Human Molecular Genetics Advance Access originally published online on October 6, 2005
Human Molecular Genetics 2005 14(22):3539-3548; doi:10.1093/hmg/ddi382
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Two single-nucleotide polymorphisms in the human vitamin D receptor promoter change proteinDNA complex formation and are associated with height and vitamin D status in adolescent girls
1Inserm U561, Hôpital Saint Vincent de Paul, 82 Avenue Denfert-Rochereau, 75014 Paris, France and 2Departments of Medical Biophysics and Rheumatology, Centre Hospitalier Universitaire, 14033 Caen, France
* To whom correspondence should be addressed. Tel: +33 140479258; Fax: +33 140488352; Email: jehan{at}paris5.inserm.fr
Received July 11, 2005; Revised August 19, 2005; Accepted September 30, 2005
| ABSTRACT |
|---|
|
|
|---|
Numerous association studies have dealt with single-nucleotide polymorphisms (SNPs) in coding and intronic regions of the human vitamin D receptor (hVDR) gene. We have hypothesized that phenotypic traits may also be associated with variations in VDR expression due to the presence of SNPs in promoter regions. In this work, we have studied two SNPs located 1521 bp (G/C) and 1012 bp (A/G) upstream of the transcriptional start site of the main human VDR gene promoter. One base-change in any of the two variant sites led to a dramatic change in proteinDNA complex formation using nuclear extracts from HEK293, Caco-2 and COS-7 cells. Genetic analysis of 185 healthy adolescent girls evidenced two major haplotypes: 1521G/1012A and 1521C/1012G and three main genotypes: homozygous for 1521G/1012A (21.1%), homozygous for 1521C/1012G (17.3%) and heterozygous 1521CG/1012GA (57.3%). On the basis of transfection data, promoter activity was nearly 2-fold higher with the 1521G/1012A haplotype, when compared with the 1521C/1012G haplotype. Clinical and biological association study in the adolescent cohort showed that girls with a CC/GG genotype had (i) lower circulating levels of 25-dihydroxyvitamin D, with no detectable consequence on calcium metabolism, (ii) lower serum IGF-1 levels and (iii) smaller height from 11 years of age up to adult height.
| INTRODUCTION |
|---|
|
|
|---|
Numerous studies have analyzed possible associations between several single-nucleotide polymorphisms (SNPs) of the human vitamin D receptor (hVDR) gene and diseases or phenotypic traits involving known vitamin D functions like bone mineralization, calcium metabolism, cell differentiation or regulation of the immune system (1
Another SNPs has been recently identified at 1012 site (G/A variation) of the 1a-promoter of the hVDR, and over-representation of the A allele was found in patients with malignant melanoma (14
) and psoriasis (15
). Yet the functionality of this latter site and possible impact of variants in healthy populations have not been evaluated.
Keeping in line with the hypothesis that promoter SNPs may influence VDR expression and be associated with quantitative traits in healthy populations, we have screened 2 kb upstream of the transcriptional start site of the 1a-promoter of the VDR gene and identified two SNPs, one being the 1012 (G/A) and the other being localized at 1521 (G/C). We have shown their functionality, with dramatical changes in proteinDNA complex formation and transcriptional activity, in cell types that are classical vitamin D targets. This led us to test the influence of these human VDR gene promoter (hVDRp) SNPs on vitamin D status, height and bone mineralization in a cohort of healthy adolescent girls followed during a 4-year survey.
| RESULTS |
|---|
|
|
|---|
Two SNPs were found in the hVDRp
PCR amplification of the VDR promoter (2 kb) located upstream of the exon 1a showed the presence of two polymorphisms (Fig. 1), 1012 and 1521 bp upstream of the reported transcriptional start site of the promoter (16
|
Nuclear complexes bound to the 1521 and 1012 regions depend upon polymorphism
Binding of transcription factors, or protein complexes, was investigated in the promoter region surrounding the two polymorphisms (14 bp upstream and downstream to the SNPs). As shown by Electrophoretic mobility shift assay (EMSA) using nuclear extracts of HEK293 kidney cells, oligonucleotides containing either G or C polymorphisms in the 1521 region bound a similar slow-migrating complex and different faster-migrating complexes (Fig. 2A). Results differed in the 1012 region, where 1012A and 1012G each bound a major complex with different migration properties. Similar binding patterns were found with Caco-2 (Fig. 2B) and COS-7 nuclear extracts (Fig. 2C).
|
Searching database for transcription factor-binding sites (Transcription Element Search System, TESS, using Transfac database) failed to identify transcription factors docking to the 1012G, 1521G or 1521C sites. In contrast, 1012A presented the sequence of a consensus GATA binding site.
Major complexes bound to 1521C and 1012G are related
Competition studies in EMSA using HEK293 nuclear extracts showed cross-competition between the 1521C and 1521G oligonucleotides for the slow-migrating complexes, thus confirming the similarity of these complexes, and no cross-competition for the faster-migrating complexes, which had distinct migration properties (Fig. 3A and B). No cross-competition for nuclear complexes docking was observed between the 1012G and 1012A oligonucleotides, further supporting that single nucleotide variations dramatically switch the nuclear protein complex bound to the 1012 site (Fig. 3C and D).
|
Remarkably, the faster-migrating complex bound to 1521C and the main complex bound to 1012G had comparable migrating properties and the two oligonucleotides were able to compete with each other for nuclear binding (Fig. 3A and C). This suggests that 1521C and 1012G sites (which are mostly found on the same allele) bind the same or closely related nuclear complexes. Similar results were found using the Caco-2 and COS-7 nuclear extracts (data not shown).
