Skip Navigation


Human Molecular Genetics Advance Access originally published online on August 22, 2005
Human Molecular Genetics 2005 14(19):2779-2786; doi:10.1093/hmg/ddi311
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow All Versions of this Article:
14/19/2779    most recent
ddi311v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (13)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Matsuda, A.
Right arrow Articles by Shirakawa, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsuda, A.
Right arrow Articles by Shirakawa, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oupjournals.org

Coding SNP in tenascin-C Fn-III-D domain associates with adult asthma

Akira Matsuda1,*, Tomomitsu Hirota1, Mitsuteru Akahoshi1, Makiko Shimizu1, Mayumi Tamari1, Akihiko Miyatake3, Atsushi Takahashi2, Kazuko Nakashima1,4, Naomi Takahashi1, Kazuhiko Obara1, Noriko Yuyama5, Satoru Doi6, Yumiko Kamogawa7, Tadao Enomoto9, Koichi Ohshima10, Tatsuhiko Tsunoda2, Shoichiro Miyatake7, Kimie Fujita11, Moriaki Kusakabe12, Kenji Izuhara13, Yusuke Nakamura8, Julian Hopkin14 and Taro Shirakawa1,4

1Laboratory for Genetics of Allergic Diseases and 2Laboratory for Medical Informatics, SNP Research Center, RIKEN, Yokohama, Japan, 3Miyatake Asthma Clinic, Osaka, Japan, 4Department of Health Promotion and Human Behavior, Kyoto University Graduate School of Public Health, Kyoto, Japan, 5Genox Research Inc., Kawasaki, Japan, 6Osaka Prefectural Habikino Hospital, Osaka, Japan, 7Department of Molecular and Developmental Biology and 8Laboratory of Molecular Medicine, Human Genome Center, Institute of Medical Science, University of Tokyo, Tokyo, Japan, 9Department of Otolaryngology, Japanese Red Cross Society, Wakayama Medical Center, Wakayama, Japan, 10Department of Pathology, School of Medicine, Fukuoka University, Fukuoka, Japan, 11College of Nursing, University of Shiga, Shiga, Japan, 12Experimental Animal Research Center, Institute for Animal Reproduction, Ibaraki, Japan, 13Department of Biomolecular Sciences, Saga Medical School, Saga, Japan and 14Experimental Medicine Unit, University of Wales Swansea, Swansea, UK

* To whom correspondence should be addressed at: Laboratory for Genetics of Allergic Diseases, SNP Research Center, RIKEN, Suehiro 1-7-22, Tsurumi-KU, Yokohama 230-0045, Japan. Tel: +81 455039616; Fax: +81 455039615; Email: akimatsu{at}src.riken.go.jp

Received June 20, 2005; Accepted August 9, 2005


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
The extracellular matrix glycoprotein tenascin-C (TNC) has been accepted as a valuable histopathological subepithelial marker for evaluating the severity of asthmatic disease and the therapeutic response to drugs. We found an association between an adult asthma and an SNP encoding TNC fibronectin type III-D (Fn-III-D) domain in a case–control study between a Japanese population including 446 adult asthmatic patients and 658 normal healthy controls. The SNP (44513A/T in exon 17) strongly associates with adult bronchial asthma ({chi}2 test, P=0.00019, Odds ratio=1.76, 95% confidence interval=1.31–2.36). This coding SNP induces an amino acid substitution (Leu1677Ile) within the Fn-III-D domain of the alternative splicing region. Computer-assisted protein structure modeling suggests that the substituted amino acid locates at the outer edge of the beta-sheet in Fn-III-D domain and causes instability of this beta-sheet. As the TNC fibronectin-III domain has molecular elasticity, the structural change may affect the integrity and stiffness of asthmatic airways. In addition, TNC expression in lung fibroblasts increases with Th2 immune cytokine stimulation. Thus, Leu1677Ile may be valuable marker for evaluating the risk for developing asthma and plays a role in its pathogenesis.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Asthma is a chronic inflammatory disease characterized by smooth muscle hypertrophy, excess mucus secretion and increased deposition of extracellular matrix (ECM) around the basement membrane (1Go–3Go). Many asthmatic patients also have an atopic tendency characterized by a Th2 dominant cytokine profile including interleukin (IL)-4 and IL-13 (4Go). Several studies showed genetic associations between asthma and proteinases like ADAM33 (5Go) or Th2 cytokine receptors (4Go,6Go), but to the best of our knowledge, there is no report of an association between asthma and ECM genes. The hexametric ECM glycoprotein tenascin-C (TNC) has been accepted as a histopathological marker, beneath the asthmatic airway, for evaluating the severity and the therapeutic effects of drugs in bronchial asthma (7Go,8Go) because of its tightly controlled expression pattern. TNC expression is prominently increased around airway basement membranes of asthmatic patients (8Go), and two independent microarray experiments, including our own, identified TNC as one of the IL-4- or IL-13-induced genes in human bronchial epithelial cells (9Go,10Go). Recent studies showed that the fibronectin-III (Fn-III) domain of TNC has molecular elasticity (11Go) and mechanical strain can induce TNC expression (12Go), so we consider TNC to be more than just a marker for asthmatic pathology.

