Skip Navigation


Human Molecular Genetics Advance Access originally published online on July 27, 2005
Human Molecular Genetics 2005 14(17):2547-2557; doi:10.1093/hmg/ddi258
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
14/17/2547    most recent
ddi258v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Galy, A.
Right arrow Articles by Giangrande, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Galy, A.
Right arrow Articles by Giangrande, A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oupjournals.org

Rhodopsin maturation defects induce photoreceptor death by apoptosis: a fly model for RhodopsinPro23His human retinitis pigmentosa

Anne Galy1,2, Michel Joseph Roux2, José Alain Sahel2, Thierry Léveillard2,{dagger} and Angela Giangrande1,*,{dagger}

1Institut de Génétique et de Biologie Moléculaire et Cellulaire, CNRS/INSERM/ULP, BP 10142, 67404 Illkirch Cedex, CU de Strasbourg, France and 2INSERM U592, Laboratoire de Physiopathologie Moléculaire et Cellulaire de la Rétine, 75571 Paris Cedex 12, France

* To whom correspondence should be addressed. Tel: +33 388653381; Fax: +33 388653201; Email: angela{at}titus.u-strasbg.fr

Received March 8, 2005; Revised May 4, 2005; Accepted July 13, 2005


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
rhodopsin mutations result in autosomal dominant retinitis pigmentosa (ADRP), the most frequent being Proline-23 substitution by histidine (RhoP23H). Although cellular and rodent animal models have been developed, the pathogenic mechanisms leading to RhoP23H-induced cell death are still poorly understood. For this, we have used a Drosophila model by introducing a mutation in the fly rhodopsin-1 gene (Rh1P37H) that corresponds to human RhoP23H. Rh1P37H transgenic flies show dominant photoreceptor degeneration that mimics age-, light-dependent and progressive ADRP. Moreover, we clarify the pathogenic mechanism of Rh1P37H mutation that acts as an antimorph. First, we show the dual-localization of mutant Rhodopsin since most of Rh1P37H accumulates in endoplasmic reticulum. Second, expression of mutant, mislocalized, Rhodopsin leads to cytotoxicity, via the activation of two stress-specific mitogen-activated protein kinases (MAPKs), p38 and JNK, which are known to control stress-induced apoptosis. In Rh1P37H flies, visual loss and degeneration are indeed accompanied by apoptotic features and prevented by expression of p35 apoptosis inhibitor. Finally, we show for the first time that properly localized, mutant, Rhodopsin is active. Thus, the development of a fly model that faithfully reproduces the human disease sheds light onto the molecular defects causing ADRP thereby making it possible to devise potential therapeutic approaches.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Retinitis pigmentosa (RP) represents a group of inherited disorders causing photoreceptor degeneration. Even though RPs are heterogeneous for disease severity and affected gene, they are all characterized by progressive blindness that is at present neither preventable nor curable (1Go). Twenty-five percent of autosomal dominant retinitis pigmentosa (ADRP) is linked to more than 100 different mutations scattered throughout the rhodopsin gene and affect different processes (http://www.sph.uth.tmc.edu/Retnet/) (2Go).

Proline substitution at position-23 by histidine (P23H) is the most frequent rhodopsin mutation causing ADRP (3Go). Moreover, Proline-23 by leucine (P23L) or by alanine (P23A) substitutions are also associated with ADRP (4Go,5Go). Although transgenic mice and rats expressing RhoP23H recapitulate dominant photoreceptor degeneration, the pathogenic mechanism is still under debate (6Go,7Go), for most of the other photoreceptor degenerative models (8Go). Moreover, controversial data on the subcellular localization of the mutant protein make it difficult to clarify the molecular bases of the RhoP23H-induced degenerative phenotype. Drosophila has been successfully used to study human pathologies (9Go). Moreover, despite a different overall organization, fly and vertebrate retina share structural and molecular features: photoreceptor cells display similar structures sensitive to light, as Drosophila rhabdomeres are functionally equivalent to vertebrate photoreceptor outer-segments. Moreover, light stimuli are transduced by pathways that display many common key players (10Go,11Go).

We have developed a transgenic approach to study RhoP23H-induced RP and shown that flies harboring a mutated Rhodopsin-1, Rh1P37H, analogous to human RhoP23H, develop dominant photoreceptor degeneration linked to progressive loss of vision. This age- and light-dependent phenotype recapitulates the phenotypes observed in RhoP23H patients and rodents. We show that mutant Rhodopsin is partially active and that it interferes with the phototransduction pathway. Although part of the Rh1P37H protein is properly transported to photoreceptor rhabdomeres, most of it is trapped in rough endoplasmic reticulum (ER), triggering activation of stress-specific p38 and JNK mitogen-activated protein kinases (MAPKs). Finally, the degeneration phenotype is rescued by p35 anti-apoptotic factor.

In conclusion, our fly model constitutes a promising genetic tool to uncover the molecular mechanisms underlying retinal degeneration and to identify potential therapeutic pathways.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Rh1P37H induces dominant light- and age-dependent retinal degeneration in flies
Drosophila compound eye is comprised 800 ommatidia, each harboring eight photoreceptors (R1–R8). Photoreceptor rhabdomeres are specialized portions of plasma membrane comprised thousands of microvilli corresponding to vertebrate photoreceptor outer-segments and containing phototransduction proteins.

Rhodopsin-1 (Rh1), which is expressed in outer photoreceptors (R1–R6), represents the major fly Rhodopsin and displays 22% amino acid identity with human Rhodopsin (12Go,13Go). Amino acid alignment of opsins throughout phyla highlights both conservation of Proline-23 in vertebrates and its correspondence with Proline-37 in Drosophila (http://www.gpcr.org/7tm/seq/001_004/001_004.MSF.mview2.html and Supplementary Material, Fig. S1). This residue lies in the N-terminal, extracellular part of the protein, a region of unknown function.

To develop a fly model for RhodopsinP23H (RhoP23H)-induced RP, we substituted Proline-37 by histidine and produced transgenic flies that, in addition to endogenous Rh1, express either Rh1P37H or wild-type Rh1 (Rh1WT) under the control of the rh1 promoter (14Go) (referred to as lines Rh1P37H and Rh1WT throughout the text).

RhoP23H patients and rodents present no vision deficit at birth (3Go,7Go,15Go,16Go). To determine whether Rh1P37H causes age-dependent retinal degeneration in flies, we investigated photoreceptor morphology as a function of age. Rhabdomeres of wild-type and transgenic (Rh1WT and Rh1P37H) flies raised under day/night light conditions show no sign of photoreceptor degeneration at eclosion (Fig. 1A, C and E). Rh1P37H flies, however, display vacuoles in R1–R6 cytoplasm (data not shown) and slightly mislocalized (in 80% of the samples) (Fig. 1C). This very first degeneration signs are due to light exposure during pupal life, because pupae of the same genotype kept in the dark show no cytoplasm defect (data not shown).



View larger version (93K):
[in this window]
[in a new window]
  		Figure 1. Rh1P37H induces dominant R1–R6 degeneration. Drosophila eye transverse semi-thin sections at day 1 (A, C, E, G–K) and day 21 (B, D, F). Animals are grown under 12 h light/dark conditions (A–F) or kept under constant light illumination during 1 day (G–K). (A, B) Wild-type; (C, D, G, I–K) Rh1P37H; (E, F, H) Rh1WT. Insets show rhabdomere schematic representation in normal eye (B) and after R1–R6 degeneration (D). White arrowheads show R7 photoreceptors (A–F) and black arrowheads show sub-rhabdomeric area in the wild-type (H, I). Asterisks show lysosomes (G, J, K). Vacuoles are indicated by (V) (J, K). Scale bar 5 µm (A–F), 1 µm (G, I, J) and 0.5 µm (H, K).

