Skip Navigation


Human Molecular Genetics Advance Access originally published online on May 25, 2005
Human Molecular Genetics 2005 14(14):1955-1963; doi:10.1093/hmg/ddi200
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
14/14/1955    most recent
ddi200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Veltman, I. M.
Right arrow Articles by van Kessel, A. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Veltman, I. M.
Right arrow Articles by van Kessel, A. G.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oupjournals.org

Fusion of the SUMO/Sentrin-specific protease 1 gene SENP1 and the embryonic polarity-related mesoderm development gene MESDC2 in a patient with an infantile teratoma and a constitutional t(12;15)(q13;q25)

Imke M. Veltman1, Lilian A. Vreede1, Jinke Cheng2, Leendert H.J. Looijenga3, Bert Janssen1, Eric F.P.M. Schoenmakers1, Edward T.H. Yeh2 and Ad Geurts van Kessel1,*

1Department of Human Genetics, 417 Radboud University Nijmegen Medical Centre, PO Box 9101, 6500 HB Nijmegen, The Netherlands, 2Department of Cardiology, Unit 449, University of Texas—MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030, USA and 3Department of Pathology, Erasmus Medical Center/Daniel den Hoed, PO Box 1738, 3000 DR Rotterdam, The Netherlands

* To whom correspondence should be addressed. Tel: +31 243614107; Fax: +31 243540488; Email: a.geurtsvankessel{at}antrg.umcn.nl

Received February 4, 2005; Revised April 10, 2005; Accepted May 17, 2005


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Recently, we identified a patient with an infantile sacrococcygeal teratoma and a constitutional t(12;15)(q13;q25). Here, we show that, as a result of this chromosomal translocation, the SUMO/Sentrin-specific protease 1 gene (SENP1) on chromosome 12 and the embryonic polarity-related mesoderm development gene (MESDC2) on chromosome 15 are disrupted and fused. Both reciprocal SENP1–MESDC2 (SEME) and MESDC2–SENP1 (MESE) fusion genes are transcribed in tumor-derived cells and their open reading frames encode aberrant proteins. As a consequence of this, and in contrast to wild-type (WT) MESDC2, the translocation-associated SEME protein is no longer targeted to the endoplasmatic reticulum, leading to a presumed loss-of-function as a chaperone for the WNT co-receptors LRP5 and/or LRP6. Ultimately, this might lead to abnormal development and/or routing of germ cell tumor precursor cells. SUMO, a post-translational modifier, plays an important role in several cellular key processes and is cleaved from its substrates by WT SENP1. Using a PML desumoylation assay, we found that translocation-associated MESE proteins exhibit desumoylation capacities similar to those observed for WT SENP1. We speculate that spatio-temporal disturbances in desumoylating activities during critical stages of embryonic development might have predisposed the patient. Together, the constitutional t(12;15)(q13;q25) translocation revealed two novel candidate genes for neonatal/infantile GCT development: MESDC2 and SENP1.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Human germ cell tumors (GCTs) can arise at various ages, in both sexes, at different body locations and vary with respect to clinical outcome, histology and genetic constitution (1Go–3Go). GCTs are most prevalent in the testis of young adult males. We and others have suggested that GCTs of infants and neonates may represent a distinct subgroup (2Go–8Go). These latter tumors are relatively rare, mainly arise in the sacral/sacrococcygeal region and, at a lower frequency, in the gonads and along the midline of the body (3Go). How these tumors develop and from which precursor cells they originate is still a matter of debate. A common precursor cell type, however, has been suggested for infantile gonadal and extra-gonadal GCTs (9Go). The main histological infantile subtypes include teratomas with mesodermal, ectodermal and endodermal components and yolk sac tumors with yolk sac endodermal components. Teratoma development resembles embryogenesis in various aspects (10Go,11Go). Therefore, these latter tumors have been used as model systems to study both early embryonic and tumorigenic processes (12Go,13Go).

Currently available information on the cytogenetic constitution of neonatal and infantile GCTs indicates that teratomas are mostly diploid with only minor non-recurrent chromosomal anomalies. In contrast, infantile yolk sac tumors exhibit several major recurrent chromosomal aberrations (7Go,8Go,14Go–18Go). Overall, the most frequent cytogenetic anomaly in GCTs is the i(12p) chromosome. This marker chromosome is almost exclusively present in testicular GCTs of juveniles and adults (19Go). Several recurrent genomic anomalies in both neonatal/infantile and juvenile/adult GCTs are currently under investigation (20Go–24Go). So far, however, no gene that is causally related to GCT development has been unambiguously identified neither for the infantile type nor for the adult type.

Using linkage analysis, Rapley et al. (25Go) identified a locus on Xq27 for familial testicular germ cell cancer. Additional candidate regions harboring putative genes for familial GCT development include 16p13, 18q22-qter and 12q12–13 (26Go). Together with the 12q22 region, the 12q12–13 region was found to be frequently deleted in sporadic GCTs as well (27Go–29Go). Linkage and CGH studies typically result in the identification of relatively large tumor-related genomic intervals containing numerous candidate genes. Recurrent, apparently balanced chromosomal anomalies, however, provide an opportunity to overcome this problem. Constitutional chromosome translocations have been widely employed to identify candidate genes in various (hereditary) cancer syndromes (30Go–33Go). Recently, we detected a patient with an infantile sacrococcygeal teratoma and a constitutional t(12;15)(q13;q25) (34Go). Here, we show that this translocation results in a fusion of the SUMO/Sentrin-specific protease 1 gene (SENP1) on 12q13 and the embryonic polarity-related mesoderm development gene (MESDC2) on 15q25. The putative implications of this novel gene fusion in the context of GCT development are discussed.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
SENP1 is disrupted by the 12q13 breakpoint
Previously, we identified a YAC clone (CEPH-919G8) that spans the constitutional t(12;15)(q13;q25) breakpoint at 12q13 (5Go). In order to refine this breakpoint region, a PAC contig was assembled that corresponds to this YAC clone (Fig. 1A). Fluorescence in situ hybridization (FISH) analysis on metaphase spreads of t(12;15)(q13;q25)-positive cells revealed that PAC clones RP1-316M24, RP1-130F5 and RP3-197B17 map proximal to the breakpoint and that, in contrast, RP1-228P16 turned out to be a breakpoint spanning clone. This finding is in full concordance with our subsequent array CGH-based mapping data (35Go). The complete sequence of RP1-228P16 is available in GenBank (accession no. AC004801) and, according to the May 2004 human genome assembly freeze (http://genome.ucsc.edu/), it encompasses four positional candidate genes: MGC5576 (a hypothetical gene), COL2A1, SENP1 and PFKM (Fig. 1A).



