequence motif in these Gemins (55
). It is thus conceivable that Gemin6 and Gemin7, which interact with Sm proteins, play a role in organizing Sm proteins for assembly onto snRNAs, possibly by serving as an Sm-like dimer surrogate around which individual Sm proteins and/or sub-complexes are arranged for binding to the Sm site. Another possibility that we consider is that Gemin6 and 7, rather than interacting with Sm proteins, associate with each other to form a ring structure, which serves as a scaffold that organizes the other components of the SMN complex so that they can facilitate the formation of an Sm core. Further studies will be required to understand the specific mechanism of snRNP assembly that the SMN complex mediates, and the specific roles of Gemins in this process. Furthermore, in light of our findings here, the possibility that Gemin2 and Gemin6, as well as the other Gemins, are potential genetic modifiers of SMA deserves further consideration.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture
HeLa PV cells were cultured in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen).
RNA interference
Following the guidelines by Elbashir et al. (56
), 21-nt RNA duplexes (siRNAs) were designed to target SMN or Gemin26 mRNAs. For each target transcript, at least five siRNAs were designed and tested and, in general, found to behave similarly in all subsequent analyses. The following siRNA sequences yielded the most efficient protein knockdowns of each target: GAAGAAUACUGCAGCUUCC for SMN; GCAGCUCAAUGUCCAGAUG for Gemin2; GGCUUAGAGUGUCAUGUCU for Gemin3; ACUCCCCAGUGAGACCAUU for Gemin4; GCAUAGUGGUGAUAAUUGA for Gemin5 and AACUACAGACCCAGUCUCUGC for Gemin6. In addition, an siRNA initially designed to target Y14, a component of the exon junction complex (57
), which failed to produce any protein reduction within 44 h, was used as a control (CCCGGACCACAACGCUCUG). All siRNAs were chemically synthesized and purified by Dharmacon Research. Transfections of siRNAs into HeLa PV cells were performed using OligofectamineTM (Invitrogen) as specified by the manufacturer. Transfected cells were analyzed 4044 h post-transfection.
Quantitative western blotting and indirect immunofluorescence microscopy
For western blotting, fresh cell pellets were resuspended in PBS and briefly sonicated on ice. The protein concentrations of the whole cell extracts were determined using the Bio-Rad protein assay (Bio-Rad Laboratories). Proteins were resolved on 412% BisTris NuPage pre-cast gels and transferred onto nitrocellulose membranes using a mini-gel transfer apparatus (Invitrogen). Subsequently, quantitative western analysis was performed using the Odyssey System according to the instructions of the manufacturer (Li-Cor Biosciences). Bound antibodies were detected using IRDye800CW-conjugated goat anti-mouse IgG (Rockland). The intensity of each band was measured on the Odyssey Infrared Imaging System (Li-Cor). The signals for SMN and Gemin26 were normalized to the protein levels of the arginine methyltransferase JBP1 that served as a loading control. Indirect immunofluorescence experiments using HeLa PV cells were performed as previously described (19
).
Antibodies
The following mouse monoclonal antibodies were used: 2B1 (anti-SMN), 2E17 (anti-Gemin2), 12H12 (anti-Gemin3), 17D10 (anti-Gemin4), 10G11 (anti-Gemin5), 6G8 (anti-JBP1) and Y12 (anti-Sm). Gemin6 was detected using the affinity-purified rabbit polyclonal antibody rG6 (19
). Antibodies 17D10 and rG6 are only suited for western blotting but not for immunofluorescence.
In vitro snRNP assembly
Biotinylated U1 snRNA was in vitro transcribed from 1 µg of linearized template DNA (34
) using 5 mM biotin-UTP (Roche), 2.5 mM UTP, 7.5 mM ATP, 7.5 mM CTP, 1.5 mM GTP, 5.25 mM m7
G(5')ppp(5')G cap analog and 2 µl T7 RNA polymerase (Ambion) at 37°C for 6 h. The labeled RNAs were purified by electrophoresis on 6% acrylamide/7 M urea gels, precipitated with ethanol, resuspended in nuclease free water and quantitated by spectroscopy. Cytoplasmic extracts were prepared 4044 h after siRNA transfection into HeLa PV cells, as previously described (35
). These cytoplasmic extracts were used to assemble on the biotin-labeled U1 snRNA using standard reconstitution conditions at 30°C for 1 h in a 96-well plate format (34
,35
). Subsequently, Y12 immunoprecipitations were carried out following Y12 antibody immobilization on magnetizable Dynabeads® Protein A. Assembled U1 snRNPs were quantitated using horseradish peroxidase-conjugated NeutrAvidinTM (48
).
| ACKNOWLEDGEMENTS |
|---|
We thank members of our laboratory, especially Drs Jin Wang and Steven Kolb, for stimulating discussions and helpful comments on this manuscript. We are also grateful to Hongying Deng for technical help and Gina Daly for secretarial assistance. This work was supported by the Association Française Contre les Myopathies (AFM) and by a grant from the National Institute of Health. G.D. is an Investigator of the Howard Hughes Medical Institute.