In the present study, we show the genetic association between an adult asthma and an SNP in exon 17 (44513A/T) causing amino acid substitution in the fibronectin type III-D (Fn-III-D) domain region of TNC gene (13Go). We carried out protein structure modeling of the Fn-III-D domain and found that the amino acid replacement Leu1677Ile could affect the structural stability of the Fn-III-D domain, which might affect the elasticity of the domain. In addition, TNC expression in lung fibroblasts was increased with IL-4 or IL-13 stimulation. The aim of our study was to test the association between the coding SNP in the TNC Fn-III-D domain and asthma and to determine how the SNP may affect the pathophysiology of asthma.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Identification of TNC genetic polymorphisms and selection of representative SNPs
We detected 62 genetic polymorphisms within the TNC region (Supplementary Material, Table S1) by resequencing samples from 24 Japanese individuals (12 asthmatics and 12 controls). Of these, we selected 23 SNPs whose minor allele frequency (MAF) was >20%. To check the intragenic linkage disequilibrium (LD) pattern in the TNC gene, pairwise LD was measured by r among the 23 SNPs (Fig. 1A). We selected 10 representative SNPs on the basis of location and LD with other sites; the positions of the 10 SNPs are shown in Figure 1B.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 1. Pairwise LD map and SNP map in the TNC genomic region. (A) Pairwise LD in the TNC gene, as measured by the r2 value between all pairs of SNPs examined. The position of 44513A/T is indicated with an asterisk and the remaining nine SNPs genotyped were indicated with red color. (B) The complete coding region of TNC, intron/exon boundaries, the intronic sequence, ~3 kb of 5' genomic DNA and 1 kb of 3' genomic DNA are shown. Twenty-seven exons are indicated by closed squares. Position 1 is the start codon of the TNC gene. An asterisk indicates the 44513A/T SNP.

 
Case–control association study using asthmatic patients
We carried out a case–control association study using a Japanese asthmatic population. Clinical characteristics of the bronchial asthma patients are presented in Table 1. The severity of asthma before treatment was classified by the Global Initiative for Asthma Guideline (14Go). All 10 investigated SNPs were within the Hardy–Weinberg equilibrium. The overall success rate for genotyping was 99.1%. Of these 10, an SNP in exon 17 (44513A/T) had a significant association with adult bronchial asthma in our Japanese cohort under a recessive model [{chi}2 test, 44513TT versus AT+AA, raw P-value 0.00019, Odds ratio (OR) 1.76, 95% confidence interval (95% CI)=1.31–2.36] (Table 2). Stronger association was observed when we limited case subjects to non-smoking asthmatics (44513TT versus AT+AA, raw P-value 0.000025, OR 2.06, 95% CI=1.45–2.87). There was no correlation between the severity of asthma and the TNC genetic association (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical characteristics of the bronchial asthma patients
 

View this table:
[in this window]
[in a new window]
 
Table 2. Genotype frequencies for TNC SNPs and asthma susceptibility
 
LD mapping around the TNC gene
To exclude the possibility that our results reflected the association of other genes near the TNC locus with asthma, we constructed an LD map around the TNC gene locus using 48 SNPs (MAF>10%). The results indicated that 44513A/T (indicated by an asterisk in Fig. 2) was located in the LD block extended from intron 8 of the TNC gene to the 3' genome region of TNC (30 kb upstream and 20 kb downstream of this SNP) and that there were no other genes in this block (Fig. 2).



View larger version (55K):
[in this window]
[in a new window]
 
Figure 2. Pairwise LD map around TNC locus, as measured by D' value or r value. Pairwise LD map around the TNC locus, as measured by D' value or r value between all pairs of SNPs examined. The position of 44513A/T is indicated with an asterisk. Arrows indicate the direction of transcription of the genes.

 
Haplotype analysis
We carried out haplotype analysis of four representative SNPs in the LD block containing the 44513A/T SNP. Estimated frequencies of the four-locus haplotype were compared between cases and control subjects. The results of association studies for each haplotype showed a significant association between haplotype 1 and asthma (Table 3) (raw P-value=0.004); however, the association was not stronger than that observed for the single locus (44513A/T).