The hVDRp activity depends upon haplotype variation
Transfection experiments were performed in HEK293 and in COS-7 cells to test the effects on hVDRp activity of the two major haplotypes found in our cohort (1521C/1012G and 1521G/1012A). A recurrent and significant 1.9-fold higher hVDRp activity (P<0.0001 in unpaired Student's t-test) was found with the promoter containing the 1521G/1012A allele (Fig. 4).
|
Genotypes of the hVDRp are associated with variations in skeletal growth
Genotype and phenotype associations were analyzed in the 177 adolescent and young adult females bearing one of the three most frequent VDR promoter genotypes (Tables 1 and 2), as the other genotypes included only three individuals or less. At the beginning of the study, the three genotypes did not differ as regards mean chronological age, body weight and body mass index. Age at menarche established at the end of the survey did not depend on the genotype (Table 1). Girls with a GG/AA genotype tended to have more advanced bone maturation and a higher bone mineral density, when adjusted for age and pubertal stage. But these differences did not reach significance. In contrast, height, expressed as standard deviations (SD) on French reference growth curves, was significantly associated with the hVDRp genotype, with a 0.7 SD lower height in girls with a CC/GG genotype versus girls with a GG/AA genotype (P=0.006). Moreover, girls with a small size (
1 SD) or a low bone mass (
1 SD) were more frequently found in the CC/GG population (20%) than in the GG/AA population (3 and 6%). Interestingly, girls with the CC/GG genotype also had significantly lower mean levels of circulating total IGF-1.
|
|
At the beginning of the survey, no significant genotype association was observed with either mean serum calcium, urinary calcium excretion, serum PTH, serum osteocalcin, serum 1.25-(OH)2D or serum alkaline phosphatase activity (Table 2). But girls with the CC/GG genotype had significantly lower mean circulating levels of 25-(OH)D, the storage form of vitamin D (P=0.006). Furthermore, 20% of the CC/GG girls had 25-(OH)D levels below the threshold of vitamin D deficiency (10 ng/ml), whereas they were only 3% in the GG/AA group.
Multiple regression analysis (Table 3) confirmed the significant contribution of the VDR promoter genotype to height, serum IGF-1 levels and serum 25-(OH)D levels at the beginning of the survey. In contrast, none of the tested clinical and biological variables, besides 25-(OH)D levels (18±1.6, 19±0.9 and 23±2.0 ng/ml in BB, Bb and bb girls, respectively, P<0.05), was associated with the BsmI genotype (Table 3).
|
Analyzing age-dependent height in the whole cohort showed significantly shorter size in the CC/GG group at all ages, from 11 years up to the end of puberty (Fig. 5), with no genotype dependent changes in growth velocity during the 4-year survey (1.6±0.4, 1.8±0.2 and 1.7±0.3 cm/yr in the CC/GG, CG/GA and GG/AA groups, respectively). In addition, the observation that 90 girls had reached the age of 18 or more at the end of the survey allowed a preliminary analysis of adult size in this cohort (Table 4). Height in female young adults with a CC/GG genotype was 164.2±1.5 cm, >3 cm shorter (P=0.05) than in the heterozygous (167.2±0.8 cm) and GG/AA groups (167.6±1.3 cm).
|
|
| DISCUSSION |
|---|
|
|
|---|
Promoter regions are potential candidates for the presence of functional SNPs affecting gene expression in human population (17
The two polymorphisms are located 1521 bp (G/C) and 1012 bp (A/G) upstream of the transcriptional start site of the promoter (16
). These two SNPs are among the 245 polymorphisms recently identified on the human VDR gene (18
). However, their functionality has not been studied so far. This study shows that the two SNPs are functional: (i) one base-change in any of the two variant sites led to a dramatic switch in the nature of the complex bound to this part of the VDR promoter and (ii) it resulted in significant change in hVDRp activity. The two polymorphism sites, in EMSA studies, bound complexes present in different cell types such as enterocytes (Caco-2 cells), human tubular kidney cells (HEK293) and African green monkey kidney cells (COS-7 cells). Therefore, we can speculate that the impact of these polymorphisms on VDR expression will affect major target tissues for vitamin D, including intestine and kidney. As 1521C and 1012G sites are likely binding the same complex and have resembling sequence, we drew a consensus sequence ACC/AA/TTGCTT/AT, where underlined positions correspond to polymorphism positions at 1521 ad 1012 sites. No transcription factor-binding element has been found, using each individual sequence or the consensus sequence, during extensive TESS searches using the Transfac database. In contrast, similar TESS searches support the hypothesis that the 1012A binding area is a GATA site. Further EMSA and competition experiments confirmed the ability of the 1012A site to bind GATA factors (19
).