View larger version (27K):
[in this window]
[in a new window]
  		Figure 1. Mapping of the 12q13 breakpoint within the SENP1 gene. (A) Diagram depicting chromosome 12, the breakpoint-spanning CEPH YAC clone 919G8, its corresponding PAC contig and the genes corresponding to the breakpoint-spanning PAC clone RP1-228p16. The breakpoint-spanning clones and gene are depicted in gray. (B) Southern blot analysis of the t(12;15)(q13;q25)-positive cell line (lane 1) and its derived somatic cell hybrids [lane 2: chromosome 12; lane 3: der(15); lane 4: der(12)] after digestion of the DNAs with HindIII or BglII. A PCR fragment obtained with primer pair 228p16-38 and located proximal to the breakpoint was used as a probe. Next to the WT chromosome 12 fragments (lanes 1 and 2: 4.1 kb HindIII fragment and 6.7 kb BglII fragment, respectively), shifted fragments are readily seen in the original cell line (lane 1) and the der(15) containing hybrid (lane 3: >12 kb HindIII and ~11 kb BglII fragments). A cross-hybridizing Chinese hamster fragment is marked by an arrowhead.

 
To facilitate further refinement of the chromosomal breakpoint position in RP1-228P16, the t(12;15)(q13;q25)-associated chromosomes were segregated by generating Chinese hamster–human somatic cell hybrids. These hybrid cell lines with the normal chromosome 12, the derivative chromosome 12 [der(12)] or the derivative chromosome 15 [der(15)] were employed for STS-content mapping using specific PCR primer sets from preselected regions within RP1-228P16. The original t(12;15)(q13;q25)-positive lymphoblastoid cell line was included as a positive control. By doing so, the breakpoint interval could be reduced to a 3.6 kb genomic interval (data not shown).

In order to confirm these PCR results and to further narrow down the breakpoint region, Southern blot analysis was performed using HindIII and BglII digested DNAs extracted from the original and hybrid cell lines. A PCR fragment generated by one of the breakpoint-flanking primer sets (228p16–38) was used as probe. As expected, this probe hybridized to both HindIII and BglII wild-type (WT) fragments of 4.1 and 6.7 kb in the t(12;15)(q13;q25)-positive cell line and the chromosome 12-positive hybrid cell line, respectively (Fig. 1B, lanes 1 and 2). In addition, aberrantly hybridizing fragments were observed in the HindIII (>12 kb) and BglII (~10 kb) digested DNAs of the t(12;15)(q13;q25)-positive cell line and the der(15)-positive hybrid cell line (lanes 1 and 3, respectively). These shifted fragments were absent in the der(12)-positive hybrid cell line (lane 4), indicating that they originate from the der(15). Together, the PCR and Southern blot analysis results reduced the 12q13 breakpoint region to a 2.4 kb genomic interval. Analysis of its sequence using the UCSC human genome browser (May 2004 freeze) revealed that it is located within the second intron of one of the four earlier mentioned candidate genes; SENP1 (Fig. 2A). SENP1 belongs to the family of SUMO/Sentrin-specific proteases which are known to be involved in the cleavage of SUMO proteins from their substrates (36Go). The SENP1 gene is ~63 kb in size and encodes an mRNA of 4.7 kb (GenBank accession no. NM_014554). The May 2004 freeze of the UCSC human genome browser reveals several different mRNA splice variants that differ in their first exons, the length of their 3'-untranslated region (3'-UTRs) and/or the number of (additional) exons. The largest open reading frame (ORF) encodes a 643 amino acids protein that corresponds to the WT protein described by Gong et al. (36Go).



View larger version (53K):
[in this window]
[in a new window]
  		Figure 2. Fusion of SENP1 on chromosome 12 and MESDC2 on chromosome 15. (A) Diagram showing SENP1 and MESDC2 and the respective positions of the breakpoints in introns 2 and 1. (B) 3'-RACE products obtained from normal control and t(12;15)(q13;q25)-positive lymphoblastoid cell lines and sequences of t(12;15)(q13;q25)-derived SENP1–MESDC2 fusion products. (C) RT–PCR analysis of SENP1–MESDC2 (SEME), MESDC2–SENP1 (MESE), SENP1 and MESDC2 in the tumor sample, a positive control cell line [either the original t(12;15)(q13;q25)-positive lymphoblastoid cell line or, for MESDC2, a lymphoblastoid cell line from a healthy individual], and a negative control. (D) PCR analysis of the fusion genes SENP1–MESDC2 (SEME) on der(15) and MESDC2–-SENP1 (MESE) on der(12) in the paternal t(12;15)(q13;q25)-positive lymphoblastoid cell line, the patient-derived tumor sample and a negative control.

 
SENP1 is fused to MESDC2 at 15q25
On the basis of the localization of the 12q13 breakpoint within SENP1, we set out to identify the breakpoint sequences present at 15q25. To this end, 3'-rapid amplification of cDNA ends (RACE) analysis was performed using the SENP1 breakpoint information as a starting point. cDNAs generated from the t(12;15)(q13;q25)-positive lymphoblastoid cell line and, as a control, cDNAs from an unrelated lymphoblastoid cell line without a t(12;15)(q13;q25) were used. Aberrant PCR-fragments only present in the t(12;15)(q13;q25)-positive cell line were cloned, sequenced and analyzed (Fig. 2B). This resulted in the identification of chimeric transcripts, consisting of SENP1 sequences fused to sequences from MESDC2, a gene located at the 15q25 breakpoint region. More specifically, the MESDC2 gene is located in BAC clone RP11-775C24, again completely in line with our array CGH-based mapping data (35Go). The breakpoint in the MESDC2 gene appeared to be located within its first intron (Fig. 2A). MESDC2 is an embryonic polarity-related gene (37Go,38Go) of ~14 kb in size and encodes a 4.2 kb mRNA corresponding to a deduced protein of 234 amino acids (GenBank accession no. D42039). Also, for this gene, additional mRNAs that differ in length at their 3'-UTR are reported in the May 2004 freeze of the UCSC human genome browser.

The presence of SENP1–MESDC2 fusion transcripts (here referred to as SEME) in the t(12;15)(q13;q25)-positive cell line was confirmed by reverse transcription–polymerase chain reaction (RT–PCR). Similarly, the presence of SEME was confirmed in the primary tumor sample of the patient as well (Fig. 2C, first panel). In addition, RT–PCR showed the presence of the reciprocal MESDC2–SENP1 transcript (referred to as MESE) and the WT SENP1 and MESDC2 transcripts in the primary tumor sample (Fig. 2C).