View this table:
[in this window]
[in a new window]
 
Table 3. Haplotype structure and frequency in TNC
 
Immunohistochemistry of TNC
Paraffin sections of asthmatic lungs were immunostained with a rat anti-TNC monoclonal antibody. Subepithelial deposition of TNC protein was observed beneath the bronchial epithelium in the asthmatic lung of a 65-year-old male (Fig. 3A). No apparent TNC staining was observed in the control lung of a 68-year-old male (Fig. 3B).



View larger version (106K):
[in this window]
[in a new window]
 
Figure 3. Immunohistochemical analysis of asthmatic lung with TNC antibody. Paraffin sections of asthmatic and control lungs were immunostained with the anti-TNC monoclonal antibody and visualized with indirect immunoperoxidase staining. Intense subepithelial staining is observed in the asthmatic lung (A) but not in the control lung (B) * indicates bronchial epithelium and ** indicates airway smooth muscle. Dark black spots in the control lung are foreign particles in the lung.

 
Computer modeling of the TNC Fn-III-D domain structure
We derived a protein structure model of the TNC Fn-III-D domain with MOE software (Fig. 4) to examine the possible effects of the substitution of the 1677th amino acid. The major allele in the normal population 44513-T encodes 1677Leu, whereas 44513-A, common in asthmatic patients, encodes 1677Ile. The 1677th amino acid is located at the beta-strand, which makes up the outermost side of the beta-sheet (Fig. 4A and B). The amino acid faces to the inside of the beta-sheet structure and there is a hydrophobic interaction between Phe1636, Leu1638, Leu1652, Ile1654 and Leu1680 (Fig. 4C, shaded region). The substitution of Leu1677Ile could result in steric hindrance with Phe1636 because of its side chain (Fig. 4D).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 4. Computer modeling of TNC Fn-III-D domain and effect of 1677 Leu-Ile substitution. The 2.25 Åcrystal structure of chicken TNC (PDB accession no. P24821) was used as a template for homology modeling of the human TNC Fn-III-D domain. (A) The amino acid Leu1667 located in the fifth beta-sheet (yellow arrow, downward, indicated by black arrow) of the TNC Fn-III-D domain is shown with a green bar. (B) Amino acid Ile1677 located in the fifth beta-sheet of the TNC Fn-III-D domain is shown with a red bar. (C) Leu1677 makes a hydrophobic interaction plane (shaded region) among the hydrophobic amino acids. (D) The change of the amino acid from Leu to Ile caused steric hindrance with Phe1636 inside the beta-sheet.

 
Identification of TNC variant expression in normal human lung fibroblasts by RT–PCR and western blotting
To confirm the expression of the TNC mRNA variant containing SNP 44513A/T in exon 17, RT–PCR (reverse transcription–polymerase chain reaction) was performed with a forward primer in exon 10 and a reverse primer in exon 19. The PCR results showed bands of 1969, 607 and 331 bp with normal human lung fibroblasts (NHLF) cDNA (Fig. 5A, left). The PCR products were subcloned and then sequenced. Larger bands (1969 and 607 bp) contained the Fn-III-D domain, including SNP 44513A/T. The cell lysate of NHLF was electrophoresed and immunoblotted with the rat anti-TNC antibody. A 250 kDa variant of TNC, corresponding to the largest mRNA, was dominantly expressed in NHLF, and both IL-4 and IL-13 could upregulate the 250 kDa TNC protein expression (Fig. 5B).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 5. RT–PCR and western blot analysis for TNC variants in NHLF with Th2 cytokine stimulation. (A) TNC mRNA expression in NHLF was examined with RT–PCR. Subconfluent NHLF were stimulated with 100 ng/ml IL-13 for 72 h. After mRNA extraction and cDNA synthesis, PCR was performed with a pair of primers designed to differentiate alternatively spliced mRNA of TNC. The PCR products were electrophoresed on 1% agarose gel. M: 1 kb DNA marker and Lane 1: NHLF (left side). The structure of the FN-III domain in the human TNC gene is shown (center). F: forward primer and R: reverse primer. Corresponding protein molecular weights (M.W.) are indicated to the right. (B) Western blot analysis of NHLF culture samples stimulated with IL-4 or with IL-13 for 72 h. The samples were electrophoresed in 4–20% Tris–glycine gels and electrotransferred in PVDF membrane. Immunoblotting was performed with the rat anti-TNC monoclonal antibody. The relative intensity of TNC protein was quantified with NIH Image and is shown at the bottom. Lane 1 represents NHLF without stimulation. Lanes 2–4 represent NHLF stimulated with IL-4 at the concentrations of 100, 200 and 400 ng/ml, respectively. Lanes 5–7 represent NHLF stimulated with IL-13 at the concentrations of 100, 200 and 400 ng/ml, respectively.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
In the present study, asthmatic patients were recruited on the basis of the clinical asthma findings (14Go). We selected well-controlled cases after asthma treatments, (for class 2, 3 and 4 cases with known amounts of an inhaled steroid: beclomethasone dipropionate; BDP), to ensure the reversibility of lung functions (Table 1). We took care to exclude possible COPD (chronic obstructive pulmonary disease) cases by spirometric analysis to check the reversibility of airflow obstruction and by X-ray/CT examinations. We found a genetic association between SNP 44513A/T in exon 17, coding the 1677th amino acid in the Fn-III-D domain, and adult bronchial asthma (Table 2). The genetic association between 44513A/T and asthma became stronger when we limited the analysis to the non-smoker asthmatic subpopulation. This result suggested that the association was not the consequence of secondary impairment of lung function due to smoking. The LD map around the TNC gene region showed that SNP 44513A/T was located in the LD block that extended from intron 8 to the 3' genomic region of the TNC gene, and there were no other genes in the block (Fig. 2). Therefore, we concluded that the strong association observed with the SNP 44513A/T originated from the TNC gene itself. We intensively searched SNPs around the 44513A/T by resequencing and using public SNP databases, but we could not find any SNPs showing tight LD with 44513A/T. Weak LD was observed with 60715C/G (a coding SNP in exon 24) but there was no association between that SNP and bronchial asthma (Table 2), and the association between the four-SNP haplotypes including these two SNPs and asthma was not stronger than that of the 44513A/T single locus (Table. 3). Therefore, we selected SNP 44513A/T as the target for further analysis.