On the basis of transfection data using the two hVDRp main haplotypes, hVDR promoter activity in renal HEK293 cells and COS-7 cells was nearly 2-fold higher with the 1521G/1012A haplotype, which contains the GATA site, when compared with the 1521C/1012G haplotype, which contains two docking sites to the same unknown transcription factor complex. It is thus possible that the VDR content is reduced in cells (and individuals) bearing a CC/GG genotype.
Genotyping the present cohort of healthy French Caucasian girls evidenced SNPs frequencies similar to those described for the 1012 (14
,18
) and the 1521 (18
) sites in Britain populations. Both genotypes were linked, very likely due to their close location (509 bp apart), and there was a high frequency of homozygous haplotypes, 21.1% 1521GG/1012AA (GG/AA) and 17.3% 1521CC/1012GG (CC/GG), allowing association studies. These two polymorphisms localize to the haplotype block C covering the intron 2exon 1f regulatory region of the VDR gene described by Nejentsev et al. (18
). They are in linkage disequilibrium with the Cdx-2 polymorphism, which is also in haplotype block C, but not with other studied polymorphisms, such as BsmI ApaI and TaqI in haplotype block B or FokI located in the breaking spot separating blocks B and C (18
).
Keeping in line with a putative lower hVDR expression in cells with a CC/GG genotype, we have searched for an association between hVDRp genotypes and markers of vitamin D status and vitamin D responsiveness. Girls with a CC/GG genotype had lower circulating levels of 25-(OH)D and tended to have higher, although not significant, circulating levels of 1,25-dihydroxyvitamin D. Similarly, low normal 25-(OH)D and elevated 1,25-(OH)2D levels have been observed in children with genetically altered VDR function and severe vitamin D resistance (20
). These findings are thought to result from increased 1,25-(OH)2D production and decreased 1,25-(OH)2D catabolism, both being VDR dependent (21
). Yet, the absence of association between VDRp genotypes and either serum calcium, serum PTH or urinary calcium excretion suggests that vitamin D resistance in the CC/GG cohort was moderate and not sufficient to alter calcium metabolism.
Of particular interest, height in CC/GG girls was found to be markedly smaller during the 4-year survey that spanned the pubertal growth spurt up to adult height. Earlier studies have considered association between height and VDR polymorphisms located in coding and intronic regions of the VDR gene, namely BsmI, ApaI, TaqI and FokI. FokI site influences the length and activity of the VDR protein (21
). The other polymorphism sites have no known functional activity, but they are tightly linked to other VDR gene polymorphism sites, which may influence VDR mRNA stability or VDR transcriptional activity (19
). Associations between height and VDR genotypes at these polymorphism sites have been reported in pre-pubertal and pubertal children (3
5
,8
,9
), adult men (5
) and adult women (3
,10
). However, other studies have found no such associations in young or adult males (4
,6
,8
,10
) or females (6,7,22 and present study). Our findings are the first shown with variants located in the main regulatory region of the VDR gene, at polymorphic sites important for the regulation of the promoter activity. These findings suggest that the hVDRp genotype may contribute to growth, up to adult stature, via variations in the transactivation capacity of the hVDRp, in addition to other hVDR polymorphisms influencing the stability of hVDR mRNA or the length of the hVDR protein. Of interest, hVDRp genotypes were associated with height, but neither with body weight, body mass index, bone mineral content nor circulating markers of bone metabolism (osteocalcin and alkaline phosphatase activity). It appears thus that the putative hVDRp genotype effect on growth might specifically concern the growth plate cartilage function, rather than bone growth and mineralization. Along this line, associations between VDR genotype and bone density during growth have been observed in some studies (8
,23
,24
), but not all studies (5
,6
,25
), and have been attributed to variance in bone size rather than in bone mineralization (4
,9
).
Several global genome scanning for genetic determination of height loci have highlighted the chromosome 12 as a region of interest (26
), and a peak of linkage with adult height has been observed at the chromosome marker D12S398 locus (27
29
). Interestingly, VDR gene is located at chromosome 12q12q14, and the peak of linkage is located only 4.5 Mb from the VDR gene, a spacing smaller than the average spacing between two markers in these studies. Therefore, the VDR gene could be one of the genetic determinants of adult height pointed out by genome scan studies.
Several evidences point out vitamin D as a likely contributor to growth: (i) its activity on cell proliferation in bone and growth plate cartilage (30
,31
), (ii) the growth delay observed in patients with vitamin D deficiency or pseudo-deficiency rickets and (iii) the growth enhancing effect of vitamin D during intrauterine and postnatal life in children (32
). VDR is likely to be involved in this action, as suggested by phenotype and genotype association studies including the present one, and by the observation of a reduced growth in transgenic mice with an invalidated vitamin D receptor (33
); however, how VDR controls growth remains to be elucidated. The observed differences in height do not seem related to differences in sexual maturation or bone differentiation, as age at menarche and bone age were not associated with hVDRp genotype. In contrast, the significant association with circulating levels of IGF-1 suggests that this major factor for skeletal growth mediates in part the observed association with height. There is no evidence as yet for a direct interaction between VDR and the IGF-1 gene. But several interactions between vitamin D and the IGF system have been reported: (i) 1,25-(OH)2D increases IGF-1 circulating levels in vivo (34
) and in bone cell cultures (35
37
); (ii) it increases the expression of the IGF-Type 1 receptor in growth plate chondrocytes (38
); (iii) it increases the expression of several IGF-binding proteins in osteoblasts and bone marrow stromal cell cultures, namely IGF-BP2 and IGF-BP3 (39
), IGF-BP4 (37
40
) and IGF-BP5 (41
); (iv) a VDR responsive element has been identified on the promoter region of IGF-BP3 (42
). Finally, it has been proposed that VDR genotype effects result from variations in VDR expression in the intestine and, subsequently, in the intestine ability to absorb calcium (43
46
). Biological and clinical association studies gave no evidence for a lower calcium absorption in the CC/GG girls. But interactions of calcium (or dairy product) intake and VDR genotype on pubertal growth cannot be excluded.