 
Large number of R1–R6 photoreceptors degenerate by day 21 post-eclosion (Fig. 1D) and inner photoreceptors (R7 and R8) remaining intact (white arrow heads in Fig. 1D); in contrast, wild-type flies show no sign of degeneration throughout life (Fig. 1B). Morphological signs of degeneration such as reduced or absent rhabdomeres are observed by day 14 (Supplementary Material, Fig. S2A). This phenotype is highly penetrant, because each ommatidium is affected (Fig. 1D). Like vertebrate RhoP23H, Rh1P37H induces a dominant phenotype, as flies carry both wild-type and mutant genes. Rh1WT transgenic photoreceptors, in contrast, display normal morphology at day 21 (Fig. 1F).

RhoP23H-induced retinal degeneration is light-sensitive (17Go–20Go). Similarly, Rh1P37H flies reared in the dark do not display a degenerative phenotype, even after 35 days of post-eclosion (Supplementary Material, Fig. S2B). Furthermore, Rh1P37H-expressing photoreceptors (Fig. 1G and I–K) were kept under constant light illumination during 24 h and subsequently analyzed, already present degenerative signs, such as involution of microvillar rhabdomere membranes (see arrows in Fig. 1I). Degenerating photoreceptor cytoplasm also contains a large number of lysosomes (see asterisks in Fig. 1G and J–K) and vacuoles (see ‘V’ in Fig. 1J and K), as found by electron microscopy. Such degenerative signs are not observed in control, Rh1WT-expressing, photoreceptors (Fig. 1H). Therefore, the fly Rh1P37H-induced dominant retinal degeneration is age- and light-dependent.

Rh1P37H induces progressive blindness
RhoP23H-induced photoreceptor degeneration is associated with progressive blindness (6Go,15Go,16Go,21Go) and therefore we analyzed the visual activity of Rh1P37H flies at different ages.

Behavioral assay
Wild-type flies are attracted by light, a phenotype that is abolished in blind strains (22Go). We therefore assayed Rh1P37H flies for fast phototaxis, a behavioral assay measuring the visual activity of a fly population (23Go). In each test, flies are submitted to a sequence of five light stimuli in a countercurrent apparatus (Fig. 2A). Flies walking toward light are separated from those that do not, so that after the assay, the fly population is fractionated into six tubes for visual activity. Positive phototactic flies respond to light and reach the last tubes, whereas non-phototactic flies do not respond to light and stay in the first tubes. Flies with reduced visual activity end are distributed in the intermediate tubes.



View larger version (30K):
[in this window]
[in a new window]
  		Figure 2. Aged Rh1P37H flies display altered fast phototaxis and ERG. (A) Principle of phototactic assay: a—1 to 6 indicate tube numbers; b—prior to the test, the fly population is placed at the bottom of tube 1 (white arrow). The apparatus is placed horizontally, flies are allowed to walk toward light during 30 s (black arrow). Tubes are shifted and flies are placed at the bottom of the following tube (white arrow) to start the test again. Flies that have responded to light are in tube 2, whereas others stay in tube 1. The test is reiterated five times. Phototaxis histograms at day 1 (solid colored columns B) and day 14 (medium shade columns C) under day/nightlight conditions. x and y axes represent the tube number and fly percentage, respectively. Columns indicate the percentage of flies that have reached the tube annotated in x-axis. Values for wild-type (WT), Rh1WT and Rh1P37H flies are represented in black, purple and orange, respectively. Each value represents the average of at least six assays scoring for independent populations of at least 20 flies each. Total number of flies is noted. (D) PS quantifies visual activity, taking into account both number of flies in each tube and the number of times they have ran toward light following a weighted equation: ({Sigma}iNi)/{Sigma}Ni, where N is the number of flies in the ith tube. Left (solid coloured), right (light shade) and middle columns represent average PS at days 1, 14 and 7, respectively. Error bars show s.e.m. Significance is evaluated using Student's t-test and indicated on bars (*P<0.05; ***P<0.0001). (E) ERG at day 1: Rh1-null (grey), Rh1P37H (orange), Rh1WT (purple) and wild-type (black). Striped box indicates light stimulus duration. Plateau represents photoreceptor depolarization. ON and OFF spikes represent synaptic transmission. Time scale: 1 s. Stimulus intensity scale: 5 mV. (F) Average depolarization amplitudes: at days 1, 14, 35, 42, 49 and 56, color coding as above. Error bars indicate s.e.m. Number of fly tested is between 14 and 29 except for Rh1-null at day 49 (n=6) and Rh1P37H at day 56 (n=4).

 
We performed the phototaxis assay at days 1, 7 and 14 on wild-type flies and on Rh1P37H or Rh1WT transgenic flies (Fig. 2B–D). Wild-type and Rh1WT flies show positive phototaxis, both at days 1 and 14, indicating that the Rh1WT transgene does not modify fly vision throughout life (compare black and purple columns in Fig. 2B and C). In contrast, Rh1P37H flies are normal at day 1 (orange columns in Fig. 2B), but display strongly reduced phototaxis at day 14, as shown by the large proportion of flies in the first two tubes (Fig. 2C).

A quantitative evaluation of the phototactic behavior is represented by the phototactic score (PS) (24Go), a parameter taking into account the total number of flies and the number of times flies have walked toward light, following a weighted average (see Fig. 2). Theoretically, for phototactic positive and non-phototactic flies, PS corresponds to 6 and 1, respectively. Experimentally, day 14 wild-type and Rh1-null (I17) flies display a PS of 5.1 and 1.1, respectively (light grey column in Fig. 2D and data not shown). At the same age, mutant (Rh1P37H=3.1), but not wild-type (Rh1WT=4.3), transgenic flies display a significantly low PS (light shade columns in Fig. 2D). Finally, at day 1, both transgenic lines display a PS similar to that of wild-type flies and are therefore phototactic positive (solid coloured columns in Fig. 2D). Similar results are obtained in a genetic background that corresponds exactly to that of RP patients. Indeed, Rh1-null flies, in which one copy of mutated gene and one copy of WT gene have been reintroduced, show a PS of 4.7 at day 1 and 3.1 at day 14 (data not shown). Rh1P37H-induced defects are already detectable at day 7 and flies displaying intermediate visual activity (middle column of each genotype in Fig. 2D). Thus, Rh1P37H eye morphology correlates with visual behavior. Moreover, fast phototaxis provides a non-invasive, functional assay that detects progressive blindness well before morphological defects become manifest.

Electrophysiological assay
Phototactic behavior integrates parameters as diverse as locomotion, photoreceptor stimulation, phototransduction, synaptic transmission to second-order neurons and integration into the fly brain. To corroborate phototaxis data, we performed a direct measurement of visual activity by analyzing the electroretinogram (ERG). Fly ERG displays photoreceptor depolarization (Plateau), which corresponds to phototransduction cascade activation, and transient spikes following initiation and cessation of the light stimulus (ON and OFF), which results from synaptic activity (Fig. 2E) (25Go). This method allows for scoring of aged animals, which is not possible with the fast phototaxis assay, because locomotion decreases with age.