The TNC gene was chosen as a candidate gene for asthma on the basis of our previous GeneChip experiment (9Go). According to the results, TNC was one of the few genes constantly upregulated in bronchial epithelial cells in response to Th2 cytokines. We analyzed several candidate genes on the basis of the GeneChip results and found a significant association with the TNC gene. Furthermore, one previous genome-wide linkage study by Wjst et al. (15Go) showed that D9S1784 and D9S195 markers at chromosome 9q33 could be linked to asthma. TNC genes were located between these two markers (~9.7 Mb to D9S1784 and 5 Mb to D9S195). On the basis of these results, TNC seemed to be a good candidate gene for affecting susceptibility to asthma.

Our immunohistochemical staining of asthmatic airways showed TNC deposition around the basement membrane (Fig. 3A). Both bronchial epithelial cells and lung fibroblasts under the basement membrane may produce TNC. In situ hybridization experiments with the developing human lung (16Go) and respiratory distress syndrome (17Go) have shown that myofibroblasts under the epithelium express TNC mRNA. Therefore, we suppose that TNC in the asthmatic lung is predominantly produced by lung fibroblasts. It should be noted that the TNC Fn-III domain has both molecular elasticity (11Go) and essential roles for airway branching (18Go,19Go). We considered that TNC around the airway might have homeostatic roles for maintaining the integrity of airways in stressed conditions like bronchial asthma.

The structural model of the TNC Fn-III-D domain showed that the Ile1677 variant caused instability of the beta-sheet in the domain (Fig. 4D). Thus, Ile1677, a common variant among adult asthmatic patients, may alter the molecular elasticity of the TNC Fn-III domain. Airway resistance measurements of the asthmatic patients with or without allele 44513-A to investigate genotype–phenotype association are now ongoing.

It is known that a part of the TNC Fn-III domain, Fn-III-A1 through Fn-III-D, (Fig. 5A), is alternatively spliced (13Go). We checked the alternative splicing exon–intron junction for SNPs that might affect the splicing sites (20Go), but we could not find any SNPs that showed a significant association with asthma. Previous reports showed that the large form of TNC, including the alternative splicing region, was the predominant form in developing rat lung (19Go). Thus, it is likely that the large form of TNC is the main variant in the lung. Our monoclonal antibody could not distinguish between the large and small forms of TNC in immunohistochemistry, so we further analyzed the TNC variants by RT–PCR and by western blotting using NHLF. We showed that 250 and 190 kDa TNC variants contained the alternatively spliced Fn-III-D domain in NHLF (Fig. 5A) and either IL-4 or IL-13 treatment could preferentially induce the 250 kDa variant (Fig. 5B). We also found that the induction of TNC mRNA by IL-4 and IL-13 was not the consequence of non-specific inflammation because STAT6 activation could upregulate TNC mRNA expression (Supplementary Material, Fig. S3). From these findings, we conclude that it is highly likely that SNP 44513A/T in the TNC Fn-III-D domain is functional, especially under the influence of Th2 cytokines.

There are a few studies analyzing the role of TNC in pathologic conditions, some of which showed homeostatic roles of TNC protein (21Go,22Go). Habu snake-venom toxin induces glomerulonephritis phenotype in TNC knockout mice with more severe disease than that in congenic control mice (23Go). We suppose that TNC is a molecule with homeostatic functions emergent under stressful conditions. The TNC molecule may also have homeostatic roles in asthmatic conditions and the instability of the Fn-III-D structure caused by this SNP may hence affect the pathophysiology of asthma.