In conclusion, we identified two functional SNPs located in the main VDR promoter. One base-change in any of the two variant sites led to a dramatic change in the nature of proteinDNA complex formation and to significant changes in the transactivation capacity of the VDR promoter. Results of the present association studies in female adolescents suggest that these two SNPs may be of great interest for the understanding of individual phenotypic variations in response to vitamin D.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Population cohort
The studied cohort included 185 unrelated healthy French Caucasian girls with no known alteration in calcium or bone metabolism (mean ±SD: 14.7±2.8 years; range: 1122 years). All girls had been enrolled for the 4-year survey of their bone mineral mass acquisition (47
Analysis of the human VDR promoter SNPs
Genomic DNA was prepared from blood, using commercial extraction kits (Qiagen, Courtaboeuf, France). The human VDR promoter was PCR-amplified with 50 ng of genomic DNA as template using 0.5 µM of 3' forward primer 5'-GGA CTT GCA GAG AAT GTC CCA AG-3' (1609 to 1586 pb from the start site of the hVDRp) and 0.5 µM of 3' reverse primer 5'-GAT AGG CAC CGC TCT ATC TGC-3' (position 856 to 835 pb). The PCR amplifications were performed using either 2 units of Taq polymerase or 4 units of BioXAct short (Abcys S.A., Paris France), enzyme for difficult templates in the presence of 2.0 mM MgCl2 and 1x buffer of the enzyme supplier. Thermal conditions required for the PCR reactions were 94°C for 3 min, followed by 35 cycles of 20 s of denaturation at 94°C, 20 s of annealing at 56°C and 1 min of elongation at 72°C, followed by a final step of 5 min of elongation at 72°C. PCR products were purified using High Pure PCR Product Purification Kit (Roche Diagnostics). Sequencing was carried out by the Sequencing Facility of the Institut Cochin (Inserm U567, Paris, France). Statistical analysis (ANOVA, Student's t-test and multiple regression analysis) has been performed using the Staview 5.0 software.
hVDR gene promoter and reporter vector construction
The human VDR promoter region was subcloned into the pGL2 luciferase reporter vector (Promega Corporation, Madison, WI, USA) from the commercially available BAC vector RP11-89H19 (Roswell Park Center Institute Human BAC Library via Invitrogen Life Technologies) containing a 58 kb fragment of human genomic DNA (GenBank accession number AC121338) located between exon 1f and exon 3 of the hVDR gene.
The 2024 bp fragment of hVDRp was obtained by cutting the BAC RP11-89H19 vector with EagI and BglII restriction enzymes. Then, the fragment was placed into pGL2basic vector in the BglII site, and a new EagI site, generated by an oligonucleotide insertion in the NheI and HindIII sites: Sense oligonucleotide CTAGCTCGAGATCTAACTGCAGGTTATTCAAGTCGGCCGTA and Antisense oligonucleotide AGCTTACGGCCGACTTGAATAACCTGCAGTTAGATCTCGAG.
Transformant Escherichia coli clones (strain DH5
) were screened using a 32P-labeled oligonucleotide probe (5'-GCT AGC TTT CCC ACG ATG CTT TGG GCA AG-3') and positive clones were confirmed by sequencing.
Site-directed mutagenesis at the SNP locations in the hVDRp was performed using the Gene Editor TM system (Promega Corporation). The mutated oligonucleotides used were 5'-AGG CGA ATA GCA ATG TCT TCC CTG GCT AA-3' for 1012 SNP and 5'-GCT AGC TTT CCC ACC ATG CTT TGG GCA AG-3' for 1521 SNP (the mutated base in underlined). Each site-directed mutant was confirmed by sequencing.
Cell culture
Human intestinal cells (Caco-2), human kidney cells (HEK293) and African green monkey kidney cells (COS-7) were obtained from the American Type Culture Collection (HTB-37, Rockville, MD, USA). All cells were cultured at 37°C under 5% CO2 in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum and antibiotics (100 U/ml penicillin G, 100 mg/ml of streptomycin sulfate, 0.25 µg/ml amphotericin B).