Conflict of Interest statement. None declared.
| FOOTNOTES |
|---|
The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors. | REFERENCES |
|---|
|
|
|---|
- Pearn, J. (1980) Classification of spinal muscular atrophies. Lancet, 1, 919922.[Web of Science][Medline]
- Melki, J. (1997) Spinal muscular atrophy. Curr. Opin. Neurol., 10, 381385.[Web of Science][Medline]
- Lefebvre, S., Burglen, L., Reboullet, S., Clermont, O., Burlet, P., Viollet, L., Benichou, B., Cruaud, C., Millasseau, P., Zeviani, M. et al. (1995) Identification and characterization of a spinal muscular atrophy-determining gene. Cell, 80, 155165.[CrossRef][Web of Science][Medline]
- Brzustowicz, L.M., Lehner, T., Castilla, L.H., Penchaszadeh, G.K., Wilhelmsen, K.C., Daniels, R., Davies, K.E., Leppert, M., Ziter, F., Wood, D. et al. (1990) Genetic mapping of chronic childhood-onset spinal muscular atrophy to chromosome 5q11.213.3. Nature, 344, 540541.[CrossRef][Medline]
-
Melki, J., Lefebvre, S., Burglen, L., Burlet, P., Clermont, O., Millasseau, P., Reboullet, S., Benichou, B., Zeviani, M., Le Paslier, D. et al. (1994) De novo and inherited deletions of the 5q13 region in spinal muscular atrophies. Science, 264, 14741477.
[Abstract/Free Full Text] -
Lorson, C.L., Hahnen, E., Androphy, E.J. and Wirth, B. (1999) A single nucleotide in the SMN gene regulates splicing and is responsible for spinal muscular atrophy. Proc. Natl Acad. Sci. USA, 96, 63076311.
[Abstract/Free Full Text] -
Schrank, B., Gotz, R., Gunnersen, J.M., Ure, J.M., Toyka, K.V., Smith, A.G. and Sendtner, M. (1997) Inactivation of the survival motor neuron gene, a candidate gene for human spinal muscular atrophy, leads to massive cell death in early mouse embryos. Proc. Natl Acad. Sci. USA, 94, 99209925.
[Abstract/Free Full Text] -
Wang, J. and Dreyfuss, G. (2001) A cell system with targeted disruption of the SMN gene: functional conservation of the SMN protein and dependence of Gemin2 on SMN. J. Biol. Chem., 276, 95999605.
[Abstract/Free Full Text] -
Miguel-Aliaga, I., Culetto, E., Walker, D.S., Baylis, H.A., Sattelle, D.B. and Davies, K.E. (1999) The Caenorhabditis elegans orthologue of the human gene responsible for spinal muscular atrophy is a maternal product critical for germline maturation and embryonic viability. Hum. Mol. Genet., 8, 21332143.
[Abstract/Free Full Text] - Miguel-Aliaga, I., Chan, Y.B., Davies, K.E. and van den Heuvel, M. (2000) Disruption of SMN function by ectopic expression of the human SMN gene in Drosophila. FEBS Lett., 486, 99102.
-
Hannus, S., Buhler, D., Romano, M., Seraphin, B. and Fischer, U. (2000) The Schizosaccharomyces pombe protein Yab8p and a novel factor, Yip1p, share structural and functional similarity with the spinal muscular atrophy-associated proteins SMN and SIP1. Hum. Mol. Genet., 9, 663674.
[Abstract/Free Full Text] -
Owen, N., Doe, C.L., Mellor, J. and Davies, K.E. (2000) Characterization of the Schizosaccharomyces pombe orthologue of the human survival motor neuron (SMN) protein. Hum. Mol. Genet., 9, 675684.
[Abstract/Free Full Text] -
Paushkin, S., Charroux, B., Abel, L., Perkinson, R.A., Pellizzoni, L. and Dreyfuss, G. (2000) The survival motor neuron protein of Schizosacharomyces pombe. Conservation of survival motor neuron interaction domains in divergent organisms. J. Biol. Chem., 275, 2384123846.