In conclusion, we found a genetic association between the SNP encoding the Fn-III-D domain of the TNC molecule and the adult bronchial asthma. The coding SNP causes instability of the Fn-III-D domain structure. Under the influences of Th2 cytokines, the expression and functional impact of the TNC molecule increase. The coding SNP might be a useful marker for evaluating the risk for adult asthma and provides insights into the precise functional roles of TNC in the pathogenesis of asthma. Further study is needed.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Materials
The rat anti-human TNC monoclonal antibody (clone 3–6) was described previously (24Go). A horseradish peroxidase (HRP)-conjugated goat anti-rat IgG antibody and precast Tris–glycine polyacrylamide gels were purchased from Invitrogen (Carlsbad, CA, USA). Recombinant human IL-4 and IL-13 were purchased from Peprotec (London, UK).

Cell culture
NHLF were purchased from BioWhittaker (Walkersville, MD, USA) and cultured with the fibroblast basal medium from the same company according to the manufacturer's protocol.

Subjects
The adult asthmatic patients were recruited from approximately 4000 outpatients who were diagnosed as having bronchial asthma at the Miyatake Asthma Clinic or at the Osaka Prefectural Habikino Hospital by asthma specialists using the American Thoracic Society criteria as previously described (25Go,26Go). We selected 446 adult bronchial asthma patients (mean age 46.9, 16–70 years; male : female ratio, 1.0 : 1.2; mean serum IgE level, 741.3 U/ml; mite RAST positive 64.9%) satisfying the following symptoms and physical examination criteria: (i) those who showed episodic breathlessness, wheezing and chest tightness before treatment, (ii) the asthmatic symptoms were well controlled with known amounts of inhaled steroids. Among them, 105 patients were smokers or ex-smokers but not heavy smokers judged by the Fagerstrom Tolerance Questionnaire (26Go). Detailed information about the patients, including the severity of asthma (14Go) is summarized in Table 1. Peak expiratory flow analysis, spirometry, chest X-ray and CT scan were performed for the patients in need of differential diagnosis for COPD. Bronchial hyper-responsiveness was not tested. Peripheral blood was obtained from these 505 adult bronchial asthma patients. As a healthy control group, we analyzed 625 randomly selected population-based individuals (mean age 42.0, 18–69 years; male:female ratio, 2.5:1.0). We excluded the presence of asthma, atopic dermatitis and nasal allergies in the control population through careful interviews by physicians. All individuals were of Japanese origin and gave written informed consent to participate in the study, according to the process committee at SNP Research Center, RIKEN.

SNP discovery and genotyping in TNC gene
The TNC region targeted for SNP discovery included a 5 kb continuous region 5' to the gene and 28 exons, each with a minimum 200 bp of a flanking intronic sequence. Forty primer sets were designed on the basis of TNC genomic sequences (Supplementary Material, Table S2). Each PCR was performed with 5 ng of genomic DNA from 24 individuals (12 asthmatic patients and 12 controls). The PCR product was reacted with BigDye Terminator v3.1 (Applied Biosystems). We also utilized the SNP information from the database of SNPs by Japanese Science and Technology Agency database (JSNP). Intragenic pairwise LD in the TNC locus was examined by measuring r2 among 22 SNPs. The pairwise LD and haplotype were evaluated using the SNPAlyze 3.1 software (Dynacom Co. Ltd, Chiba, Japan). Position SNPs were numbered according to their position relative to the published genomic sequence containing the TNC region (GenBank accession no. AL162425), and position 1 is the adenine of the first methionine of TNC. The panel of 10 SNPs was genotyped with the multiplex PCR-Invader assay or Taqman genotyping system as described previously (27Go). To investigate the pattern of LD in and around the TNC locus, pairwise LD coefficients were calculated and expressed as |D'| or r. We evaluated the LD extension of the TNC genomic region with 48 SNPs registered in JSNP by genotyping 1041 general Japanese subjects.

Statistical analysis
Allele frequencies in bronchial asthma and controls were compared by the contingency {chi}2 test. A P-value of less than 0.01, after Bonferroni adjustment in case of multiple comparisons, was considered to be statistically significant. The OR and 95% CI were also calculated. Haplotype frequencies were estimated by the expectation-maximization algorithm.