Transfection and luciferase assays
For these transfection studies, HEK293 and COS-7 cells were plated in six well plates (2x105 cells/well) with 2 ml of medium for 24 h. Cells were transfected using 2 µl of fuGENETM six transfection reagent (Roche Diagnostics, France) with 0.95 µg of the pGL2 vector containing a 2024 pb hVDR promoter fragment coupled to the firefly luciferase reporter gene. In each transfection, 50 ng of the ß-galactosidase expression vector pCMVß (Clontech, Palo Alto, CA, USA) was used to correct for transfection efficiency. The cells have been grown for an additional 48 h and harvested with 200 µl of 1x lysis buffer (Promega Corporation). Luciferase activities have been measured in 10 µl of cell extract with LG Berthold Lumat LB 9507 and corrected average ß-galactosidase activity determined by a standard colorimetric procedure using o-nitrophenyl-ß-D-galactopyranoside (ONPG) as substrate.
Electrophoretic mobility shift assays
Nuclear proteins were extracted as described previously (51
) in a 300 mM KCL solution. The following double-stranded oligonucleotide probes (SNP identified in bold highlighted) were generated: 1012 A sense: 5'-AGG CGA ATA GCA ATA TCT TCC CTG GCT AA-3'; 1012 A antisense: 5'-TTA GCC AGG GAA GAT ATT GCT ATT CGC CT-3'; 1012 G sense: 5'-AGG CGA ATA GCA ATG TCT TCC CTG GCT AA-3'; 1012 G antisense: 5'-TTA GCC AGG GAA GAC ATT GCT ATT CGC CT-3'; 1521 G sense: 5'-GCT AGC TTT CCC ACG ATG CTT TGG GCA AG-3'; 1521 G antisense: 5'-CTT GCC CAA AGC ATC GTG GGA AAG CTA GC-3'; 1521 C sense: 5'-GCT AGC TTT CCC ACC ATG CTT TGG GCA AG-3'; 1521 C antisense: 5'-CTT GCC CAA AGC ATG GTG GGA AAG CTA GC-3'.
The double-stranded synthetic oligonucleotides were [
-32P]-ATP end-labeled by T4 polynucleotide kinase (Invitrogen Life Technologies) and purified on a non-denaturing 10% polyacrylamide gel prior to gel shift studies. EMSA and competition experiments were described previously (52
). Competition experiments were performed using an 100-fold of a non-radioactive probe.
| ACKNOWLEDGEMENTS |
|---|
We thank Françoise Suarez for Genomic DNA extraction and BsmI polymorphism determination, and we thank IREM for IGF-1-related assays. The work was supported in part by a grant from the Candia Institute.
Conflict of Interest statement. None declared.
| REFERENCES |
|---|
|
|
|---|
- Uitterlinden, A.G., Fang, Y., Van Meurs, J.B., Pols, H.A. and Van Leeuwen, J.P. (2004) Genetics and biology of vitamin D receptor polymorphisms. Gene, 338, 143156.[CrossRef][ISI][Medline]
-
Suarez, F., Zeghoud, F., Rossignol, C., Walrant, O. and Garabedian, M. (1997) Association between vitamin D receptor gene polymorphism and sex-dependent growth during the first two years of life. J. Clin. Endocrinol. Metab., 82, 29662970.
[Abstract/Free Full Text] - Minamitani, K., Takahashi, Y., Minagawa, M., Yasuda, T. and Niimi, H. (1998) Difference in height associated with a translation start site polymorphism in the vitamin D receptor gene. Pediatr. Res., 44, 628632.[ISI][Medline]
-
Tao, C., Yu, T., Garnett, S., Briody, J., Knight, J., Woodhead, H. and Cowell, C.T. (1998) Vitamin D receptor alleles predict growth and bone density in girls. Arch. Dis. Child, 79, 488493.
[Abstract/Free Full Text] -
Lorentzon, M., Lorentzon, R. and Nordstrom, P. (2000) Vitamin D receptor gene polymorphism is associated with birth height, growth to adolescence, and adult stature in healthy caucasian men, a cross-sectional and longitudinal study. J. Clin. Endocrinol. Metab., 85, 16661670.
[Abstract/Free Full Text] - Baroncelli, G.I., Federico, G., Bertelloni, S., Ceccarelli, C., Cupelli, D. and Saggese, G. (1999) Vitamin-D receptor genotype does not predict bone mineral density, bone turnover, and growth in prepubertal children. Horm. Res., 51, 150156.[CrossRef][ISI][Medline]
- Keen, R.W., Egger, P., Fall, C., Major, P.J., Lanchbury, J.S., Spector, T.D. and Cooper, C. (1997) Polymorphisms of the vitamin D receptor, infant growth, and adult bone mass. Calcif. Tissue Int., 60, 233235.[CrossRef][ISI][Medline]
- Ferrara, M., Matarese, S.M., Francese, M., Borrelli, B., Coppola, A., Coppola, L. and Esposito, L. (2002) Effect of VDR polymorphisms on growth and bone mineral density in homozygous beta thalassaemia. Br. J. Haematol., 117, 436440.[CrossRef][ISI][Medline]
- van der Sluis, I.M., de Muinck Keizer-Schrama, S.M., Krenning, E.P., Pols, H.A. and Uitterlinden, A.G. (2003) Vitamin D receptor gene polymorphism predicts height and bone size, rather than bone density in children and young adults. Calcif. Tissue Int., 73, 332338.[CrossRef][ISI][Medline]
-
Xiong, D.H., Xu, F.H., Liu, P.Y., Shen, H., Long, J.R., Elze, L., Recker, R.R. and Deng, H.W. (2005) Vitamin D receptor gene polymorphisms are linked to and associated with adult height. J. Med. Genet., 42, 228234.