The t(12;15)(q13;q25)-positive lymphoblastoid cell line that we used for mapping of the breakpoints was derived from the patient's father. In order to verify whether the genomic breakpoints identified in this cell line are in conformity to those in the patient, we performed PCR analysis on genomic DNAs extracted from the tumor material of the patient and the t(12;15)(q13;q25)-positive cell line. In both cases, similar PCR products were obtained (Fig. 2D), and their sequences revealed that both breakpoints were identical at the base-pair level, thereby, ruling out breakpoint-flanking duplications and/or deletions in the patient due to incomplete pairing and unequal crossing over of the respective derivative chromosomes at the breakpoints during meiotic division. In addition, we sequenced the complete ORFs of SENP1 and MESDC2 from the tumor-derived DNA and no additional (somatic) mutations were detected.

MESE has retained desumoylating activity
The reciprocal MESE fusion transcript is composed of the first exon of MESDC2 followed by exons 3–18 of SENP1. Owing to the translocation, the original start codon of SENP1 (36Go) is lost and two alternative ORFs are predicted for this MESE transcript. Depending on which ATG is used as a start codon, the encoded protein represents either an aberrant MESDC2 protein with 71 in-frame N-terminal amino acids followed by six additional amino acids or a protein that is almost completely composed of SENP1 except for the second amino acid at the N-terminus (here referred to as MESE 1.2). Using RT–PCR, we detected an additional MESE transcript containing an aberrant exon 1 of MESDC2 (lacking 199 bp at the 3'end) and exons 3–18 of SENP1 in the t(12;15)(q13;q25)-positive lymphoblastoid cell line. The predicted ORF of this transcript encodes a putative protein that lacks eight amino acids at the N-terminus when compared with WT SENP1 (here referred to as MESE 11.4). The two aberrant SENP1 proteins (MESE 1.2 and 11.4) encoded by the largest predicted ORFs contain the known SENP1 functional domains, i.e. the nuclear localization signal and the protease domain (Fig. 3) (36Go,39Go).



View larger version (16K):
[in this window]
[in a new window]
  		Figure 3. Diagram showing the proteins encoded by WT SENP1 and MESDC2 genes and the SEME and MESE fusion genes. Functional domains and the respective breakpoints are marked.

 
SENP1 is a SUMO/Sentrin-specific protease, which can cleave SUMO-1 from target proteins such as PML (36Go,40Go). To examine whether the MESE proteins have retained this functional capacity, we performed desumoylation assays using PML as a target. Therefore, COS-1 cells were transfected with one or more of the following expression constructs: His–PML, Ha–SUMO-1, MESE–VSV (1.2 or 11.4), WT SENP1–VSV and/or a control empty vector (Fig. 4). His–PML proteins with or without a conjugated Ha–SUMO-1 protein were purified from the cell lysates by immunoprecipitation (IP) using an anti-polyhistidine antibody. Multiple SUMO-1 associated PML isoforms were readily detected in the lysates of COS-1 cells expressing SUMO-1 and PML (Fig. 4; sumoylated PML, upper panel, lane 3). These isoforms were not detected in control IP samples of COS-1 cells transfected with empty vectors in conjunction with vectors without (lane 1) or with (lane 2) PML. Also, COS-1 cells expressing WT SENP1 together with SUMO-1 and PML did not show any sumoylated isoforms of PML (lane 4), indicating that the majority of PML protein is indeed desumoylated by SENP1. Similarly, IPs of COS-1 cells expressing MESE (11.4 or 1.2) together with PML and SUMO-1 (lanes 5 and 6) did not show any sumoylated isoforms of PML, indicating that although both MESE proteins were expressed at a lower level than WT SENP1 (Fig. 4; SENP1 variants), they were still fully capable of desumoylating PML.



View larger version (41K):
[in this window]
[in a new window]
  		Figure 4. PML desumoylation assay with VSV-tagged SENP1 and MESE (1.2 and 11.4) proteins. COS-1 cells were transfected with one or more of the following constructs: His–PML, Ha–SUMO-1, WT SENP1–VSV, MESE–VSV (11.4), MESE–VSV (1.2) or empty vector (PSG8). His–PML proteins were pulled down with the anti-polyhistidine antibody using immunoprecipitation (anti-polyhistidine IP) and subsequently detected on western blots: sumoylated His–PML with the anti-Ha antibody and desumoylated His–PML with the anti-polyhistidine antibody. SENP1 variants were visualized in the total cell lysates using an anti-VSV antibody. The molecular weights (in kilodaltons) from co-electrophoresed markers are indicated.

 
Anomalous subcellular localization of SEME
WT MESDC2 contains a putative N-terminal signal sequence and a non-conserved C-terminal ER-retention signal (Fig. 3). Previously, it was shown that a flag-tagged mouse homologue of MESDC2 co-localizes with the luminal ER protein calreticulin in COS-1 cells (38Go). In this study, we independently confirmed this localization by showing that a VSV-tagged human MESDC2 co-localizes with the ER protein PDI in HeLa cells (Fig. 5A). The translocation-related SEME fusion transcript contains the first two exons of SENP1 and exons 2 and 3 of MESDC2. A predicted ORF encodes an MESDC2 protein that lacks 106 amino acids at the N-terminus when compared with WT MESDC2 (Fig. 3). In addition, we detected a splice variant of SEME without the SENP1 exon 2 in the tumor material (SEME-2). The predicted ORF of this splice variant lacks 71 N-terminal MESDC2 amino acids and, instead, contains seven additional amino acids. Owing to the truncations, both SEME proteins lack the putative signal peptide that is required for the transport to the ER. Indeed, exogeneous expression of VSV-tagged SEME in HeLa cells revealed a diffuse staining pattern throughout the cytoplasm and no co-localization with PDI was observed (Fig. 5B). Therefore, we conclude that SEME is not localized at or in the ER. Control empty vector cells failed to yield any signals using the anti-VSV and secondary antibodies (data not shown).



View larger version (57K):
[in this window]
[in a new window]
  		Figure 5. Subcellular localization of MESDC2 (A) and SEME (B), using C-terminal VSV tags and SV40 promoters, after transient expression in HeLa cells. The proteins were visualized using an anti-VSV antibody (green; left panels). Endogenous PDI, an ER resident protein, was visualized with an anti-PDI antibody (red; middle panels). Overlays are shown in the right panels.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
Recently, we presented a novel case of a sacrococcygeal teratoma from an infantile patient carrying a constitutional t(12;15)(q13;q25). LOH experiments confirmed the presence of both reciprocal derivative chromosomes in the tumor material (34Go). In addition to this constitutional translocation, we identified one additional (somatic) cytogenetic aberration in this tumor, i.e. amplification of 20q and deletion of 20p (18Go). As the 12q13 region is recurrently affected in human GCTs (27Go,28Go), we set out to characterize this constitutional t(12;15)(q13;q25) translocation in detail. Using positional cloning strategies, we found that the breakpoints on chromosome 12 and chromosome 15 disrupt two genes, i.e. SENP1 and MESDC2, respectively. This resulted in the formation of two reciprocal fusion genes: SENP1–MESDC2 on the der(15Go) and MESDC2–SENP1 on the der(12Go). Next to the respective WT genes, both fusion genes (here referred to as SEME and MESE) appeared to be transcribed in the tumor tissue, and functional ORFs were predicted from them.