To accumulate further evidence of progressive blindness, we measured ERGs at different ages (days 1–56) in flies of the following genotypes: wild-type, Rh1P37H, Rh1WT and Rh1-null (Fig. 2F). Rh1-null flies, which lack R1–R6 activity (12Go), provide a negative control and show reduced ERG resulting from R7 and R8 (Fig. 2E) (26Go). Rh1P37H flies display ERG amplitude similar to that of Rh1WT and WT flies at day 1 (Fig. 2E), confirming phototaxis data. With time, however, the Plateau amplitude of Rh1P37H flies gradually decreases compared with that of positive controls and by day 56, it reaches that of blind Rh1-null flies (Fig. 2F). Altogether, behavioral and electrophysiological data allow us to correlate morphological photoreceptor degeneration with progressive blindness.

Rh1P37H activates the visual signaling pathway
One major and still open question concerning the RhoP23H-induced degeneration is whether the mutant protein is able to transduce the light signal correctly. To analyze the activity of Rh1P37H, we performed ERG in Rh1-null flies carrying the mutant or the wild-type transgene. Wild-type (WT) and Rh1-null flies were used as positive and negative controls, respectively. The Plateau as well as the ON and OFF profiles indicate that both transgenes rescue the ERG phenotype of Rh1-null flies at day 1 (Fig. 3A and B). When compared with WT and Rh1WT flies ERG, however, Rh1P37H flies display significant reduced ERG amplitude (Fig. 3A and B). This is not due to altered photoreceptor morphology (compare parts D and E with F and G of Fig. 3), showing that Rh1P37H ERG reduction is due to signaling impairment. Altogether, these data demonstrate that Rh1P37H is able to transduce the light stimulus and that Rh1P37H does not represent a null (complete loss of function) or a constitutively active (hypermorph) mutation. Finally, increasing the expression of the mutant protein does not improve the ERG amplitude (Fig. 3C), as revealed by using two copies of the mutant transgene. Thus, Rh1P37H is not a hypomorph mutation (partial loss of function decreasing protein activity or expression).



View larger version (67K):
[in this window]
[in a new window]
  		Figure 3. Rh1P37H activates the phototransduction cascade. (A) ERG at day 1: wild-type (WT), (Rh1WT; Rh1-null), (Rh1P37H; Rh1-null) and Rh1-null. Experimental conditions as in Fig. 2E and F. (B) ERG phases quantification: average amplitudes are measured for each genotype. Color coding indicates different genotypes: wild-type (WT), in black; (Rh1WT; Rh1-null) in purple; (Rh1P37H; Rh1-null), in orange; and Rh1-null, in grey. E (mV) is in y-axis. Error bars indicate s.e.m. Total number of tested flies is indicated. Significance vs. (Rh1P37H;Rh1-null) genotype is evaluated using Student's t-test and indicated on bars (*P<0.05; ***P<0.0001). (C) ERG at day 1 from Rh1P37H;Rh1-null (orange) and Rh1WT; Rh1-null (purple) flies. 1x and 2x (in bold) refer to one or two dose(s) of transgene. s.e.m. is indicated in superscript. Number of tested flies is indicated in the first column. Significance is evaluated using Student's t-test (*P<0.05; **P<0.005). (D–G) Eye transverse semi-thin (D, F) and ultra-thin sections (E, G) at day 1. (D, E) (Rh1P37H; Rh1-null); (F, G) (Rh1WT; Rh1-null). Asterisk and arrows show normal rhabdomeres and sub-rhabdomeric structures. Scale bar: 5 µm (D, F); 0.5 µm (E, G).

 
Rh1hsv-P37H displays partial mislocalization in the fly eye
The localization of the vertebrate mutant protein is matter of debate, because a large number of studies in cell cultures assign a cytoplasmic localization (ER, agresome) to RhoP23H, whereas studies in vivo using transgenic animal models argue for RhoP23H proper localization to photoreceptor outer-segments (7Go,27Go–32Go). We therefore asked whether the degenerative phenotype is due to Rh1P37H misexpression/mislocalization. To specifically identify the mutant protein, we performed the analysis in flies lacking endogenous Rhodopsin by crossing Rh1P37H or Rh1WT transgenic flies with Rh1-null animals (referred to as Rh1P37H; Rh1-null and Rh1WT; Rh1-null, respectively). The amount of Rh1 expressed by Rh1P37H; Rh1-null and Rh1WT; Rh1-null flies is comparable, corresponding, respectively, to 53 and 52% of the Rh1 protein expressed in a wild-type strain, as quantified by densitometry (Fig. 4B).



View larger version (33K):
[in this window]
[in a new window]
  		Figure 4. Rh1P37H localizes to rhabdomeres and to ER. Transverse sections (A, C–K) of adult eyes (day 1), immunolabeled in green with anti-Rh1 (Rh1) (A, C, D), anti-hsv (hsv) (E, F), anti-Rh1 polyclonal antibody (I, J), respectively. Phalloidin, which labels rhabdomeric and sub-rhabdomeric (asterisks) F-Actin, in red. (A) Wild-type (WT); (C, D) (Rh1P37H; Rh1-null) and (Rh1WT; Rh1-null), respectively. Like endogenous Rh1 and Rh1WT, Rh1P37H accumulates in R1–R6 rhabdomeres delineated by dotted lines. (B) Anti-Rh1 western blot on head extracts: wild-type (WT), Rh1-null and WT or mutant transgenes into an Rh1-null background ((Rh1P37H; Rh1-null), (Rh1WT; Rh1-null)). Same amount of total protein in each lane, ß-tubulin as loading control (B). (E, G) Rh1hsv-P37H, Rh1WT; (F, H) Rh1hsv-WT; Rh1WT; (I) Rh1hsv-WT; Rh1 P37H, (G, H) Anti-hsv immunogold labeling analyzed by electron microscopy. Rhodopsin labeling at ER is indicated by black arrows. (I) (Rh1hsv-P37H; Rh1-WT); (J) (Rh1hsv-WT; Rh1-WT). In contrast with Rh1wt restricted in rhadomeres (J), anti-Rh1 polyclonal antibody confirms Rh1P37H dual localization in rhabdomeres and cytoplasm (arrows I). 1–7 indicate R1–R7 photoreceptors, respectively. Scale bars: 2 µm (A, C–E, I–K); 0.5 µm (G, H).

 
Using anti-Rh1 immunolabeling in adult eyes, we found that Rhodopsin proteins colocalize with the rhabdomeric marker phalloidin, showing that Rh1P37H and Rh1WT are correctly targeted to R1–R6 apical microvilli (Fig. 4C and D), and are also expressed at proper developmental stage (70% of pupal life) (data not shown).

In conclusion, Rhodopsin labeling shows the same developmental profile, cell-specificity and subcellular localization for Rh1P37H and WT Rh1, consistent with the observation that Rh1P37H activates the phototransduction pathway.

One important question is to assess Rh1P37H subcellular localization in a more physiopathologic context, namely in the presence of wild-type Rh1, as it is the case in ADRP patients. Indeed, it is interesting to check whether both proteins were colocalized at the subcellular level, under degenerating conditions.

For this purpose, we generated a transgenic line that expresses an Rh1P37H protein tagged by hsv-epitope, under the control of rh1 promoter (Rh1hsv-P37H). Hsv-epitope in fusion with C-terminus does not modify Rh1 properties (33Go). Moreover, similar to Rh1P37H flies, Rh1hsv-P37H flies display reduced PS at day 7 that reflects photoreceptor degeneration, which is in contrast to Rh1hsv-WT-expressing flies (data not shown). This tool allows us to specifically follow the behavior of the mutant protein in a genetic context that most faithfully reproduces that of patients affected by ADRP i.e., in presence of the endogenous wild-type Rhodopsin.