[Abstract/Free Full Text] - Liu, Q., Fischer, U., Wang, F. and Dreyfuss, G. (1997) The spinal muscular atrophy disease gene product, SMN, and its associated protein SIP1 are in a complex with spliceosomal snRNP proteins. Cell, 90, 10131021.[CrossRef][Web of Science][Medline]
-
Charroux, B., Pellizzoni, L., Perkinson, R.A., Shevchenko, A., Mann, M. and Dreyfuss, G. (1999) Gemin3: a novel DEAD box protein that interacts with SMN, the spinal muscular atrophy gene product, and is a component of gems. J. Cell Biol., 147, 11811194.
[Abstract/Free Full Text] -
Charroux, B., Pellizzoni, L., Perkinson, R.A., Yong, J., Shevchenko, A., Mann, M. and Dreyfuss, G. (2000) Gemin4. a novel component of the SMN complex that is found in both gems and nucleoli. J. Cell Biol., 148, 11771186.
[Abstract/Free Full Text] -
Gubitz, A.K., Mourelatos, Z., Abel, L., Rappsilber, J., Mann, M. and Dreyfuss, G. (2002) Gemin5, a novel WD repeat protein component of the SMN complex that binds Sm proteins. J. Biol. Chem., 277, 56315636.
[Abstract/Free Full Text] -
Pellizzoni, L., Baccon, J., Rappsilber, J., Mann, M. and Dreyfuss, G. (2002) Purification of native survival of motor neurons complexes and identification of Gemin6 as a novel component. J. Biol. Chem., 277, 75407545.
[Abstract/Free Full Text] -
Baccon, J., Pellizzoni, L., Rappsilber, J., Mann, M. and Dreyfuss, G. (2002) Identification and characterization of Gemin7, a novel component of the survival of motor neuron complex. J. Biol. Chem., 277, 3195731962.
[Abstract/Free Full Text] -
Pellizzoni, L., Charroux, B. and Dreyfuss, G. (1999) SMN mutants of spinal muscular atrophy patients are defective in binding to snRNP proteins. Proc. Natl Acad. Sci. USA, 96, 1116711172.
[Abstract/Free Full Text] -
Buhler, D., Raker, V., Luhrmann, R. and Fischer, U. (1999) Essential role for the tudor domain of SMN in spliceosomal U snRNP assembly: implications for spinal muscular atrophy. Hum. Mol. Genet., 8, 23512357.
[Abstract/Free Full Text] -
Friesen, W.J. and Dreyfuss, G. (2000) Specific sequences of the Sm and Sm-like (Lsm) proteins mediate their interaction with the spinal muscular atrophy disease gene product (SMN). J. Biol. Chem., 275, 2637026375.
[Abstract/Free Full Text] -
Pellizzoni, L., Charroux, B., Rappsilber, J., Mann, M. and Dreyfuss, G. (2001) A functional interaction between the survival motor neuron complex and RNA polymerase II. J. Cell Biol., 152, 7585.
[Abstract/Free Full Text] - Pellizzoni, L., Baccon, J., Charroux, B. and Dreyfuss, G. (2001) The survival of motor neurons (SMN) protein interacts with the snoRNP proteins fibrillarin and GAR1. Curr. Biol., 11, 10791088.[CrossRef][Web of Science][Medline]
-
Jones, K.W., Gorzynski, K., Hales, C.M., Fischer, U., Badbanchi, F., Terns, R.M. and Terns, M.P. (2001) Direct interaction of the spinal muscular atrophy disease protein SMN with the small nucleolar RNA-associated protein fibrillarin. J. Biol. Chem., 276, 3864538651.
[Abstract/Free Full Text] - Liu, Q. and Dreyfuss, G. (1996) A novel nuclear structure containing the survival of motor neurons protein. EMBO J., 15, 35553565.[Web of Science][Medline]
- Mourelatos, Z., Abel, L., Yong, J., Kataoka, N. and Dreyfuss, G. (2001) SMN interacts with a novel family of hnRNP and spliceosomal proteins. EMBO J., 20, 54435452.[CrossRef][Web of Science][Medline]
-
Rossoll, W., Kroning, A.K., Ohndorf, U.M., Steegborn, C., Jablonka, S. and Sendtner, M. (2002) Specific interaction of Smn, the spinal muscular atrophy determining gene product, with hnRNP-R and gry-rbp/hnRNP-Q: a role for Smn in RNA processing in motor axons? Hum. Mol. Genet., 11, 93105.