SUMO/Sentrin is an ubiquitin-like protein that covalently attaches to lysine residues in substrate proteins as a post-translational modification. In vertebrates, three SUMO family members have been described, i.e. SUMO-1, -2 and -3 (41Go,42Go). In contrast to ubiquitin, SUMO does not target proteins for proteasomal destruction. Instead, SUMO modification appears to be involved in the regulation of various cellular key processes, including transcriptional regulation, nuclear transport, maintenance of genome integrity and signal transduction (43Go–45Go). The SENP1 gene was first identified by Gong et al. (36Go) and encodes a cysteine-specific protease that deconjugates SUMO-1 from its target proteins. A recent in vitro study showed that SENP1 can also preprocess SUMO-1, -2 and -3 from their precursor forms (46Go). So far, seven SUMO-related proteases have been identified and deposited in the GenBank database (SENP1–SENP7). These proteases are homologous at their C-termini, a region that contains a conserved protease domain, the HIS/ASP/CYS catalytic triad. On the basis of the differences in subcellular localization and mRNA expression patterns, substrate specificities have been suggested for the various SENP family members (39Go,47Go–50Go). Interestingly, one of the family members, SENP6 (SUSP1) was recently found to be disrupted and fused to the TCBA1 gene in the lymphoma-derived cell line HT-1 (51Go). Also, SENP1 was detected as one of the 30 overexpressed genes in thyroid oncocytic tumors, using a two-step differential RT–PCR assay (52Go). Together with the present study, these findings strengthen a possible role for this protease family in cancer development.

Through a PML desumoylation assay, we established that the two translocation-associated MESE proteins (differing in only eight or one amino acid(s) from WT SENP1, respectively) exhibited desumoylation capacities similar to that observed for WT SENP1. In addition, the MESDC2–SENP1 fusion gene is under the control of the MESDC2 promoter. Therefore, we speculate that spatio-temporal disturbances in desumoylating activities during critical stages of embryonic development may lead to an abnormal regulation of gene transcription, nuclear transport, genome integrity and/or signal transduction in GCT precursor cells. In addition to these promoter-swap related phenomena, it should be noted that N-terminal truncation of the SENP1 protein may have additional in vivo effects on its biological activity and/or its substrate specificity. Such disturbances may have predisposed our patient to GCT development.

The mouse homologue of MESDC2 (aliases: Mesd in mouse, KIAA0081 in human and BOCA in fly) was first identified as a candidate gene present in the mouse proximal albino deletion interval, which is critical for mesoderm differentiation and polarity during embryonic development (37Go). Embryos homozygous for this deletion are lethal, fail to develop mesodermal structures and do not form a primitive streak (53Go). Hsieh et al. (38Go) demonstrated by transgene rescue that Mesd is the gene that is responsible for the polarity defects and embryonic lethality in these mice. Subsequently, transient expression in COS-1 cells demonstrated that Mesd may act as a chaperone located in the ER, which facilitates the membrane localization and prevents the aggregation of LDL receptor family members like the WNT co-receptors LRP5 and LRP6 (38Go,54Go). In this study we show that, in contrast to WT MESDC2, the translocation-associated SEME protein is no longer restricted to the ER. Consequently, it may have lost its capacity to act as a chaperone for the LDL receptors LRP5 and/or LRP6. Like the MESDC2–SENP1 fusion gene, the SENP1–MESDC2 fusion gene also has undergone a promoter swap. Again, such a swap may have spatio-temporal consequences during early embryogenesis, including an abnormal development and/or routing of GCT precursor cells. Obviously, additional studies are required to establish a definite role for desumoylation, LDL receptor aggregation or both, on the (de)regulation of GCT precursor cells. This novel constitutional chromosome translocation, however, appears to have revealed novel leads to candidate genes and pathways critical to the development of neonatal/infantile GCTs.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Patient material and somatic cell hybrids
Peripheral blood lymphocytes were used (informed consent) to generate an immortal t(12;15)(q13;q25)-positive cell line after in vitro Epstein–Barr virus transformation using standard procedures. For the preparation of somatic cell hybrids, these t(12;15)(q13;q25)-positive cells were fused with thymidine kinase-deficient Chinese hamster A3 cells as described earlier (55Go). Subsequently, independent somatic cell hybrids were isolated after hypoxanthine–aminoterine–thymidine (HAT) selection and their human chromosomal constitution was established through karyotyping, FISH analysis and PCR-screening with primers D12S63, D12S85, D12S1661 and D12S1701. Hybrid cell lines that contained the normal chromosome 12, the der(15Go) or the der(12Go), respectively, were selected for further analysis. No other chromosome 12 or chromosome 15 material was detected in these selected hybrid cell lines.

FISH analysis
Metaphase spreads from the t(12;15)(q13;q25)-positive cell line and its derived somatic cell hybrids were used for FISH analysis. Probe labeling, slide preparation and hybridization were performed essentially as described earlier (34Go,56Go). The following clones were used for FISH analysis: RP1-316M24, RP1-130F5, RP3-197B17 and RP1-228P16 (BACPAC Resources, Oakland, CA, USA)

A Zeiss epifluorescence microscope equipped with appropriate filters was used for visual examination of the slides. Digital images were captured using a high-performance cooled CCD camera (Photometrics) coupled to a Macintosh Quadra 950 computer and processed using the Oncor-image software (Gaithersburgh, MD, USA).

PCR and Southern blot analysis
Genomic DNAs were isolated as described previously (57Go). For mapping of the 12q13 breakpoint, genomic DNAs of the parental and hybrid cell lines were analyzed using different primer sets, including those flanking the breakpoint, i.e. 228p16-38f (TCACTTCTAGTGGCTGCACC) and 228p16-38r (AAACCCATTCTTTCACTACAGC), and 228p16-41f (GAGTTCTTTGAGAACAGTACG) and 228p16-41r (ATAGCACAGACATCTTAGAGC). The PCR fragment of primer set 228p16-38 was subsequently labeled with [{alpha}-32P]dCTP by random priming and used as a probe on Southern blots containing BglII- and HindIII-digested parental and hybrid cell-derived DNAs.