Rh1hsv-P37H and control Rh1hsv-WT flies were analyzed to compare subcellular localization of hsv-tagged Rhodopsins. Interestingly, anti-hsv labeling localizes to rhabdomeres in Rh1hsv-WT flies (Fig. 4F) (33Go), and also to both rhabdomeres (inset) and cytoplasm (arrows) in Rh1hsv-P37H flies (Fig. 4E). This reveals a dual Rh1hsv-P37H localization that is not detectable with anti-Rhodopsin-1 4C5 monoclonal antibody, as the latter labels only rhabdomeres (data not shown). Moreover, immunogold labelings analyzed by electron microscopy also show Rh1hsv-P37H, but not Rh1hsv-WT, localization to the ER (arrows, compare parts G and H of Fig. 4). Thus, Rh1hsv-P37H localizes both to rhabdomeres and ER, regardless of the presence of endogenous Rh1 (both in Rh1WT and Rh1null background) (data not shown).

Finally, we used a polyclonal anti-Rh1 antibody as a third method to reveal Rhodopsin (34Go) and formally demonstrated that mutant protein (with or without hsv tag) is localized both in rhabdomeres and cytoplasm, whereas wild-type protein only localizes at rhabdomeres (Fig. 4I and J and data not shown).

The hsv tool also allowed us to ask another important question concerning the possibility that the presence of mutant Rhodopsin affects the subcellular localization of wild-type endogenous Rh1. For this, we performed anti-hsv labeling on eye sections that express both Rh1hsv-WT and Rh1P37H transgenes in Rh1null background. The fact that only wild-type protein is detected in rhabdomeres (Fig. 4K) clearly demonstrates that Rh1P37H mislocalization does not affect that of wild-type Rhodopsin.

Protein accumulation in ER has been shown to activate pathways that lead to phosphorylation and thereby activation of stress-specific MAPKs named p38 and JNK (35Go) which then translocate to the nucleus. The observed ER accumulation of Rh1P37H and the degenerative phenotype of R1–R6 prompted us to analyze the phosphorylation state of two such MAPKs in western blot assay from Rh1hsv-P37H- and Rh1hsv-WT-expressing head extracts. The signal obtained using antibody against the phosphorylated form of p38 (activated p38) is stronger in Rh1hsv-P37H-expressing head extracts (day 7 or 14) than in Rh1hsv-WT head extracts (Fig. 5A). We obtained the same result by using Rh1P37H flies (data not shown). We also observed that phosphorylation of JNK protein, another stress-induced MAPK, is also increased in the mutant, albeit at lower level, as compared to p38 (Fig. 5B).



View larger version (82K):
[in this window]
[in a new window]
  		Figure 5. p38 and JNK phosphorylation increase in Rh1P37H photoreceptors. (A, B) Anti-Phospho-p38 and anti-Phospho-JNK western blot on days 7 and 14 head extracts: Rh1hsv-P37H or Rh1hsv-WT transgenes into Rh1WT background (Rh1hsv-P37H and Rh1hsv-WT). Note the increased level of phosphorylated p38 and JNK in Rh1hsv-P37H heads. Same amount of total protein in each lane, ß-tubulin as loading control. (C, D) Rh1hsv-P37H; Rh1WT (C) and Rh1hsv-WT; Rh1WT (D) longitudinal sections (day 7) immunolabeled with anti-Phospho-p38 (green). Phalloidin labels rhabdomeric F-Actin in red and DAPI labels photoreceptor nuclei in blue, surrounded by dotted lines (n), arrows show activated p38 translocated into nucleus. Scale bars: 2 µm.

 
This clearly shows that Rh1P37H expression leads to stress-induced MAPK activation. Moreover, by looking at the subcellular level, we could assign this activation to the degenerating cells, as we specifically detected Phospho-p38 translocation in mutant photoreceptor nuclei (Fig. 5C and D).

Blocking apoptosis rescues the Rh1P37H phenotype
Previous studies realized on vertebrate models suggest that RhoP23H triggers an apoptotic pathway (19Go,36Go,37Go). To characterize the mechanisms of photoreceptor loss, we analyzed aged Rh1P37H ommatidia by electron microscopy and observed several apoptotic features such as dense nuclei (compare Fig. 6E–G), devolution of rhabdomeric membranes and loss of sub-rhabdomeric structures (compare Fig. 6C, D and H and see Fig. 1I). We also found that p35 anti-apoptotic protein (38Go) fully prevents the light-induced photoreceptor loss (Fig. 6B). Furthermore, p35 rescues rhabdomere and nucleus ultrastructure defects (Fig. 6D and F). Most importantly, p35 rescues the phototactic behavior (Fig. 6I). Indeed, Rh1P37H flies' PS at day 14 corresponds to 3.6, whereas that of Rh1P37H flies expressing p35 corresponds to 5.3 (Fig. 6I), which is very similar to the score of phototaxis-positive flies (see Fig. 2). Finally, p35 expression also partially rescues the ERG phenotype (Plateau amplitude: Rh1P37H=–5.84 mV; Rh1P37H+p35=–8.04 mV) (Fig. 6J).



View larger version (91K):
[in this window]
[in a new window]
  		Figure 6. p35 rescues Rh1P37H-induced degeneration. Eye transverse semi-thin (A, B) and ultra-thin sections (C–H) at day 28. Animals are raised under constant illumination conditions. (A, C, E) Rh1P37H; (B, D, F) Rh1P37H-expressing p35 in the eye (Rh1P37H+p35); (G, H) high magnification of wild-type nucleus and R1 rhabdomere, respectively. Compare Rh1P37H disorganized R1 rhabdomeric membranes (asterisk in C) and sub-rhabdomeric structures (black arrows in C), with rescued R1 in Rh1P37H+p35 (D) or wild-type eye (H). Rh1P37H displays apoptotic features such as dense nuclei (E) as compared with rescued nuclei in Rh1P37H+p35 (F) or wild-type photoreceptor (G). (I, J) PS (day 14) and ERG plateau amplitudes (day 28), under constant light illumination. Orange and red histograms represent Rh1P37H and Rh1P37H+p35 lines, respectively. Error bars show s.e.m. Total number of tested fly is indicated. Significance is evaluated using Student's t-test (*P<0.05; ***P<0.0001). Scale bars: 5 µm (A, B), 1 µm (C) and 0.5 µm (D–H).

 
We therefore conclude that Rh1P37H-induced degenerative mechanisms converge onto an apoptotic pathway and that it is possible to prevent photoreceptor loss of function by blocking such pathway.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
We here present a fly transgenic model for RhoP23H-induced RP that allows us to characterize the pathogenic mechanisms by functional and morphological assays. We show that mutant Rhodopsin is partially active and interferes with the phototransduction pathway. We also show that most of the mutant Rhodopsin is trapped in ER, which activates stress-MAPKs, and that the degeneration phenotype is rescued by p35 anti-apoptotic factor.

The Rh1P37H fly: a model for RhoP23H-induced degeneration
Rh1P37H induces age-dependent and progressive phenotypes. For patients and vertebrate models, young transgenic flies carrying mutant Rhodopsin display wild-type phototactic behavior, electrophysiological responses and photoreceptor morphology. Rh1P37H flies show first signs of blindness at day 7 post-eclosion (Fig. 2D). Moreover, in RhoP23H rodents (6Go,7Go,16Go,39Go), Rh1P37H flies show progressive functional (phototaxis and ERG) and morphological defects (Fig. 2D, data not shown, Supplementary Material, Fig. 2A). Finally, Rh1P37H-induced degeneration is dominant and light-dependent, as seen in the vertebrate models (17Go–20Go).