TNC immunohistochemistry
TNC immunohistochemistry was performed essentially as previously described (24Go). Fresh human lung tissues were obtained and embedded in paraffin from patients undergoing surgery; informed consent was obtained. Asthmatic lung specimen was obtained from autopsied lung. The sections were deparaffined and endogenous peroxidase activity was quenched with 0.3% H2O2 in methanol for 20 min. Non-specific staining was blocked with blocking buffer [10% normal goat serum and 1% bovine serum albumin in phosphate-buffered saline (PBS)] for 30 min. The rat anti-human TNC antibody (10 µg/ml) was applied and reacted overnight at 4°C. After PBS washing, slides were incubated with HRP-conjugated anti-rat IgG antibody for 30 min. The slides were developed with DAB (Dojindo, Kumamoto, Japan) in Tris-buffered saline with 0.05% H2O2.

Computer modeling of TNC Fn-III-D protein structure
To examine the effect of amino acid substitution at position 1677 in the Fn-III-D domain, protein structural modeling was performed using MOE software (Chemical Computing Group Inc., Montreal, Canada). The coordinates of the 2.25 Å crystal structure of the chicken TNC Fn-III domain (PDB accession no. P24821) were used as a template for homology modeling of the human TNC Fn-III-D domain. The two structures were further minimized with AMBER 94 using MOE software. Both Leu1677 Ile variants of the TNC Fn-III-D domain were built up using the same program.

RT–PCR and western blotting analysis for TNC variants detection
Subconfluent NHLF were stimulated with 100 ng/ml IL-13 for 72 h and mRNA was isolated using a QuickPrep micro mRNA purification kit (Amersham, Uppsala, Sweden). cDNA was made with the SuperScript III First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA) using oligo(dT)20 primer. RT–PCR was carried out for 5 min at 95°C for initial denaturing, followed by 35 cycles of 95°C for 60 s, 52°C for 60 s, and 72°C for 120 s, in the GeneAmp PCR System 9700 (Applied Biosystems). The primer TNC-3089: ACCGCTACCGCCTCAATTACA and TNC-5331: GGTTCCGTCCACAGTTACCA were set to distinguish mRNA variants due to alternative splicing (13Go). The PCR products were electrophoresed in 1% agarose gel and distinct bands were excised. DNA was extracted from the excised bands with a DNA Gel Extraction Kit (Millipore, Tokyo, Japan) and subcloned into pCR II-TOPO cloning vector (Invitrogen). The subcloned inserts were read by sequencing. For western blotting, subconfluent NHLF were stimulated either with IL-4 or with IL-13 for 72 h at the concentration indicated in Fig. 5. The NHLF were solublized with SDS sample buffer (50 mM Tris–HCl pH6.8, 2% SDS, 20% glycerol, 0.4% bromophenol blue, 50 mM DTT). SDS–PAGE and subsequent immunoblotting were performed as previously described (21Go).


    SUPPLEMENTARY MATERIAL
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Supplementary Material is available at HMG Online.


    ACKNOWLEDGEMENTS
 
We thank Professor M. Munakata for comments and suggestions, Miki Kokubo and Hiroshi Sekiguchi for their excellent technical assistance and members of The Rotary Club of Osaka-Midosuji District 2660 Rotary International in Japan for supporting our study. This work was supported by a grant from the Japanese Millennium Project.

Conflict of Interest statement. None declared.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 

  1. Callerame, M.L., Condemi, J.J., Bohrod, M.G. and Vaughan, J.H. (1971) Immunologic reactions of bronchial tissues in asthma. N. Engl. J. Med., 284, 459–464.[Web of Science][Medline]

  2. Carroll, N., Elliot, J., Morton, A. and James, A. (1993) The structure of large and small airways in nonfatal and fatal asthma. Am. Rev. Respir. Dis., 147, 405–410.[Web of Science][Medline]

  3. Cohn, L., Elias, J.A. and Chupp, G.L. (2004) Asthma: mechanisms of disease persistence and progression. Annu. Rev. Immunol., 22, 789–815.[CrossRef][Web of Science][Medline]

  4. Heinzmann, A., Mao, X.Q., Akaiwa, M., Kreomer, R.T., Gao, P.S., Ohshima, K., Umeshita, R., Abe, Y., Braun, S., Yamashita, T. et al. (2000) Genetic variants of IL-13 signalling and human asthma and atopy. Hum. Mol. Genet., 9, 549–559.[Abstract/Free Full Text]

  5. Van Eerdewegh, P., Little, R.D., Dupuis, J., Del Mastro, R.G., Falls, K., Simon, J., Torrey, D., Pandit, S., McKenny, J., Braunschweiger, K. et al. (2002) Association of the ADAM33 gene with asthma and bronchial hyperresponsiveness. Nature, 418, 426–430.[CrossRef][Medline]

  6. Mitsuyasu, H., Izuhara, K., Mao, X.Q., Gao, P.S., Arinobu, Y., Enomoto, T., Kawai, M., Sasaki, S., Dake, Y., Hamasaki, N. et al. (1998) Ile50Val variant of IL4R alpha upregulates IgE synthesis and associates with atopic asthma. Nat. Genet., 19, 119–120.[CrossRef][Web of Science][Medline]