3'-RACE and RT–PCR analyses
Total RNA was isolated from the t(12;15)(q13;q25)-positive lymphoblastoid cell line and a control lymphoblastoid cell line using RNAzol B (Campro Scientific, Veenendaal, The Netherlands) according to the instructions of the manufacturer. RT–PCR was performed using Superscript II (Life Technologies, Gaithersburg, MD, USA), 5 µg of total RNA, the oligodT primer (AAGGATCCGTCGACATCTTTTTTTTTTTTTTTTT) and a random hexamer mix (Invitrogen, Breda, The Netherlands), again according to the instructions of the manufacturer. 3'-RACE analysis was carried out in two PCR steps. The first PCR was performed with a specific forward primer located in the first exon of SENP1 (GACTCTTCCGGTGCTGT) and a primer that hybridizes to the oligodT primer sequences (CUACUACUACUAAAGGATCCGTCGACATC). This PCR was carried out under standard conditions using 10 pmol of priming oligonucleotides. Samples were amplified during 30 cycles in a Perkin Elmer 2400 GeneAmp PCR System. Each cycle included 1 min at 94°C, 1 min at 55°C and 3 min at 72°C. In the first cycle, an extra denaturation step (94°C) was included for 1 min and the last cycle was extended at 72°C for 5 min. Subsequently, the PCR sample was diluted 10 times and used for the second PCR step, a hemi-nested PCR. Therefore, the following primers were used: a nested forward primer located in the first exon of SENP1 (CATCATCATCATCTGTGAAGGCGGTTCC) and the reverse primer that hybridizes to the oligodT primer sequences. PCR analyses (35 cycles) included 30 s at 94°C, 30 s at 55°C and 3 min at 72°C. In the first cycle, an extra denaturation step (94°C) was included for 2 min and the last cycle was extended at 72°C for 5 min. The PCR samples were loaded onto standard agarose gels and bands were sliced out, purified by standard procedures, ligated into pGEM-T vectors (Promega, Leiden, The Netherlands), according to the instructions of the manufacturer, and sequenced using SP6- and T7-specific primers. For additional PCR analyses, the following primers were used: Sprot-exon5r (GAGGTCTTTCGGGTTTCGAGG), Sprot-exon3r (AGCGAAAGCTGGTCCTCTGG), Sprot-raceFnest (CGCATGGCAGCCGGTTCCG), KIAA0081-exon3r (TTGCCCTTGTCTTGCTTTG), KIAA0081-exon1f (TTGTGCCTCTGACCTGCTGC) and KIAA0081-exon2r (CCTTCTCAGTAGGGCTTCC).

Plasmid constructs
On the basis of the published sequences of SENP1 (36Go) and MESDC2 (GenBank accession nos. KIAA0081 and BC009210) (37Go,38Go), cDNAs of SENP1, SENP1–MESDC2 (SEME) and MESDC2–SENP1 (MESE) were generated by RT–PCR on RNA extracted from the t(12;15)(q13;q25)-positive cell line using the oligodT primer, the random hexamer mix and Sprotex1-EcoRI-F (CGGAATTCTCTTCCGGTGCTGTGAAGG), Sprotex18-NheI-R (CTAGCTAGCTAGGAGTTTTCGGTGGAGGATC) and 5-BC009210-F (GGAATTCGGTAAGCGCGTCTAGGG). For the MESDC2 construct, cDNA was derived from a clone (3637449) of the IMAGE Consortium (58Go), using a primer specific for the SP6 promoter and 3-Mesdc2-R (GACTAGTGTCTTCTCTTTTATTCCCAGC). These cDNAs were cloned into a eukaryotic expression vector PSG8 (59Go) in frame with a VSV-tag at their 3'end. His–PML and Ha–SUMO-1 constructs were described earlier (36Go,60Go).

Cellular localization assays
HeLa cells were transfected directly on glass slides using FuGENE 6 (Roche Diagnostics, Mannheim, Germany), according to the instructions of the manufacturer. Immunofluorescence assays were performed essentially as described earlier (61Go). The following antibodies were used for immunostaining: the monoclonal mouse anti-VSV antibody (1:1000) (Sigma Genosys, Cambridge, UK) and the rabbit anti-PDI antibody (1:10) (62Go), followed by appropriate FITC or Texas Red-conjugated goat-anti-mouse antibody or goat-anti-rabbit antibody (1:100) (Jackson ImmunoResearch Laboratories Inc., West Grove, PA, USA). Images were recorded using a Zeiss LSM510 META confocal microscope running software release 3.2.

PML desumoylation assay
COS-1 cells were transfected by nucleofection (Amaxa, Koeln, Germany), according to the instructions of the manufacturer, with one or more of the following constructs (displayed in Fig. 4): His–PML, Ha–SUMO-1, MESE–VSV (11.4), MESE–VSV (1.2), WT SENP1–VSV or empty vector (PSG8). The cells were washed in ice-cold PBS ~24 h after transfection and lysed in ice-cold lysis buffer (50 mM HEPES pH 7.5, 150 mM NaCl, 1.5 mM MgCl2, 1 mM EDTA, 0.5% NP-40 and 0.3% Triton X-100) supplemented with protease inhibitors [100x dilution of 0.5 M DTE, 2 M ethylmaleimide, complete cocktail (Roche Diagnostics) and 100 mM PMSF]. Before IP, aliquotes of the cell lysates were used to assay the expression levels from the different SENP1–VSV constructs. For IP-mediated extraction of the PML conjugates, a monoclonal anti-polyhistidine antibody (Sigma Genosys) was added to the cell lysates (100x dilution) and mixed by tumbling for minimal 4 h at 4°C. Subsequently, protein A beads (Sigma Genosys) were added (10% v/v) after washing with ice-cold lysis buffer and mixed by tumbling for an additional 1–2 h at 4°C. After several washes, the samples (before and after IP) were boiled for 5 min in SDS sample buffer before loading onto SDS polyacrylamide gels (7.5%) and, subsequently, transferred to PROTRAN nitrocellulose membranes (Schleicher and Schuell, Dassel, Germany). For immunodetection of the samples on the membranes, a mouse anti-Ha (1 : 1000), a mouse monoclonal anti-polyhistidine (1 : 3000) and an anti-VSV (1 : 10) (P5D4) antibodies were used. As secondary antibodies, a rabbit-anti-mouse-HRP or a swine-anti-rabbit-HRP was used (1:1000) (DAKO, Denmark). Immunostaining was performed using chemoluminesence.


   ACKNOWLEDGEMENTS
 
The authors thank Marga Schepens for expert technical assistance, Martien van Asseldonk for advice and support, Jack Fransen for antibodies, advice and support and Lutgarde Govaerts, Cokkie Wouters, Rosalyn Slater and Jan van Hemel for referring this case to us and for providing patient material.