These data clearly show that Rh1P37H transgenic flies faithfully reproduce the pathological events occurring in ADRP patients that carry the RhoP23H mutation. This allows us to use Drosophila as a novel animal model to study the RhoP23H-induced RP and to characterize the molecular mechanisms triggering degeneration.

Rh1P37H responds to light
One of the most challenging questions is to determine the molecular pathways leading to photoreceptor degeneration. Depending on the rhodopsin mutation, distinct pathogenic mechanisms have been proposed, affecting protein activity or localization. Our data allow us to draw first conclusions on the cause of Rh1P37H-induced defects.

A frequently described cause of retinal degeneration involves Rhodopsin dysfunction: rhodopsin mutations failing to activate phototransduction (40Go) and mutations inducing light-independent constitutive activity lead to retinal degeneration in flies, transgenic mice and patients (41Go,42Go). Our electrophysiological data show for the first time that Rh1P37H is able to trigger photoreceptor depolarization and synaptic activity. This is the first evidence that the mutant protein is active, as the very early onset of degeneration of RhoP23H transgenic mice lacking endogenous Rhodopsin prevents from evaluating the intrinsic activity of RhoP23H (43Go). Moreover, although Rh1P37H displays a reduced ERG, it does not constitute a hypomorph mutation, as two copies of the mutant transgene in a genetic rhodopsin null background neither restore nor improve partially ERG wild-type amplitude. In addition, the fact that degeneration is not observed in flies kept in the dark speaks against Rh1P37H being a constitutively active mutation (Supplementary Material, Fig. S2B).

Our genetic data also allow us to exclude the possibility that Rh1P37H-induced degeneration is due to Rhodopsin excess, as transgenic Rh1WT expressed at comparable level as Rh1P37H does not induce degeneration. Therefore, Rh1P37H does not constitute a hypermorph mutation, which is consistent with the observation that expressing two doses of Rh1WT does not impair visual behavior (Supplementary Material, Table S1). By comparison, vertebrate RhoWT does trigger photoreceptor degeneration but only when overexpressed at extremely high levels (7Go). Finally, and more interestingly, performing the same dosage experiment with Rh1P37H further aggravates the mutant phenotype, as flies carrying one dose of Rh1P37H in a wild-type rhodopsin background see better than those carrying two doses of the same transgene (Supplementary Material, Table S1).

Altogether, the genetic approach allows us to demonstrate for the first time that Rh1P37H acts neither as a partial or complete loss of function (null/hypomorph) nor as a hypermorph or constitutively active mutation. Rather, Rh1P37H acts an antimorph, due to the cytotoxic effects induced by mislocalized Rh1P37H molecules (see subsequently). Thus, mutant, mislocalized, Rhodopsin indirectly interferes with the phototransduction cascade.

Rh1P37H dual localization
A second cause of photoreceptor-dominant degeneration is abnormal Rhodopsin trafficking (44Go). Indeed, a large number of dominant mutations throughout Rh1 cause protein sequestration in ER in flies (45Go,46Go).

Concerning RhoP23H, subcellular localization of the mutant protein is still under debate. RhoP23H mislocalization has been observed in vertebrate transfected cells (27Go–31Go), whereas in transgenic animals it is properly targeted to photoreceptor outer-segments (7Go,28Go,32Go). The use of transgenic wild-type and mutant-tagged Rhodopsins has made it possible to unambiguously address the issue of protein localization in vivo. Indeed, our immunolabeling data illustrate both localizations for mutant Rhodopsin. On one hand, we detect Rh1P37H labeling (monoclonal anti-Rh1) in rhabdomeres, even in a Rhodopsin wild-type background, which mimics the genetic context of RP patients (Supplementary Material, Fig. S2E and F). On the other hand, we also show Rh1hsv-P37H labeling in cytoplasm by using both a polyclonal anti-Rh1 antibody (34Go) (Fig. 4I arrows) and an anti-hsv antibody in tagged transgenic lines (Fig. 4E) indicating that the epitope recognized by the Rh1 monoclonal antibody is masked, either by misfolding or because altered protein interaction, as it has been described for the inactive form of Rh1 bound to Arrestin-2 (34Go).

Most of the Rhodopsin-dominant mutations described in Drosophila, acting on mutant protein maturation trough ER, also interfere with the wild-type Rhodopsin transport (45Go,47Go). In the case of Rh1P37H, however, mutant Rhodopsin sequestration in ER does not interfere with the Rh1hsv-WT transport to rhabdomeres.

Finally, in contrast to many dominant rhodopsin mutations in Drosophila causing ER membrane accumulation (45Go,46Go), Rh1P37H flies show normal ER ultrastructure (Supplementary Material, Fig. S2C), similar to what observed in RhoP23H mice (7Go,28Go). Our data favor the hypothesis that Rhodopsin transport is partially impaired allowing a small proportion of Rh1P37H to properly localize to rhabdomeres, where it is functional.

Protein accumulation in ER has been described to trigger apoptosis in some neurodegenerative processes such as Alzheimer's disease, through the so-called ER stress pathway (48Go). To respond to this ER stress and to get rid of protein excess, the unfolded protein response (UPR) signaling network is subsequently activated, which in turn finally leads to the activation of stress-MAPKs p38 and JNK (35Go). We have shown that P37H mutation triggers Rh1 sequestration in ER and triggers p38 and JNK activation, which is specific to photoreceptors.

Rh1P37H-induced degenerative mechanism leads to apoptosis
The fact that Rh1P37H photoreceptors undergo apoptosis and this phenotype is fully rescued by expressing p35 anti-apoptotic factor strongly suggest that Rh1P37H activation ultimately leads to caspase activation (49Go). Several mutations altering the phototransduction cascade (Rh1C200Y, rdgC, arr2 or norpA) inducing age- and light-dependent degeneration in flies are also fully (50Go–53Go) or partially (54Go) prevented by p35 expression (50Go–54Go). Most importantly, the observation that Rh1P37H-induced phenotype is morphologically and functionally rescued by p35 demonstrates a therapeutic effect of late-stage inhibition of apoptosis in adult flies. As apoptosis has been described in a variety of vertebrate models for retinal degeneration (55Go), the present data confirm the interference of apoptotic pathways as a promising therapeutic tool for human retinal dystrophies (56Go).

The activation of the UPR on ER stress has been described to trigger apoptosis, when such a pathway is not sufficient to get rid of the accumulated protein in ER (35Go). In view of our data, we propose that Rh1P37H accumulation in the ER causes apoptosis trough activation of a stress pathway that leads to p38 and JNK phosphorylation. In the future, it will be interesting to discuss the pathway leading to stress-MAPKs activation and to determine whether UPR is involved in it.