[Abstract/Free Full Text] - Yamamoto, H., Miyamoto, K., Li, B., Taketan, Y., Kitano, M., Inoue, Y., Morita, K., Pike, J.W. and Takeda, E. (1999) The caudal-related homeodomain protein Cdx-2 regulates vitamin D receptor gene expression in the small intestine. J. Bone Miner. Res., 14, 240247.[CrossRef][ISI][Medline]
- Arai, H., Miyamoto, K.I., Yoshida, M., Yamamoto. H., Taketani, Y., Morita, K., Kubota, M., Yoshida, S., Ikeda, M., Watabe, F. et al. (2001) The polymorphism in the caudal-related homeodomain protein Cdx-2 binding element in the human vitamin D receptor gene. J. Bone Miner. Res., 16, 12561264.[CrossRef][ISI][Medline]
- Fang, Y., van Meurs, J.B., Bergink, A.P., Hofman, A., van Duijn, C.M., van Leeuwen, J.P., Pols, H.A. and Uitterlinden, A.G. (2003) Cdx-2 polymorphism in the promoter region of the human vitamin D receptor gene determines susceptibility to fracture in the elderly. J. Bone Miner. Res., 18, 16321641.[CrossRef][ISI][Medline]
- Halsall, J.A., Osborne, J.E., Potter, L., Pringle, J.H. and Hutchinson, P.E. (2004) A novel polymorphism in the 1A promoter region of the vitamin D receptor is associated with altered susceptibility and prognosis in malignant melanoma. Br. J. Cancer, 91, 765770.[ISI][Medline]
- Halsall, J.A., Osborne, J.E., Pringle, J.H. and Hutchinson, P.E. (2005) Vitamin D receptor gene polymorphisms, particularly the novel A-1012G promoter polymorphism, are associated with vitamin D3 responsiveness and non-familial susceptibility in psoriasis. Pharmacogenet. Genomics, 15, 349355.[ISI][Medline]
-
Miyamoto, K., Kesterson, R.A., Yamamoto, H., Taketani, Y., Nishiwaki, E., Tatsumi, S., Inoue, Y., Morita, K., Takeda, E. and Pike, J.W. (1997) Structural organization of the human vitamin D receptor chromosomal gene and its promoter. Mol. Endocrinol., 11, 11651179.
[Abstract/Free Full Text] -
Hoogendoorn, B., Coleman, S.L., Guy, C.A, Smith, K., Bowen, T., Buckland, P.R. and O'Donovan, M.C. (2003) Functional analysis of human promoter polymorphisms. Hum. Mol. Genet., 12, 22492254.
[Abstract/Free Full Text] -
Nejentsev, S., Godfrey, L., Snook, H., Rance, H., Nutland, S., Walker, N.M., Lam, A.C., Guja, C., Ionescu-Tirgoviste, C., Undlien, D.E. et al. (2004) Comparative high-resolution analysis of linkage disequilibrium and tag single nucleotide polymorphisms between populations in the vitamin D receptor gene. Hum. Mol. Genet., 13, 16331639.
[Abstract/Free Full Text] - Fang, Y., van Meurs, J.B., d'Alesio, A., Jhamai, M., Zhao, H., Rivadeneira, F., Hofman, A., van Leeuwen, J.P.T., Jehan, F., Pols, H.A.P. and Uitterlinden, A.G. Promoter and 3'UTR haplotypes in the vitamin D receptor (VDR) gene predispose to osteoporotic fracture: the Rotterdam Study. Am. J. Hum. Genet., in press.
- Balsan, S., Garabedian, M., Liberman, U.A., Eil, C., Bourdeau, A., Guillozo, H., Grimberg, R., Le Deunff, M.J., Lieberherr, M., Guimbaud, P., Broyer, M. and Marx, S.J. (1983) Rickets and alopecia with resistance to 1,25-dihydroxyvitamin D: two different clinical courses with two different cellular defects. J. Clin. Endocrinol. Metab., 57, 803811.[Abstract]
- Haussler, M.R., Whitfield, G.K., Haussler, C.A., Hsieh, J.C., Thompson, P.D., Selznick, S.H., Dominguez, C.E. and Jurutka, P.W. (1998) The nuclear vitamin D receptor: biological and molecular regulatory properties revealed. J. Bone Miner. Res., 13, 325349.[CrossRef][ISI][Medline]
-
Garnero, P., Munoz, F., Borel, O., Sornay-Rendu, E. and Delmas, P.D. (2005) Vitamin D receptor gene polymorphisms are associated with risk of fractures in postmenopausal women, independently of bone density. The OFELY study. J. Clin. Endocrinol. Metab., 90, 48294835.
[Abstract/Free Full Text] -
Sainz, J., Van Tornout, J.M., Loro, M.L., Sayre, J., Roe, T.F. and Gilsanz, V. (1997) Vitamin D-receptor gene polymorphisms and bone density in prepubertal American girls of Mexican descent. N. Engl. J. Med., 337, 7782.