Conflict of Interest statement. None declared.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Looijenga, L.H. and Oosterhuis, J.W. (1999) Pathogenesis of testicular germ cell tumours. Rev. Reprod., 4, 90–100.[Abstract]

  2. Oosterhuis, J.W., Looijenga, L.H., van Echten, J. and de Jong, B. (1997) Chromosomal constitution and developmental potential of human germ cell tumors and teratomas. Cancer Genet. Cytogenet., 95, 96–102.[CrossRef][Web of Science][Medline]

  3. Schneider, D.T., Calaminus, G., Koch, S., Teske, C., Schmidt, P., Haas, R.J., Harms, D. and Gobel, U. (2004) Epidemiologic analysis of 1442 children and adolescents registered in the German germ cell tumor protocols. Pediatr. Blood Cancer, 42, 169–175.[CrossRef][Web of Science][Medline]

  4. van Echten, J., Timmer, A., van der Veen, A.Y., Molenaar, W.M. and de Jong, B. (2002) Infantile and adult testicular germ cell tumors. A different pathogenesis? Cancer Genet. Cytogenet., 135, 57–62.[CrossRef][Web of Science][Medline]

  5. Veltman, I.M., Schepens, M.T., Looijenga, L.H.J., Strong, L.C. and Geurts van Kessel, A. (2003) Germ cell tumours in neonates and infants: a distinct subgroup? APMIS, 111, 152–160.[CrossRef][Web of Science][Medline]

  6. Perlman, E.J., Valentine, M.B., Griffin, C.A. and Look, A.T. (1996) Deletion of 1p36 in childhood endodermal sinus tumors by two-color fluorescence in situ hybridization: a pediatric oncology group study. Genes Chromosomes Cancer, 16, 15–20.[CrossRef][Web of Science][Medline]

  7. Perlman, E.J., Hu, J., Ho, D., Cushing, B., Lauer, S. and Castleberry, R.P. (2000) Genetic analysis of childhood endodermal sinus tumors by comparative genomic hybridization. J. Pediatr. Hematol. Oncol., 22, 100–105.[CrossRef][Web of Science][Medline]

  8. Mostert, M., Rosenberg, C., Stoop, H., Schuyer, M., Timmer, A., Oosterhuis, J. and Looijenga, L. (2000) Comparative genomic and in situ hybridization of germ cell tumors of the infantile testis. Lab Invest., 80, 1055–1064.[Web of Science][Medline]

  9. Schneider, D.T., Schuster, A.E., Fritsch, M.K., Hu, J., Olson, T., Lauer, S., Gobel, U. and Perlman, E.J. (2001) Multipoint imprinting analysis indicates a common precursor cell for gonadal and nongonadal pediatric germ cell tumors. Cancer Res., 61, 7268–7276.[Abstract/Free Full Text]

  10. Damjanov, I. (1993) Teratocarcinoma: neoplastic lessons about normal embryogenesis. Int. J. Dev. Biol., 37, 39–46.[Medline]

  11. Andrews, P.W. (2002) From teratocarcinomas to embryonic stem cells. Philos. Trans. R. Soc. Lond B Biol. Sci., 357, 405–417.[Abstract/Free Full Text]

  12. Tzukerman, M., Rosenberg, T., Ravel, Y., Reiter, I., Coleman, R. and Skorecki, K. (2003) An experimental platform for studying growth and invasiveness of tumor cells within teratomas derived from human embryonic stem cells. Proc. Natl Acad. Sci. USA, 100, 13507–13512.[Abstract/Free Full Text]

  13. Langa, F., Kress, C., Colucci-Guyon, E., Khun, H., Vandormael-Pournin, S., Huerre, M. and Babinet, C. (2000) Teratocarcinomas induced by embryonic stem (ES) cells lacking vimentin: an approach to study the role of vimentin in tumorigenesis. J. Cell Sci., 113, 3463–3472.[Abstract]

  14. Bussey, K.J., Lawce, H.J., Olson, S.B., Arthur, D.C., Kalousek, D.K., Krailo, M., Giller, R., Heifetz, S., Womer, R. and Magenis, R.E. (1999) Chromosome abnormalities of eighty-one pediatric germ cell tumors: sex-, age-, site-, and histopathology-related differences—a children's cancer group study. Genes Chromosomes Cancer, 25, 134–146.[CrossRef][Web of Science][Medline]

  15. Schneider, D.T., Schuster, A.E., Fritsch, M.K., Calaminus, G., Gobel, U., Harms, D., Lauer, S., Olson, T. and Perlman, E.J. (2002) Genetic analysis of mediastinal nonseminomatous germ cell tumors in children and adolescents. Genes Chromosomes Cancer, 34, 115–125.[CrossRef][Web of Science][Medline]

  16. Hu, J., Schuster, A.E., Fritsch, M.K., Schneider, D.T., Lauer, S. and Perlman, E.J. (2001) Deletion mapping of 6q21–26 and frequency of 1p36 deletion in childhood endodermal sinus tumors by microsatellite analysis. Oncogene, 20, 8042–8044.[CrossRef][Web of Science][Medline]

  17. Perlman, E.J., Cushing, B., Hawkins, E. and Griffin, C.A. (1994) Cytogenetic analysis of childhood endodermal sinus tumors: a pediatric oncology group study. Pediatr. Pathol., 14, 695–708.[Web of Science][Medline]

  18. Veltman, I., Veltman J., Janssen I., Hulsbergen-van de Kaa C., Oosterhuis W., Schneider D., Stoop H., Gillis A., Zahn S., Looijenga L. et al. (2005) Identification of recurrent chromosomal aberrations in germ cell tumors of neonates and infants using genome-wide array-based comparative genomic hybridization. Genes Chromosomes Cancer, doi:10.1002/gcc.20208.

  19. Looijenga, L.H., Zafarana, G., Grygalewicz, B., Summersgill, B., Debiec-Rychter, M., Veltman, J., Schoenmakers, E.F., Rodriguez, S., Jafer, O., Clark, J. et al. (2003) Role of gain of 12p in germ cell tumour development. APMIS, 111, 161–171.[CrossRef][Web of Science][Medline]

  20. Honorio, S., Agathanggelou, A., Wernert, N., Rothe, M., Maher, E.R. and Latif, F. (2003) Frequent epigenetic inactivation of the RASSF1A tumour suppressor gene in testicular tumours and distinct methylation profiles of seminoma and nonseminoma testicular germ cell tumours. Oncogene, 22, 461–466.[CrossRef][Web of Science][Medline]

  21. Looijenga, L.H., de Leeuw, H., van Oorschot, M., van Gurp, R.J., Stoop, H., Gillis, A.J., Gouveia Brazao, C.A., Weber, R.F., Kirkels, W.J., van Dijk, T. et al. (2003) Stem cell factor receptor (c-KIT) codon 816 mutations predict development of bilateral testicular germ-cell tumors. Cancer Res., 63, 7674–7678.[Abstract/Free Full Text]