  7. Flood-Page, P., Menzies-Gow, A., Phipps, S., Ying, S., Wangoo, A., Ludwig, M.S., Barnes, N., Robinson, D. and Kay, A.B. (2003) Anti-IL-5 treatment reduces deposition of ECM proteins in the bronchial subepithelial basement membrane of mild atopic asthmatics. J. Clin. Invest., 112, 1029–1036.[CrossRef][Web of Science][Medline]

  8. Laitinen, A., Altraja, A., Kampe, M., Linden, M., Virtanen, I. and Laitinen, L.A. (1997) Tenascin is increased in airway basement membrane of asthmatics and decreased by an inhaled steroid. Am. J. Respir. Crit. Care Med., 156, 951–958.[Abstract/Free Full Text]

  9. Yuyama, N., Davies, D.E., Akaiwa, M., Matsui, K., Hamasaki, Y., Suminami, Y., Yoshida, N.L., Maeda, M., Pandit, A., Lordan, J.L. et al. (2002) Analysis of novel disease-related genes in bronchial asthma. Cytokine, 19, 287–296.[CrossRef][Web of Science][Medline]

  10. Lee, J.H., Kaminski, N., Dolganov, G., Grunig, G., Koth, L., Solomon, C., Erle, D.J. and Sheppard, D. (2001) Interleukin-13 induces dramatically different transcriptional programs in three human airway cell types. Am. J. Respir. Cell Mol. Biol., 25, 474–485.[Abstract/Free Full Text]

  11. Oberhauser, A.F., Marszalek, P.E., Erickson, H.P. and Fernandez, J.M. (1998) The molecular elasticity of the extracellular matrix protein tenascin. Nature, 393, 181–185.[CrossRef][Medline]

  12. Chiquet-Ehrismann, R., Tannheimer, M., Koch, M., Brunner, A., Spring, J., Martin, D., Baumgartner, S. and Chiquet, M. (1994) Tenascin-C expression by fibroblasts is elevated in stressed collagen gels. J. Cell Biol., 127, 2093–2101.[Abstract/Free Full Text]

  13. Siri, A., Carnemolla, B., Saginati, M., Leprini, A., Casari, G., Baralle, F. and Zardi, L. (1991) Human tenascin: primary structure, pre-mRNA splicing patterns and localization of the epitopes recognized by two monoclonal antibodies. Nucleic Acid. Res., 19, 525–531.[Abstract/Free Full Text]

  14. NIH (1995) Global Initiative for Asthma. NHLBI Global Strategy for Asthma Management and Prevention NHLBI/WHO Workshop. NIH publication, Bethesda, MD.

  15. Wjst, M., Fischer, G., Immervoll, T., Jung, M., Saar, K., Rueschendorf, F., Reis, A., Ulbrecht, M., Gomolka, M., Weiss, E.H. et al. (1999) A genome-wide search for linkage to asthma. German Asthma Genetics Group. Genomics, 58, 1–8.[CrossRef][Web of Science][Medline]

  16. Kaarteenaho-Wiik, R., Kinnula, V., Herva, R., Paakko, P., Pollanen, R. and Soini, Y. (2001) Distribution and mRNA expression of tenascin-C in developing human lung. Am. J. Respir. Cell Mol. Biol., 25, 341–346.[Abstract/Free Full Text]

  17. Kaarteenaho-Wiik, R., Kinnula, V.L., Herva, R., Soini, Y., Pollanen, R. and Paakko, P. (2002) Tenascin-C is highly expressed in respiratory distress syndrome and bronchopulmonary dysplasia. J. Histochem. Cytochem., 50, 423–431.[Abstract/Free Full Text]

  18. Roth-Kleiner, M., Hirsch, E. and Schittny, J.C. (2004) Fetal lungs of tenascin-C-deficient mice grow well, but branch poorly in organ culture. Am. J. Respir. Cell Mol. Biol., 30, 360–366.[Abstract/Free Full Text]

  19. Young, S.L., Chang, L.Y. and Erickson, H.P. (1994) Tenascin-C in rat lung: distribution, ontogeny and role in branching morphogenesis. Dev. Biol., 161, 615–625.[CrossRef][Web of Science][Medline]

  20. Matlin, A.J., Clark, F. and Smith, C.W. (2005) Understanding alternative splicing: towards a cellular code. Nat. Rev. Mol. Cell Biol., 6, 386–398.[CrossRef][Web of Science][Medline]

  21. Matsuda, A., Yoshiki, A., Tagawa, Y., Matsuda, H. and Kusakabe, M. (1999) Corneal wound healing in tenascin knockout mouse. Invest. Ophthalmol. Vis. Sci., 40, 1071–1080.[Abstract/Free Full Text]