[Abstract/Free Full Text] - Viitanen, A., Karkkainen, M., Laitinen, K., Lamberg-Allardt, C., Kainulainen, K., Rasanen, L., Viikari, J., Valimaki, M.J. and Kontula, K. (1996) Common polymorphism of the vitamin D receptor gene is associated with variation of peak bone mass in young finns. Calcif. Tissue Int., 59, 231234.[CrossRef][ISI][Medline]
-
Gunnes, M., Berg, J.P., Halse, J. and Lehmann, E.H. (1997) Lack of relationship between vitamin D receptor genotype and forearm bone gain in healthy children, adolescents, and young adults. J. Clin. Endocrinol. Metab., 82, 851855.
[Abstract/Free Full Text] - Willemsen, G., Boomsma, D.I., Beem, A.L., Vink, J.M., Slagboom, P.E. and Posthuma, D. (2004) QTLs for height: results of a full genome scan in Dutch sibling pairs. Eur. J. Hum. Genet., 12, 820828.[CrossRef][ISI][Medline]
- Hirschhorn, J.N., Lindgren, C.M., Daly, M.J., Kirby, A., Schaffner, S.F., Burtt, N.P., Altshuler, D., Parker A., Rioux, J.D., Platko, J. et al. (2001) Genomewide linkage analysis of stature in multiple populations reveals several regions with evidence of linkage to adult height. Am. J. Hum. Genet., 69, 106116.[CrossRef][ISI][Medline]
- Beck, S.R., Brown, W.M., Williams, A.H., Pierce, J., Rich, S.S. and Langefeld, C. (2003) Age-stratified QTL genome scan analyses for anthropometric measures. BMC Genet., 4 (Suppl. 1), S31.
- Geller, F., Dempfle, A. and Gorg, T. (2003) Genome scan for body mass index and height in the Framingham Heart Study. BMC Genet., 4, S91.
- Schwartz, Z., Schlader, D.L., Ramirez, V., Kennedy, M.B. and Boyan, B.D. (1989) Effects of vitamin D metabolites on collagen production and cell proliferation of growth zone and resting zone cartilage cells in vitro. J. Bone Miner. Res., 4, 199207.[ISI][Medline]
-
Kato, Y., Shimazu, A., Iwamoto, M., Nakashima, K., Koike, T., Suzuki, F., Nishii, Y. and Sato, K. (1990) Role of 1,25-dihydroxycholecalciferol in growth-plate cartilage: inhibition of terminal differentiation of chondrocytes in vitro and in vivo. Proc. Natl Acad. Sci. USA, 87, 65226526.
[Abstract/Free Full Text] - Brooke, O.G., Butters, F. and Wood, C. (1981) Intrauterine vitamin D nutrition and postnatal growth in Asian infants. Br. Med. J., (Clin. Res. Ed.) 283, 1024.
-
Li, Y.C., Pirro, A.E., Amling, M., Delling, G., Baron, R., Bronson, R. and Demay, M.B. (1997) Targeted ablation of the vitamin D receptor: an animal model of vitamin D-dependent rickets type II with alopecia. Proc. Natl Acad. Sci. USA, 94, 98319835.
[Abstract/Free Full Text] - Zofkova, I., Kancheva, R.L. and Bendlova, B. (1997) Effect of 1,25(OH)2 vitamin D3 on circulating insulin-like growth factor-I and beta 2 microglobulin in patients with osteoporosis. Calcif. Tissue Int., 60, 236239.[CrossRef][ISI][Medline]
- Kurose, H., Yamaoka, K., Okada, S., Nakajima, S. and Seino, Y. (1990) 1,25-Dihydroxyvitamin D3 [1,25-(OH)2D3] increases insulin-like growth factor I (IGF-I) receptors in clonal osteoblastic cells. Study on interaction of IGF-I and 1,25-(OH)2D3. Endocrinology, 126, 20882094.[Abstract]
- Chenu, C., Valentin-Opran, A., Chavassieux, P., Saez, S., Meunier, P.J. and Delmas, P.D. (1990) Insulin like growth factor I hormonal regulation by growth hormone and by 1,25(OH)2D3 and activity on human osteoblast-like cells in short-term cultures. Bone, 11, 8186.[Medline]
- Scharla, S.H., Strong, D.D., Mohan, S., Baylink, D.J. and Linkhart, T.A. (1991) 1,25-Dihydroxyvitamin D3 differentially regulates the production of insulin-like growth factor I (IGF-I) and IGF-binding protein-4 in mouse osteoblasts. Endocrinology, 129, 31393146.[Abstract]
- Klaus, G., Weber, L., Rodriguez, J., Fernandez, P., Klein T., Grulich-Henn, J., Hugel, U., Ritz, E. and Mehls, P. (1998) Interaction of IGF-I and 1 alpha, 25(OH)2D3 on receptor expression and growth stimulation in rat growth plate chondrocytes. Kidney Int., 53, 11521161.[CrossRef][ISI][Medline]
- Kveiborg, M., Flyvbjerg, A., Eriksen, E.F. and Kassem, M. (2001) 1,25-Dihydroxyvitamin D3 stimulates the production of insulin-like growth factor-binding proteins-2, -3 and -4 in human bone marrow stromal cells. Eur. J. Endocrinol., 144, 549557.[Abstract]
- Scharla, S.H., Strong, D.D., Rosen, C., Mohan, S., Holick, M., Baylink, D.J. and Linkhart, T.A. (1993) 1,25-Dihydroxyvitamin D3 increases secretion of insulin-like growth factor binding protein-4 (IGFBP-4) by human osteoblast-like cells in vitro and elevates IGFBP-4 serum levels in vivo. J. Clin. Endocrinol. Metab., 77, 11901197.[Abstract]
- Schmid, C., Schlapfer, I., Gosteli-Peter, M.A., Hauri, C., Froesch, E.R. and Zapf, J. (1996) 1 alpha,25-dihydroxyvitamin D3 increases IGF binding protein-5 expression in cultured osteoblasts. FEBS Lett., 392, 2124.[CrossRef][ISI][Medline]
-
Peng, L., Malloy, P.J. and Feldman, D. (2004) Identification of a functional vitamin D response element in the human insulin-like growth factor binding protein-3 promoter. Mol. Endocrinol., 18, 11091119.