[Abstract/Free Full Text] -
Hebert, M.D., Szymczyk, P.W., Shpargel, K.B. and Matera, A.G. (2001) Coilin forms the bridge between Cajal bodies and SMN, the spinal muscular atrophy protein. Genes Dev., 15, 27202729.
[Abstract/Free Full Text] - Fischer, U., Liu, Q. and Dreyfuss, G. (1997) The SMNSIP1 complex has an essential role in spliceosomal snRNP biogenesis. Cell, 90, 10231029.[CrossRef][Web of Science][Medline]
- Pellizzoni, L., Kataoka, N., Charroux, B. and Dreyfuss, G. (1998) A novel function for SMN, the spinal muscular atrophy disease gene product, in pre-mRNA splicing. Cell, 95, 615624.[CrossRef][Web of Science][Medline]
-
Meister, G., Buhler, D., Laggerbauer, B., Zobawa, M., Lottspeich, F. and Fischer, U. (2000) Characterization of a nuclear 20S complex containing the survival of motor neurons (SMN) protein and a specific subset of spliceosomal Sm proteins. Hum. Mol. Genet., 9, 19771986.
[Abstract/Free Full Text] - Meister, G., Buhler, D., Pillai, R., Lottspeich, F. and Fischer, U. (2001) A multiprotein complex mediates the ATP-dependent assembly of spliceosomal U snRNPs. Nat. Cell Biol., 3, 945949.[CrossRef][Web of Science][Medline]
- Yong, J., Pellizzoni, L. and Dreyfuss, G. (2002) Sequence-specific interaction of U1 snRNA with the SMN complex. EMBO J., 21, 11881196.[CrossRef][Web of Science][Medline]
-
Pellizzoni, L., Yong, J. and Dreyfuss, G. (2002) Essential role for the SMN complex in the specificity of snRNP assembly. Science, 298, 17751779.
[Abstract/Free Full Text] - Gangwani, L., Mikrut, M., Theroux, S., Sharma, M. and Davis, R.J. (2001) Spinal muscular atrophy disrupts the interaction of ZPR1 with the SMN protein. Nat. Cell Biol., 3, 376383.[CrossRef][Web of Science][Medline]
-
Giesemann, T., Rathke-Hartlieb, S., Rothkegel, M., Bartsch, J.W., Buchmeier, S., Jockusch, B.M. and Jockusch, H. (1999) A role for polyproline motifs in the spinal muscular atrophy protein SMN. Profilins bind to and colocalize with smn in nuclear gems. J. Biol. Chem., 274, 3790837914.
[Abstract/Free Full Text] - Williams, B.Y., Hamilton, S.L. and Sarkar, H.K. (2000) The survival motor neuron protein interacts with the transactivator FUSE binding protein from human fetal brain. FEBS Lett., 470, 207210.[CrossRef][Web of Science][Medline]
-
Young, P.J., Day, P.M., Zhou, J., Androphy, E.J., Morris, G.E. and Lorson, C.L. (2002) A direct interaction between the survival motor neuron protein and p53 and its relationship to spinal muscular atrophy. J. Biol. Chem., 277, 28522859.
[Abstract/Free Full Text] -
Carvalho, T., Almeida, F., Calapez, A., Lafarga, M., Berciano, M.T. and Carmo-Fonseca, M. (1999) The spinal muscular atrophy disease gene product, SMN: a link between snRNP biogenesis and the Cajal (coiled) body. J. Cell Biol., 147, 715728.
[Abstract/Free Full Text] - Young, P.J., Le, T.T., Dunckley, M., Nguyen, T.M., Burghes, A.H. and Morris, G.E. (2001) Nuclear gems and Cajal (coiled) bodies in fetal tissues: nucleolar distribution of the spinal muscular atrophy protein, SMN. Exp. Cell Res., 265, 252261.[CrossRef][Web of Science][Medline]
- Young, P.J., Le, T.T., thi Man, N., Burghes, A.H. and Morris, G.E. (2000) The relationship between SMN, the spinal muscular atrophy protein, and nuclear coiled bodies in differentiated tissues and cultured cells. Exp. Cell Res., 256, 365374.[CrossRef][Web of Science][Medline]
- Matera, A.G. and Frey, M.R. (1998) Coiled bodies and gems: Janus or gemini? Am. J. Hum. Genet., 63, 317321.[CrossRef][Web of Science][Medline]
- Matera, A.G. (1999) Nuclear bodies: multifaceted subdomains of the interchromatin space. Trends Cell Biol., 9, 302309.[CrossRef][Web of Science][Medline]
- Gall, J.G. (2000) Cajal bodies: the first 100 years. Annu. Rev. Cell Dev. Biol., 16, 273300.[CrossRef][Web of Science][Medline]
-
Lamond, A.I. and Earnshaw, W.C. (1998) Structure and function in the nucleus. Science, 280, 547553.