In conclusion, our data are emblematic of the conservation of the visual system between invertebrates and vertebrates. They validate the fly transgenic model to study the photoreceptor degeneration and shed light onto the pathogenic pathway associated with the RhoP23H-induced RP. Use of flies makes it possible to perform genetic screens aiming at finding genes that modify Rh1P37H photoreceptor degeneration. This represents a promising avenue to identify viability factors that may be used for therapeutic purposes.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
SUPPLEMENTARY MATERIAL
 REFERENCES
 
Transgenesis and Drosophila lines
rh1 coding of 1747 bp and upstream sequences of 1000 bp are cloned in CasPer4. Eleven amino acid hsv-tag epitope coding sequences (bold) are added to rh1 3' sequence (GCCAGCGAGGCCGAGTCCAAGGCACAACCCGAACTGGCACCCGAGGATCCGGAGGACTAAGGGGTACCCC). Transgenesis is performed in w1118 flies. Different lines obtained for each of the transgenes p(w+ rh1-Rh1WT) and p(w+ rh1-Rh1P37H) display similar phenotypes. Transgenic lines and wild-type control flies displaying same eye pigmentation are compared throughout the study. p(w+ rh1-Rh1WT), p(w+ rh1-Rh1P37H) and p(w+ rh1-Rh1hsv-37H) lines are referred to as Rh1WT, Rh1P37H and Rh1hsv-P37H, respectively. rh1-null allele is I17 (Bloomington stock center), and p(ry+ rh1-Rh1hsv-WT) referred to as Rh1hsv-WT (33Go). p35 rescue experiments are performed using w,p(ry+ rh1-Gal4) and p(w+ rh1-Rh1P37H)/p(w+ UAS-p35) flies (Bloomington stock center). Drosophila are raised on corn-medium, under day/nightlight conditions that correspond to 12 h dark/light at 25°C. Constant illumination conditions are obtained by using two photosynthetic fluorescent tubes (in total 350 cd/m2) at 25°C. In all illumination conditions, pupae were reared in 12 h dark/light cycles.

Western blotting analysis
Heads are mashed in lysis buffer (20 mM phosphate buffer of pH 7, 1% SDS). One hundred and fifty micrograms of protein extracts are loaded on a 10% SDS–PAGE and transferred on nylon membrane. Anti-Rh1 4C5 antibody is used at 1/100 (DSHB), rabbit anti-Phospho-p38 and anti Phospho-JNK at 1/700 (Cell signaling) and ß-tubulin antibody is used for normalization (0.25 µg/ml) (Chemicon).

Histology and immunohistochemistry
For histology, heads are dissected and fixed 24 h in 2.5% glutaraldehyde, 4% paraformaldehyde, Na phosphate buffer (0.1 M, pH 7.4), post-fixed in 1% osmium tetroxide in 0.1 M Na phosphate buffer, dehydrated in graduated ethanol series and propylene oxide. Heads are embedded in epon. Semi-thin sections of 2 µm are stained with toluidin blue, 70 nm ultra-thin sections are contrasted with uranyl acetate and lead citrate, and analyzed using Philips EM208 electron microscope.

For fluorescent immunolabeling, heads are dissected and fixed 20 min in 4% formaldehyde, incubated in 10 and 25% sucrose 2 and 6 h, respectively, and embedded in cryomedium. Cryosections of 20 µm are fixed for 10 min (4% formaldehyde), permeated with 0.1% Triton X-100 PBS (PBST) and blocked 1 h with 5% goat serum in PBST. Primary and secondary antibodies are diluted in blocking solution and incubated overnight at 4°C and 1 h at room temperature, respectively. Rh1 expression is revealed by 4C5 mouse monoclonal antibody (1/50) (DSHB), anti-hsv monoclonal antibody (1/1000) (Novagen) or Rabbit polyclonal anti-Rh1 (1/500) (34Go) and F-Actin cytoskeleton by phalloidin coupled to TRITC (1/100) (Sigma). Slides are analyzed with Leica DMRE confocal microscope.

For immunogold electron microscopy, heads are dissected and fixed overnight at 4°C in 4% PFA, 0.1% glutaraldehyde in Na phosphate buffer (0.1 M, pH 7.4), dehydrated in a graded ethanol series and embedded in araldite-epon. Ultrathin sections of 70 nm collected on nickel grids are blocked with 1% NGS diluted in 0.01 M PBS–0.5% Tween 20, incubated 3 h at room temperature with anti-hsv (1/2000), washed with BSA (0.2%) and incubated 2 h with anti-mouse antibody conjugated to 10-nm colloidal gold particles (Aurion) (1/20). After post-fixation in 2.5% glutaraldehyde, sections are contrasted 15 min with 5% uranyl acetate and examined under a CM 12 Philips electron microscope.

Fast phototaxis
Countercurrent apparatus with six tubes of length 15 cm is placed horizontally, light source is switched on and flies allowed to walk during 30 s toward a photosynthetic fluorescent tube (700 cd/m2). Tubes are shifted in order to reiterate the test five times. Results are presented on histograms as fly percentage in each tube or as PS ({Sigma}iNi)/{Sigma}Ni, where N is the number of flies in the ith tube).

Electroretinogram
Cold-anesthetized flies are immobilized in clay. A tungsten electrode (0.5–1 M{Omega}, Intracell) is inserted in the back of the head and a glass electrode filled with 3 M KCl (2–6 M{Omega}) is poked through the cornea. Flies are dark-adapted for 2 min before recording. A white LED (1 cd, 60° light beam, Radiospares) is located at 1.5 cm from the head. The flash intensity (700 cd/m2) is chosen as the minimal intensity that consistently produces maximal ERG Plateaus. Signals are filtered at 2 kHz and digitized at 10 kHz, using a MultiClamp 700 A amplifier, Digidata 1322 A interface and pClamp-8 software (Axon Instruments). Flash intensity and duration are controlled through pClamp and Digidata.


   SUPPLEMENTARY MATERIAL
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
REFERENCES
 
Supplementary Material is available at HMG Online.


   ACKNOWLEDGEMENTS
 
The authors wish to thank J. Treisman and J. O'Tousa for generously providing the rh1-GAL4 and rh1-Rh1hsv-WT lines, respectively, and to P. Dolph for providing us anti-Rh1 polyclonal antibody. The authors thank A. Megighian for fruitful advice on ERG, to M. Boeglin, D. Hentsch and J.L. Vonesh for confocal imaging assistance, to C. Hindelang and J. Hergueux for histology assistance, to members of both labs for helpful discussions and comments on the manuscript. The authors also thank C. Diebold for excellent technical assistance, N. Arbogast for keeping fly stocks, M. Ezzouine, S. Durr, F. Steinmetz, A. Eken, R. Thiebault and L. Smittlin rotation students, the Bloomington Drosophila Stock Center and the Developmental Studies Hybridoma Bank for providing fly stocks and antibody. This work was supported by the Institut National de la Santé et de la Recherche Médicale, the Centre National de la Recherche Scientifique, the Hôpital Universitaire de Strasbourg, the Association pour la Recherche contre le Cancer (ARC), the ATC vieillissement and Progres from INSERM, the Human Frontier Science Program. A.G. was supported by EEC, Université Louis Pasteur and Retina France fellowships.

Conflict of Interest statement. None declared.


   FOOTNOTES
 
{dagger} Co-last authors. Back


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 

  1. Delyfer, M.N., Leveillard, T., Mohand-Said, S., Hicks, D., Picaud, S. and Sahel, J.A. (2004) Inherited retinal degenerations: therapeutic prospects. Biol. Cell., 96, 261–269.[CrossRef][Web of Science][Medline]

  2. van Soest, S., Westerveld, A., de Jong, P.T., Bleeker-Wagemakers, E.M. and Bergen, A.A. (1999) Retinitis pigmentosa: defined from a molecular point of view. Surv. Ophthalmol., 43, 321–334.[CrossRef][Web of Science][Medline]

  3. Dryja, T.P. (1990) Human genetics: deficiencies in sight with the candidate gene approach. Nature, 347, 614.[CrossRef][Medline]

  4. Sung, C.H., Davenport, C.M. and Nathans, J. (1993) Rhodopsin mutations responsible for autosomal dominant retinitis pigmentosa: clustering of functional classes along the polypeptide chain. J. Biol. Chem., 268, 26645–26649.[Abstract/Free Full Text]