[Abstract/Free Full Text] - Kiel, D.P., Myers, R.H., Cupples, L.A., Kong, X.F., Zhu, X.H., Ordovas, J., Schaefer, E.J., Felson, D.T., Rush, D., Wilson, P.W. et al. (1997) The BsmI vitamin D receptor restriction fragment length polymorphism (bb) influences the effect of calcium intake on bone mineral density. J. Bone Miner. Res., 12, 10491057.[CrossRef][ISI][Medline]
- Gennari, L., Becherini, L., Masi, L., Gonnelli, S., Cepollaro, C., Martini, S., Mansani, R. and Brandi, M.L. (1997) Vitamin D receptor genotypes and intestinal calcium absorption in postmenopausal women. Calcif. Tissue Int., 61, 460463.[CrossRef][ISI][Medline]
- Dawson-Hughes, B., Harris, S.S. and Finneran, S. (1995) Calcium absorption responses to calcitriol in black and white premenopausal women. J. Clin. Endocrinol. Metab., 80, 36573661.[Abstract]
- Ames, S.K., Ellis, K.J., Gunn, S.K., Copeland, K.C. and Abrams, S.A. (1999) Vitamin D receptor gene Fok1 polymorphism predicts calcium absorption and bone mineral density in children. J. Bone Miner. Res., 14, 740746.[CrossRef][ISI][Medline]
- Sabatier, J.P., Guaydier-Souquieres, G., Benmalek, A. and Marcelli, C. (1999) Evolution of lumbar bone mineral content during adolescence and adulthood: a longitudinal study in 395 healthy females 1024 years of age and 206 premenopausal women. Osteoporos. Int., 9, 476482.[CrossRef][ISI][Medline]
- Zeghoud, F., Jardel, A., Guillozo, H., N'Guyen, T.M. and Garabédian, M. (1991) Micromethod for the determination of 25-hydroxyvitamin D. In Norman A.W., Bouillon R. and Thomasset M. (eds) Vitamin D. Gene Regulation, Structure-Function Analysis and Clinical Application. Walter de Gruyter, Berlin, New York, pp. 662663.
- Carter, G., Hewitt, J., Trafford, J. and Makin, H.L. (1994) External quality assessment of 25 hydroxyvitamin D assays. In Norman A.W., Bouillon R. and Thomasset M. (eds) Vitamin D. A Pluripotent Steroid Hormone: Structural Studies, Molecular Endocrinology and Clinical Applications. Walter de Gruyter, Berlin, New York, pp. 759760.
- Sempé, M., Pédron, G. and Roy-Pernot, M.P. (1979) Auxologie, Méthodes et Séquences. Théraplix, Paris, p. 205.
-
Dame, M.C., Pierce, E.A. and DeLuca, H.F. (1985) Identification of the porcine intestinal 1,25-dihydroxyvitamin D3 receptor on sodium dodecyl sulfate/polyacrylamide gels by renaturation and immunoblotting. Proc. Natl Acad. Sci. USA, 82, 78257829.
[Abstract/Free Full Text] -
Jehan, F. and DeLuca, H.F. (2000) The mouse vitamin D receptor is mainly expressed through an Sp1-driven promoter in vivo. Arch. Biochem. Biophys., 377, 273283.
This article has been cited by other articles:
![]() |
R. Z. Stolzenberg-Solomon, R. Vieth, A. Azad, P. Pietinen, P. R. Taylor, J. Virtamo, and D. Albanes A Prospective Nested Case-Control Study of Vitamin D Status and Pancreatic Cancer Risk in Male Smokers Cancer Res., October 15, 2006; 66(20): 10213 - 10219. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Dempfle, S. A. Wudy, K. Saar, S. Hagemann, S. Friedel, A. Scherag, L. D. Berthold, G. Alzen, L. Gortner, W. F. Blum, et al. Evidence for involvement of the vitamin D receptor gene in idiopathic short stature via a genome-wide linkage study and subsequent association studies Hum. Mol. Genet., September 15, 2006; 15(18): 2772 - 2783. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