[Abstract/Free Full Text] -
Almeida, F., Saffrich, R., Ansorge, W. and Carmo-Fonseca, M. (1998) Microinjection of anti-coilin antibodies affects the structure of coiled bodies. J. Cell Biol., 142, 899912.
[Abstract/Free Full Text] - Wan, L., Battle, D.J., Yong, J., Gubitz, A.K., Kolb, S.J., Wang, J. and Dreyfuss, G. (2005) The survival of motor neurons protein determines the capacity for snRNP assembly: a biochemical deficiency in spinal muscular atrophy. Mol. Cell. Biol., in press.
- Paushkin, S., Gubitz, A.K., Massenet, S. and Dreyfuss, G. (2002) The SMN complex, an assemblyosome of ribonucleoproteins. Curr. Opin. Cell Biol., 14, 305312.[CrossRef][Web of Science][Medline]
- Meister, G. and Fischer, U. (2002) Assisted RNP assembly: SMN and PRMT5 complexes cooperate in the formation of spliceosomal UsnRNPs. EMBO J., 21, 58535863.[CrossRef][Web of Science][Medline]
-
Mourelatos, Z., Dostie, J., Paushkin, S., Sharma, A., Charroux, B., Abel, L., Rappsilber, J., Mann, M. and Dreyfuss, G. (2002) miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. Genes Dev., 16, 720728.
[Abstract/Free Full Text] - Navascues, J., Berciano, M.T., Tucker, K.E., Lafarga, M. and Matera, A.G. (2004) Targeting SMN to Cajal bodies and nuclear gems during neuritogenesis. Chromosoma, 112, 398409.[Web of Science][Medline]
-
Jablonka, S., Holtmann, B., Meister, G., Bandilla, M., Rossoll, W., Fischer, U. and Sendtner, M. (2002) Gene targeting of Gemin2 in mice reveals a correlation between defects in the biogenesis of U snRNPs and motoneuron cell death. Proc. Natl Acad. Sci. USA, 99, 1012610131.
[Abstract/Free Full Text] - Helmken, C., Wetter, A., Rudnik-Schoneborn, S., Liehr, T., Zerres, K. and Wirth, B. (2000) An essential SMN interacting protein (SIP1) is not involved in the phenotypic variability of spinal muscular atrophy (SMA). Eur. J. Hum. Genet., 8, 493499.[CrossRef][Web of Science][Medline]
- Ma, Y., Dostie, J., Dreyfuss, G. and Van Duyne, G.D. (2005) The Gemin6-Gemin7 heterodimer from the Survival of Motor Neurons complex has an Sm protein-like structure. Structure, in press.
- Elbashir, S.M., Martinez, J., Patkaniowska, A., Lendeckel, W. and Tuschl, T. (2001) Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. EMBO J., 20, 68776888.[CrossRef][Web of Science][Medline]
-
Kataoka, N., Yong, J., Kim, V.N., Velazquez, F., Perkinson, R.A., Wang, F. and Dreyfuss, G. (2000) Pre-mRNA splicing imprints mRNA in the nucleus with a novel RNA-binding protein that persists in the cytoplasm. Mol. Cell, 6, 673682.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
A.-F. Bruns, J. van Bergeijk, C. Lorbeer, A. Nolle, J. Jungnickel, C. Grothe, and P. Claus Fibroblast growth factor-2 regulates the stability of nuclear bodies PNAS, August 4, 2009; 106(31): 12747 - 12752. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ogawa, K. Usui, F. Ito, M. Itoh, Y. Hayashizaki, and H. Suzuki Role of Survival Motor Neuron Complex Components in Small Nuclear Ribonucleoprotein Assembly J. Biol. Chem., May 22, 2009; 284(21): 14609 - 14617. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Renvoise, S. Colasse, P. Burlet, L. Viollet, U. T. Meier, and S. Lefebvre The loss of the snoRNP chaperone Nopp140 from Cajal bodies of patient fibroblasts correlates with the severity of spinal muscular atrophy Hum. Mol. Genet., April 1, 2009; 18(7): 1181 - 1189. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. B. Shpargel, K. Praveen, T. K. Rajendra, and A. G. Matera Gemin3 Is an Essential Gene Required for Larval Motor Function and Pupation in Drosophila Mol. Biol. Cell, January 1, 2009; 20(1): 90 - 101. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Kaiser, R. V. Intine, and M. Dundr De Novo Formation of a Subnuclear Body Science, December 12, 2008; 322(5908): 1713 - 1717. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kroiss, J. Schultz, J. Wiesner, A. Chari, A. Sickmann, and U. Fischer Evolution of an RNP assembly system: A minimal SMN complex facilitates formation of UsnRNPs in Drosophila melanogaster PNAS, July 22, 2008; 105(29): 10045 - 10050. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-F. Mouillet, X. Yan, Q. Ou, L. Jin, L. J. Muglia, P. A. Crawford, and Y. Sadovsky DEAD-Box Protein-103 (DP103, Ddx20) Is Essential for Early Embryonic Development and Modulates Ovarian Morphology and Function Endocrinology, May 1, 2008; 149(5): 2168 - 2175. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Battle, M. Kasim, J. Wang, and G. Dreyfuss SMN-independent Subunits of the SMN Complex: IDENTIFICATION OF A SMALL NUCLEAR RIBONUCLEOPROTEIN ASSEMBLY INTERMEDIATE J. Biol. Chem., September 21, 2007; 282(38): 27953 - 27959. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Kolb, D. J. Battle, and G. Dreyfuss Molecular Functions of the SMN Complex J Child Neurol, August 1, 2007; 22(8): 990 - 994. [Abstract] [PDF] |
||||
![]() |
C. E. Beattie, T. L. Carrel, and M. L. McWhorter Fishing for a Mechanism: Using Zebrafish to Understand Spinal Muscular Atrophy J Child Neurol, August 1, 2007; 22(8): 995 - 1003. [Abstract] [PDF] |
||||
![]() |
L. L. Almstead and P. Sarnow Inhibition of U snRNP assembly by a virus-encoded proteinase Genes & Dev., May 1, 2007; 21(9): 1086 - 1097. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ogawa, K. Usui, M. Aoki, F. Ito, M. Itoh, C. Kai, M. Kanamori-Katayama, Y. Hayashizaki, and H. Suzuki Gemin2 Plays an Important Role in Stabilizing the Survival of Motor Neuron Complex J. Biol. Chem., April 13, 2007; 282(15): 11122 - 11134. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Otter, M. Grimmler, N. Neuenkirchen, A. Chari, A. Sickmann, and U. Fischer A Comprehensive Interaction Map of the Human Survival of Motor Neuron (SMN) Complex J. Biol. Chem., February 23, 2007; 282(8): 5825 - 5833. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Carissimi, L. Saieva, F. Gabanella, and L. Pellizzoni Gemin8 Is Required for the Architecture and Function of the Survival Motor Neuron Complex J. Biol. Chem., December 1, 2006; 281(48): 37009 - 37016. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Lemm, C. Girard, A. N. Kuhn, N. J. Watkins, M. Schneider, R. Bordonne, and R. Luhrmann Ongoing U snRNP Biogenesis Is Required for the Integrity of Cajal Bodies Mol. Biol. Cell, July 1, 2006; 17(7): 3221 - 3231. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hamamoto, H. Nishitsuji, T. Amagasa, M. Kannagi, and T. Masuda Identification of a Novel Human Immunodeficiency Virus Type 1 Integrase Interactor, Gemin2, That Facilitates Efficient Viral cDNA Synthesis In Vivo. J. Virol., June 1, 2006; 80(12): 5670 - 5677. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Girard, H. Neel, E. Bertrand, and R. Bordonne Depletion of SMN by RNA interference in HeLa cells induces defects in Cajal body formation Nucleic Acids Res., May 31, 2006; 34(10): 2925 - 2932. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Carissimi, L. Saieva, J. Baccon, P. Chiarella, A. Maiolica, A. Sawyer, J. Rappsilber, and L. Pellizzoni Gemin8 Is a Novel Component of the Survival Motor Neuron Complex and Functions in Small Nuclear Ribonucleoprotein Assembly J. Biol. Chem., March 24, 2006; 281(12): 8126 - 8134. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. B. Shpargel and A. G. Matera Gemin proteins are required for efficient assembly of Sm-class ribonucleoproteins PNAS, November 29, 2005; 102(48): 17372 - 17377. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||