  22. Schmidt, B.A., Rose, A., Steinhoff, C., Strohmeyer, T., Hartmann, M. and Ackermann, R. (2001) Up-regulation of cyclin-dependent kinase 4/cyclin D2 expression but down-regulation of cyclin-dependent kinase 2/cyclin E in testicular germ cell tumors. Cancer Res., 61, 4214–4221.[Abstract/Free Full Text]

  23. Zafarana, G., Gillis, A.J., van Gurp, R.J., Olsson, P.G., Elstrodt, F., Stoop, H., Millan, J.L., Oosterhuis, J.W. and Looijenga, L.H. (2002) Coamplification of DAD-R, SOX5, and EKI1 in human testicular seminomas, with specific overexpression of DAD-R, correlates with reduced levels of apoptosis and earlier clinical manifestation. Cancer Res., 62, 1822–1831.[Abstract/Free Full Text]

  24. Oosterhuis, J.W. and Looijenga, L.H. (2003) Current views on the pathogenesis of testicular germ cell tumours and perspectives for future research: highlights of the 5th Copenhagen Workshop on Carcinoma in situ and Cancer of the Testis. APMIS, 111, 280–289.[CrossRef][Medline]

  25. Rapley, E.A., Crockford, G.P., Teare, D., Biggs, P., Seal, S., Barfoot, R., Edwards, S., Hamoudi, R., Heimdal, K., Fossa, S.D. et al. (2000) Localization to Xq27 of a susceptibility gene for testicular germ-cell tumours. Nat. Genet., 24, 197–200.[CrossRef][Web of Science][Medline]

  26. Rapley, E.A., Crockford, G.P., Easton, D.F., Stratton, M.R. and Bishop, D.T. (2003) Localisation of susceptibility genes for familial testicular germ cell tumour. APMIS, 111, 128–133.[CrossRef][Web of Science][Medline]

  27. Murty, V.V., Houldsworth, J., Baldwin, S., Reuter, V., Hunziker, W., Besmer, P., Bosl, G. and Chaganti, R.S. (1992) Allelic deletions in the long arm of chromosome 12 identify sites of candidate tumor suppressor genes in male germ cell tumors. Proc. Natl Acad. Sci. USA, 89, 11006–11010.[Abstract/Free Full Text]

  28. Samaniego, F., Rodriguez, E., Houldsworth, J., Murty, V.V., Ladanyi, M., Lele, K.P., Chen, Q.G., Dmitrovsky, E., Geller, N.L. and Reuter, V. (1990) Cytogenetic and molecular analysis of human male germ cell tumors: chromosome 12 abnormalities and gene amplification. Genes Chromosomes Cancer, 1, 289–300.[Web of Science][Medline]

  29. Rodriguez, E., Mathew, S., Reuter, V., Ilson, D.H., Bosl, G.J. and Chaganti, R.S. (1992) Cytogenetic analysis of 124 prospectively ascertained male germ cell tumors. Cancer Res., 52, 2285–2291.[Abstract/Free Full Text]

  30. Betts, D.R., Greiner, J., Feldges, A., Caflisch, U. and Niggli, F.K. (2001) Constitutional balanced chromosomal rearrangements and neoplasm in children. J. Pediatr. Hematol. Oncol., 23, 582–584.[CrossRef][Web of Science][Medline]

  31. Bodmer, D., van den Hurk, H.W., van Groningen, J.J., Eleveld, M.J., Martens, G.J., Weterman, M.A. and Geurts van Kessel, A. (2002) Understanding familial and non-familial renal cell cancer. Hum. Mol. Genet., 11, 2489–2498.[Abstract/Free Full Text]

  32. Ganly, P., McDonald, M., Spearing, R. and Morris, C.M. (2004) Constitutional t(5;7)(q11;p15) rearranged to acquire monosomy 7q and trisomy 1q in a patient with myelodysplastic syndrome transforming to acute myelocytic leukemia. Cancer Genet. Cytogenet., 149, 125–130.[CrossRef][Web of Science][Medline]

  33. Roberts, T., Chernova, O. and Cowell, J.K. (1998) NB4S, a member of the TBC1 domain family of genes, is truncated as a result of a constitutional t(1;10)(p22;q21) chromosome translocation in a patient with stage 4S neuroblastoma. Hum. Mol. Genet., 7, 1169–1178.[Abstract/Free Full Text]

  34. Veltman, I., van Asseldonk, M., Schepens, M., Stoop, H., Looijenga, L., Wouters, C., Govaerts, L., Suijkerbuijk, R. and Geurts van Kessel, A. (2002) A novel case of infantile sacral teratoma and a constitutional t(12;15)(q13;q25) pat. Cancer Genet. Cytogenet., 136, 17–22.[CrossRef][Web of Science][Medline]

  35. Veltman, I.M., Veltman, J.A., Arkesteijn, G., Janssen, I.M., Vissers, L.E., de Jong, P.J., Geurts van Kessel, A. and Schoenmakers, E.F. (2003) Chromosomal breakpoint mapping by arrayCGH using flow-sorted chromosomes. Biotechniques, 35, 1066–1070.[Web of Science][Medline]

  36. Gong, L., Millas, S., Maul, G.G. and Yeh, E.T. (2000) Differential regulation of sentrinized proteins by a novel sentrin-specific protease. J. Biol. Chem., 275, 3355–3359.[Abstract/Free Full Text]

  37. Wines, M.E., Lee, L., Katari, M.S., Zhang, L., DeRossi, C., Shi, Y., Perkins, S., Feldman, M., McCombie, W.R. and Holdener, B.C. (2001) Identification of mesoderm development (mesd) candidate genes by comparative mapping and genome sequence analysis. Genomics, 72, 88–98.[CrossRef][Web of Science][Medline]

  38. Hsieh, J.C., Lee, L., Zhang, L., Wefer, S., Brown, K., DeRossi, C., Wines, M.E., Rosenquist, T. and Holdener, B.C. (2003) Mesd encodes an LRP5/6 chaperone essential for specification of mouse embryonic polarity. Cell, 112, 355–367.[CrossRef][Web of Science][Medline]

  39. Bailey, D. and O'Hare, P. (2004) Characterization of the localization and proteolytic activity of the SUMO-specific protease, SENP1. J. Biol. Chem., 279, 692–703.[Abstract/Free Full Text]

  40. Nefkens, I., Negorev, D.G., Ishov, A.M., Michaelson, J.S., Yeh, E.T., Tanguay, R.M., Muller, W.E. and Maul, G.G. (2003) Heat shock and Cd2+ exposure regulate PML and Daxx release from ND10 by independent mechanisms that modify the induction of heat-shock proteins 70 and 25 differently. J. Cell Sci., 116, 513–524.[Abstract/Free Full Text]