  22. Koyama, Y., Kusubata, M., Yoshiki, A., Hiraiwa, N., Ohashi, T., Irie, S. and Kusakabe, M. (1998) Effect of tenascin-C deficiency on chemically induced dermatitis in the mouse. J. Invest. Dermatol., 111, 930–935.[CrossRef][Web of Science][Medline]

  23. Nakao, N., Hiraiwa, N., Yoshiki, A., Ike, F. and Kusakabe, M. (1998) Tenascin-C promotes healing of habu-snake venom-induced glomerulonephritis: studies in knockout congenic mice and in culture. Am. J. Pathol., 152, 1237–1245.[Abstract]

  24. Matsuda, A., Tagawa, Y. and Matsuda, H. (1999) TGF-beta2, tenascin, and integrin beta1 expression in superior limbic keratoconjunctivitis. Jpn. J. Ophthalmol., 43, 251–256.[CrossRef][Medline]

  25. American Thoracic Society. (1962) Chronic bronchitis, asthma and pulmonary emphysema: a statement by the Committee on Diagnostic Standards for Nontuberculous Respiratory Diseases. Am. Rev. Respir. Dis., 85, 762–768.[Web of Science]

  26. Fujita, K., Kasayama, S., Hashimoto, J., Nagasaka, Y., Nakano, N., Morimoto, Y., Barnes, P.J. and Miyatake, A. (2001) Inhaled corticosteroids reduce bone mineral density in early postmenopausal but not premenopausal asthmatic women. J. Bone Miner. Res., 16, 782–787.[CrossRef][Web of Science][Medline]

  27. Ohnishi, Y., Tanaka, T., Ozaki, K., Yamada, R., Suzuki, H. and Nakamura, Y. (2001) A high-throughput SNP typing system for genome-wide association studies. J. Hum. Genet., 46, 471–477.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. C. Snyder, A. C. Zemke, and B. R. Stripp
Reparative Capacity of Airway Epithelium Impacts Deposition and Remodeling of Extracellular Matrix
Am. J. Respir. Cell Mol. Biol., June 1, 2009; 40(6): 633 - 642.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
C. Orsmark-Pietras, E. Melen, J. Vendelin, S. Bruce, A. Laitinen, L. A. Laitinen, R. Lauener, J. Riedler, E. von Mutius, G. Doekes, et al.
Biological and genetic interaction between Tenascin C and Neuropeptide S receptor 1 in allergic diseases
Hum. Mol. Genet., June 1, 2008; 17(11): 1673 - 1682.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. Harada, K. Nakashima, T. Hirota, M. Shimizu, S. Doi, K. Fujita, T. Shirakawa, T. Enomoto, M. Yoshikawa, H. Moriyama, et al.
Functional Polymorphism in the Suppressor of Cytokine Signaling 1 Gene Associated with Adult Asthma
Am. J. Respir. Cell Mol. Biol., April 1, 2007; 36(4): 491 - 496.
[Abstract] [Full Text] [PDF]


Home page
Br. J. Sports. Med.Home page
A. V September, M. P Schwellnus, M. Collins, and W. Gibson
Tendon and ligament injuries: the genetic component * COMMENTARY
Br. J. Sports Med., April 1, 2007; 41(4): 241 - 246.
[Full Text] [PDF]


Home page
IOVSHome page
K. E. Keller, M. J. Kelley, and T. S. Acott
Extracellular Matrix Gene Alternative Splicing by Trabecular Meshwork Cells in Response to Mechanical Stretching
Invest. Ophthalmol. Vis. Sci., March 1, 2007; 48(3): 1164 - 1172.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. Matsuda, N. Ebihara, N. Kumagai, K. Fukuda, K. Ebe, K. Hirano, C. Sotozono, M. Tei, K. Hasegawa, M. Shimizu, et al.
Genetic Polymorphisms in the Promoter of the Interferon Gamma Receptor 1 Gene Are Associated with Atopic Cataracts
Invest. Ophthalmol. Vis. Sci., February 1, 2007; 48(2): 583 - 589.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. Vendelin, S. Bruce, P. Holopainen, V. Pulkkinen, P. Rytila, A. Pirskanen, M. Rehn, T. Laitinen, L. A. Laitinen, T. Haahtela, et al.
Downstream target genes of the neuropeptide S-NPSR1 pathway
Hum. Mol. Genet., October 1, 2006; 15(19): 2923 - 2935.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow All Versions of this Article:
14/19/2779    most recent
ddi311v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (13)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Matsuda, A.
Right arrow Articles by Shirakawa, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsuda, A.
Right arrow Articles by Shirakawa, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?