  5. Oh, K.T., Weleber, R.G., Lotery, A., Oh, D.M., Billingslea, A.M. and Stone, E.M. (2000) Description of a new mutation in rhodopsin, Pro23Ala, and comparison with electroretinographic and clinical characteristics of the Pro23His mutation. Arch. Ophthalmol., 118, 1269–1276.[Abstract/Free Full Text]

  6. Lewin, A.S., Drenser, K.A., Hauswirth, W.W., Nishikawa, S., Yasumura, D., Flannery, J.G. and LaVail, M.M. (1998) Ribozyme rescue of photoreceptor cells in a transgenic rat model of autosomal dominant retinitis pigmentosa. Nat. Med., 4, 967–971.[CrossRef][Web of Science][Medline]

  7. Olsson, J.E., Gordon, J.W., Pawlyk, B.S., Roof, D., Hayes, A., Molday, R.S., Mukai, S., Cowley, G.S., Berson, E.L. and Dryja, T.P. (1992) Transgenic mice with a rhodopsin mutation (Pro23His): a mouse model of autosomal dominant retinitis pigmentosa. Neuron, 9, 815–830.[CrossRef][Web of Science][Medline]

  8. Pacione, L.R., Szego, M.J., Ikeda, S., Nishina, P.M. and McInnes, R.R. (2003) Progress toward understanding the genetic and biochemical mechanisms of inherited photoreceptor degenerations. Annu. Rev. Neurosci., 26, 657–700.[CrossRef][Web of Science][Medline]

  9. Zoghbi, H.Y. and Botas, J. (2002) Mouse and fly models of neurodegeneration. Trends Genet., 18, 463–471.[CrossRef][Web of Science][Medline]

  10. Montell, C., Jones, K., Zuker, C. and Rubin, G. (1987) A second opsin gene expressed in the ultraviolet-sensitive R7 photoreceptor cells of Drosophila melanogaster. J. Neurosci., 7, 1558–1566.

  11. Hardie, R.C. and Raghu, P. (2001) Visual transduction in Drosophila. Nature, 413, 186–193.

  12. O'Tousa, J.E., Baehr, W., Martin, R.L., Hirsh, J., Pak, W.L. and Applebury, M.L. (1985) The Drosophila ninaE gene encodes an opsin. Cell, 40, 839–850.[CrossRef][Web of Science][Medline]

  13. Zuker, C.S., Cowman, A.F. and Rubin, G.M. (1985) Isolation and structure of a rhodopsin gene from D. melanogaster. Cell, 40, 851–858.

  14. Mismer, D. and Rubin, G.M. (1987) Analysis of the promoter of the ninaE opsin gene in Drosophila melanogaster. Genetics, 116, 565–578.

  15. Berson, E.L., Rosner, B., Sandberg, M.A. and Dryja, T.P. (1991) Ocular findings in patients with autosomal dominant retinitis pigmentosa and a rhodopsin gene defect (Pro-23-His). Arch. Ophthalmol., 109, 92–101.[Abstract/Free Full Text]

  16. Naash, M.I., Hollyfield, J.G., al-Ubaidi, M.R. and Baehr, W. (1993) Simulation of human autosomal dominant retinitis pigmentosa in transgenic mice expressing a mutated murine opsin gene. Proc. Natl Acad. Sci. USA, 90, 5499–5503.[Abstract/Free Full Text]

  17. Nir, I., Harrison, J.M., Liu, C. and Wen, R. (2001) Extended photoreceptor viability by light stress in the RCS rats but not in the opsin P23H mutant rats. Invest. Ophthalmol. Vis. Sci., 42, 842–849.[Abstract/Free Full Text]

  18. Organisciak, D.T., Darrow, R.M., Barsalou, L., Kutty, R.K. and Wiggert, B. (2003) Susceptibility to retinal light damage in transgenic rats with rhodopsin mutations. Invest. Ophthalmol. Vis. Sci., 44, 486–492.[Abstract/Free Full Text]

  19. Naash, M.L., Peachey, N.S., Li, Z.Y., Gryczan, C.C., Goto, Y., Blanks, J., Milam, A.H. and Ripps, H. (1996) Light-induced acceleration of photoreceptor degeneration in transgenic mice expressing mutant rhodopsin. Invest. Ophthalmol. Vis. Sci., 37, 775–782.[Abstract/Free Full Text]

  20. Wang, M., Lam, T.T., Tso, M.O. and Naash, M.I. (1997) Expression of a mutant opsin gene increases the susceptibility of the retina to light damage. Vis. Neurosci., 14, 55–62.[Medline]

  21. Dryja, T.P., McGee, T.L., Reichel, E., Hahn, L.B., Cowley, G.S., Yandell, D.W., Sandberg, M.A. and Berson, E.L. (1990) A point mutation of the rhodopsin gene in one form of retinitis pigmentosa. Nature, 343, 364–366.[CrossRef][Medline]

  22. Hirsch, J. and Boudreau, J.C. (1958) Studies in experimental behavior genetics. I. The heritability of phototaxis in a population of Drosophila melanogaster. J. Comp. Physiol. Psychol., 51, 647–651.

  23. Benzer, S. (1967) Behavioral mutants of Drosophila isolated by countercurrent distribution. Proc. Natl Acad. Sci. USA, 58, 1112–1119.[Free Full Text]

  24. Connolly, J.B. and Tully, T. (1997) Behaviour, learning and memory. In Roberts, D.B. (ed.), Drosophila: A Practical Approach, 2nd edn. Oxford University Press, Oxford, pp. 264–317.

  25. Pak, W. (1979) Study of Photoreceptor Function using Drosophila Mutants. Elsevier, XO Breakfield.

  26. Bentrop, J., Schwab, K., Pak, W.L. and Paulsen, R. (1997) Site-directed mutagenesis of highly conserved amino acids in the first cytoplasmic loop of Drosophila Rh1 opsin blocks rhodopsin synthesis in the nascent state. EMBO J., 16, 1600–1609.[CrossRef][Web of Science][Medline]

  27. Sung, C.H., Schneider, B.G., Agarwal, N., Papermaster, D.S. and Nathans, J. (1991) Functional heterogeneity of mutant rhodopsins responsible for autosomal dominant retinitis pigmentosa. Proc. Natl Acad. Sci. USA, 88, 8840–8844.[Abstract/Free Full Text]

  28. Liu, X., Garriga, P. and Khorana, H.G. (1996) Structure and function in rhodopsin: correct folding and misfolding in two point mutants in the intradiscal domain of rhodopsin identified in retinitis pigmentosa. Proc. Natl Acad. Sci. USA, 93, 4554–4559.[Abstract/Free Full Text]

  29. Illing, M.E., Rajan, R.S., Bence, N.F. and Kopito, R.R. (2002) A rhodopsin mutant linked to autosomal dominant retinitis pigmentosa is prone to aggregate and interacts with the ubiquitin proteasome system. J. Biol. Chem., 277, 34150–34160.[Abstract/Free Full Text]

  30. Saliba, R.S., Munro, P.M., Luthert, P.J. and Cheetham, M.E. (2002) The cellular fate of mutant rhodopsin: quality control, degradation and aggresome formation. J. Cell. Sci., 115, 2907–2918.[Abstract/Free Full Text]

  31. Chapple, J.P. and Cheetham, M.E. (2003) The chaperone environment at the cytoplasmic face of the endoplasmic reticulum can modulate rhodopsin processing and inclusion formation. J. Biol. Chem., 278, 19087–19094.[Abstract/Free Full Text]