  41. Ayaydin, F. and Dasso, M. (2004) Distinct in vivo dynamics of vertebrate SUMO paralogues. Mol. Biol. Cell, 15, 5208–5218.[Abstract/Free Full Text]

  42. Kamitani, T., Kito, K., Nguyen, H.P., Fukuda-Kamitani, T. and Yeh, E.T. (1998) Characterization of a second member of the sentrin family of ubiquitin-like proteins. J. Biol. Chem., 273, 11349–11353.[Abstract/Free Full Text]

  43. Gill, G. (2004) SUMO and ubiquitin in the nucleus: different functions, similar mechanisms? Genes Dev., 18, 2046–2059.[Abstract/Free Full Text]

  44. Muller, S., Ledl, A. and Schmidt, D. (2004) SUMO: a regulator of gene expression and genome integrity. Oncogene, 23, 1998–2008.[CrossRef][Web of Science][Medline]

  45. Yeh, E.T., Gong, L. and Kamitani, T. (2000) Ubiquitin-like proteins: new wines in new bottles. Gene, 248, 1–14.[CrossRef][Web of Science][Medline]

  46. Xu, Z. and Au, S.W. (2004) Mapping residues of SUMO precursors essential in differential maturation by SUMO-specific protease, SENP1. Biochem. J. 386, 325–330.

  47. Bachant, J., Alcasabas, A., Blat, Y., Kleckner, N. and Elledge, S.J. (2002) The SUMO-1 isopeptidase Smt4 is linked to centromeric cohesion through SUMO-1 modification of DNA topoisomerase II. Mol. Cell, 9, 1169–1182.[CrossRef][Web of Science][Medline]

  48. Hang, J. and Dasso, M. (2002) Association of the human SUMO-1 protease SENP2 with the nuclear pore. J. Biol. Chem., 277, 19961–19966.[Abstract/Free Full Text]

  49. Kim, K.I., Baek, S.H., Jeon, Y.J., Nishimori, S., Suzuki, T., Uchida, S., Shimbara, N., Saitoh, H., Tanaka, K. and Chung, C.H. (2000) A new SUMO-1-specific protease, SUSP1, that is highly expressed in reproductive organs. J. Biol. Chem., 275, 14102–14106.[Abstract/Free Full Text]

  50. Nishida, T., Tanaka, H. and Yasuda, H. (2000) A novel mammalian Smt3-specific isopeptidase 1 (SMT3IP1) localized in the nucleolus at interphase. Eur. J. Biochem., 267, 6423–6427.[Web of Science][Medline]

  51. Tagawa, H., Miura, I., Suzuki, R., Suzuki, H., Hosokawa, Y. and Seto, M. (2002) Molecular cytogenetic analysis of the breakpoint region at 6q21–22 in T-cell lymphoma/leukemia cell lines. Genes Chromosomes Cancer, 34, 175–185.[CrossRef][Web of Science][Medline]

  52. Jacques, C., Baris, O., Prunier-Mirebeau, D., Savagner, F., Rodien, P., Rohmer, V., Franc, B., Guyetant, S., Malthiery, Y. and Reynier, P. (2004) Two-step differential expression analysis reveals a new set of genes involved in thyroid oncocytic tumors. J. Clin. Endocrinol. Metab., 90, 2314–2320.[Medline]

  53. Holdener, B.C., Faust, C., Rosenthal, N.S. and Magnuson, T. (1994) msd is required for mesoderm induction in mice. Development, 120, 1335–1346.[Abstract]

  54. Herz, J. and Marschang, P. (2003) Coaxing the LDL receptor family into the fold. Cell, 112, 289–292.[CrossRef][Web of Science][Medline]

  55. Geurts van Kessel, A., Tetteroo, P.A., dem Borne, A.E., Hagemeijer, A. and Bootsma, D. (1983) Expression of human myeloid-associated surface antigens in human–mouse myeloid cell hybrids. Proc. Natl Acad. Sci. USA, 80, 3748–3752.[Abstract/Free Full Text]

  56. de Bruijn, D.R., Kater-Baats, E., Eleveld, M., Merkx, G. and Geurts van Kessel, A. (2001) Mapping and characterization of the mouse and human SS18 genes, two human SS18-like genes and a mouse Ss18 pseudogene. Cytogenet. Cell Genet., 92, 310–319.[CrossRef][Web of Science][Medline]

  57. Weterman, M.A., Wilbrink, M. and Geurts van Kessel, A. (1996) Fusion of the transcription factor TFE3 gene to a novel gene, PRCC, in t(X;1)(p11;q21)-positive papillary renal cell carcinomas. Proc. Natl Acad. Sci. USA, 93, 15294–15298.[Abstract/Free Full Text]

  58. Bonaldo, M.F., Lennon, G. and Soares, M.B. (1996) Normalization and subtraction: two approaches to facilitate gene discovery. Genome Res., 6, 791–806.[Abstract/Free Full Text]

  59. Cuppen, E., Gerrits, H., Pepers, B., Wieringa, B. and Hendriks, W. (1998) PDZ motifs in PTP-BL and RIL bind to internal protein segments in the LIM domain protein RIL. Mol. Biol. Cell, 9, 671–683.[Abstract/Free Full Text]

  60. Kamitani, T., Kito, K., Nguyen, H.P., Wada, H., Fukuda-Kamitani, T. and Yeh, E.T. (1998) Identification of three major sentrinization sites in PML. J. Biol. Chem., 273, 26675–26682.[Abstract/Free Full Text]

  61. Weterman, M.J., van Groningen, J.J., Jansen, A. and Geurts van Kessel, A. (2000) Nuclear localization and transactivating capacities of the papillary renal cell carcinoma-associated TFE3 and PRCC (fusion) proteins. Oncogene, 19, 69–74.[CrossRef][Web of Science][Medline]

  62. John, D.C., Grant, M.E. and Bulleid, N.J. (1993) Cell-free synthesis and assembly of prolyl 4-hydroxylase: the role of the beta-subunit (PDI) in preventing misfolding and aggregation of the alpha-subunit. EMBO J., 12, 1587–1595.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 GENES CELLSHome page
T. Kuwata and T. Nakamura
BCL11A is a SUMOylated protein and recruits SUMO-conjugation enzymes in its nuclear body
Genes Cells, September 1, 2008; 13(9): 931 - 940.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
14/14/1955    most recent
ddi200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Veltman, I. M.
Right arrow Articles by van Kessel, A. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Veltman, I. M.
Right arrow Articles by van Kessel, A. G.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?