  32. Wu, T.H., Ting, T.D., Okajima, T.I., Pepperberg, D.R., Ho, Y.K., Ripps, H. and Naash, M.I. (1998) Opsin localization and rhodopsin photochemistry in a transgenic mouse model of retinitis pigmentosa. Neuroscience, 87, 709–717.[CrossRef][Web of Science][Medline]

  33. Kurada, P., Tonini, T.D., Serikaku, M.A., Piccini, J.P. and O'Tousa, J.E. (1998) Rhodopsin maturation antagonized by dominant rhodopsin mutants. Vis. Neurosci., 15, 693–700.[CrossRef][Web of Science][Medline]

  34. Orem, N.R. and Dolph, P.J. (2002) Epitope masking of rhabdomeric rhodopsin during endocytosis-induced retinal degeneration. Mol. Vis., 8, 455–461.[Web of Science][Medline]

  35. Takeda, K., Matsuzawa, A., Nishitoh, H. and Ichijo, H. (2003) Roles of MAPKKK ASK1 in stress-induced cell death. Cell. Struct. Funct., 28, 23–29.[CrossRef][Web of Science][Medline]

  36. Walsh, N., van Driel, D., Lee, D. and Stone, J. (2004) Multiple vulnerability of photoreceptors to mesopic ambient light in the P23H transgenic rat. Brain. Res., 1013, 194–203.[CrossRef][Web of Science][Medline]

  37. Yu, D.Y., Cringle, S., Valter, K., Walsh, N., Lee, D. and Stone, J. (2004) Photoreceptor death, trophic factor expression, retinal oxygen status, and photoreceptor function in the P23H rat. Invest. Ophthalmol. Vis. Sci., 45, 2013–2019.[Abstract/Free Full Text]

  38. Hay, B.A., Wolff, T. and Rubin, G.M. (1994) Expression of baculovirus P35 prevents cell death in Drosophila. Development, 120, 2121–2129.

  39. Machida, S., Kondo, M., Jamison, J.A., Khan, N.W., Kononen, L.T., Sugawara, T., Bush, R.A. and Sieving, P.A. (2000) P23H rhodopsin transgenic rat: correlation of retinal function with histopathology. Invest. Ophthalmol. Vis. Sci., 41, 3200–3209.[Abstract/Free Full Text]

  40. Min, K.C., Zvyaga, T.A., Cypess, A.M. and Sakmar, T.P. (1993) Characterization of mutant rhodopsins responsible for autosomal dominant retinitis pigmentosa: mutations on the cytoplasmic surface affect transducing activation. J. Biol. Chem., 268, 9400–9404.[Abstract/Free Full Text]

  41. Iakhine, R., Chorna-Ornan, I., Zars, T., Elia, N., Cheng, Y., Selinger, Z., Minke, B. and Hyde, D.R. (2004) Novel dominant rhodopsin mutation triggers two mechanisms of retinal degeneration and photoreceptor desensitization. J. Neurosci., 24, 2516–2526.[Abstract/Free Full Text]

  42. Lem, J. and Fain, G.L. (2004) Constitutive opsin signaling: night blindness or retinal degeneration? Trends Mol. Med., 10, 150–157.[CrossRef][Web of Science][Medline]

  43. Frederick, J.M., Krasnoperova, N.V., Hoffmann, K., Church-Kopish, J., Ruther, K., Howes, K., Lem, J. and Baehr, W. (2001) Mutant rhodopsin transgene expression on a null background. Invest. Ophthalmol. Vis. Sci., 42, 826–833.[Abstract/Free Full Text]

  44. Sung, C.H. and Tai, A.W. (2000) Rhodopsin trafficking and its role in retinal dystrophies. Int. Rev. Cytol., 195, 215–267.[Web of Science][Medline]

  45. Colley, N.J., Cassill, J.A., Baker, E.K. and Zuker, C.S. (1995) Defective intracellular transport is the molecular basis of rhodopsin-dependent dominant retinal degeneration. Proc. Natl Acad. Sci. USA, 92, 3070–3074.[Abstract/Free Full Text]

  46. Kurada, P. and O'Tousa, J.E. (1995) Retinal degeneration caused by dominant rhodopsin mutations in Drosophila. Neuron, 14, 571–579.[CrossRef][Web of Science][Medline]

  47. Webel, R., Menon, I., O'Tousa, J.E. and Colley, N.J. (2000) Role of asparagine-linked oligosaccharides in rhodopsin maturation and association with its molecular chaperone, NinaA. J. Biol. Chem., 275, 24752–24759.[Abstract/Free Full Text]

  48. Paschen, W. (2001) Dependence of vital cell function on endoplasmic reticulum calcium levels: implications for the mechanisms underlying neuronal cell injury in different pathological states. Cell Calcium, 29, 1–11.[CrossRef][Web of Science][Medline]

  49. Song, Z. and Steller, H. (1999) Death by design: mechanism and control of apoptosis. Trends Cell. Biol., 9, M49–M52.[CrossRef][Web of Science][Medline]

  50. Davidson, F.F. and Steller, H. (1998) Blocking apoptosis prevents blindness in Drosophila retinal degeneration mutants. Nature, 391, 587–591.[CrossRef][Medline]

  51. Acharya, U., Patel, S., Koundakjian, E., Nagashima, K., Han, X. and Acharya, J.K. (2003) Modulating sphingolipid biosynthetic pathway rescues photoreceptor degeneration. Science, 299, 1740–1743.[Abstract/Free Full Text]

  52. Alloway, P.G., Howard, L. and Dolph, P.J. (2000) The formation of stable rhodopsin–arrestin complexes induces apoptosis and photoreceptor cell degeneration. Neuron, 28, 129–138.[CrossRef][Web of Science][Medline]

  53. Kiselev, A., Socolich, M., Vinos, J., Hardy, R.W., Zuker, C.S. and Ranganathan, R. (2000) A molecular pathway for light-dependent photoreceptor apoptosis in Drosophila. Neuron, 28, 139–152.[CrossRef][Web of Science][Medline]

  54. Hsu, C.D., Whaley, M.A., Frazer, K., Miller, D.A., Mitchell, K.A., Adams, S.M. and O'Tousa, J.E. (2004) Limited role of developmental programmed cell death pathways in Drosophila norpA retinal degeneration. J. Neurosci., 24, 500–507.[Abstract/Free Full Text]

  55. Remé, C.E., Grimm, C., Hafezi, F., Marti, A. and Wenzel, A. (1998) Apoptotic cell death in retinal degenerations. Prog. Retin. Eye Res., 17, 443–464.[CrossRef][Web of Science][Medline]

  56. Wenzel, A., Grimm, C., Samardzija, M. and Reme, C.E. (2005) Molecular mechanisms of light-induced photoreceptor apoptosis and neuroprotection for retinal degeneration. Prog. Retin. Eye Res., 24, 275–306.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Proc. Natl. Acad. Sci. USAHome page
R. Datta, A. Waheed, G. Bonapace, G. N. Shah, and W. S. Sly
Pathogenesis of retinitis pigmentosa associated with apoptosis-inducing mutations in carbonic anhydrase IV
PNAS, March 3, 2009; 106(9): 3437 - 3442.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
B. M. Tam and O. L. Moritz
Dark Rearing Rescues P23H Rhodopsin-Induced Retinal Degeneration in a Transgenic Xenopus laevis Model of Retinitis Pigmentosa: A Chromophore-Dependent Mechanism Characterized by Production of N-Terminally Truncated Mutant Rhodopsin
J. Neurosci., August 22, 2007; 27(34): 9043 - 9053.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
14/17/2547    most recent
ddi258v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Galy, A.
Right arrow Articles by Giangrande, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Galy, A.
Right arrow Articles by Giangrande, A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?