Skip Navigation


Human Molecular Genetics Advance Access originally published online on October 19, 2005
Human Molecular Genetics 2005 14(23):3619-3628; doi:10.1093/hmg/ddi389
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
14/23/3619    most recent
ddi389v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (15)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tan, Z.
Right arrow Articles by Ober, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tan, Z.
Right arrow Articles by Ober, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Evidence of balancing selection at the HLA-G promoter region

Zheng Tan*, Andrew Minsoo Shon and Carole Ober

Department of Human Genetics, The University of Chicago, Chicago, IL, USA

* To whom correspondence should be addressed at: Department of Human Genetics, The University of Chicago, 920 East 58th Street, Room 501, Chicago, IL 60637, USA. Tel: +1 7737025898; Fax: +1 7738340505; Email: tzheng{at}genetics.uchicago.edu

Received August 15, 2005; Accepted October 12, 2005


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
HLA-G is a class Ib HLA gene with unique tissue expression pattern and immunomodulatory properties. Polymorphisms in the HLA-G promoter region have been associated with miscarriage and asthma, whereas expression levels have been associated with a wide range of pathologic conditions as well as survival of embryos after in vitro fertilization and of organs after transplantation. Here, we characterize the sequence variation and haplotype structure of the HLA-G promoter and flanking sequences in 44 African Americans, 47 European Americans and 43 Han Chinese by haplotype-specific PCR and sequencing. In all three populations, we observed high levels of nucleotide variation, an excess of intermediate-frequency alleles, and a genealogy with two common haplotypes separated by deep branches, features that are suggestive of balancing selection acting in this region. Comparisons to HLA-A and a pseudogene, HLA-J, suggested that the observed pattern of sequence variation in the HLA-G promoter region is not likely due to other selected HLA genes. We suggest that the mechanism for this selection is related to the highly regulated expression pattern of HLA-G and that high- and low-expressing promoters may be favored under temporally and/or spatially varying selective pressures.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The class I HLA genes are located at the telomeric end of the HLA complex on chromosome 6p21 and include both class Ia, HLA-A, -B and -C, and class Ib, HLA-E, -F and -G, genes (Fig. 1). The HLA class Ia and Ib genes differ with respect to polymorphism levels, tissue distribution and function. For example, the class Ia genes are among the most polymorphic human genes, whereas the class Ib have few (if any) variants (1Go). Expression of class Ia antigens is ubiquitous, whereas class Ib antigen expression is tissue/organ specific and/or conditional (HLA-F and -G) or dependent on expression of other class I genes (HLA-E). The primary function of the class Ia genes is antigen presentation (1Go), whereas the class Ib genes also serve novel functions, all of which are still unclear (2Go). HLA-G is additionally unique among class I genes because it undergoes alternative splicing. Seven alternatively spliced transcripts have been identified, four are predicted to encode membrane-bound proteins and three are predicted to encode soluble proteins. At least four of these splice forms (two membrane-bound and two soluble) are expressed as protein in fetal cells at the maternal–fetal interface, as demonstrated by immunohistochemistry (3Go–5Go).



View larger version (4K):
[in this window]
[in a new window]
 
Figure 1. Class I HLA genes. Class Ia HLA genes (open boxes), class Ib HLA genes (solid gray boxes) and pseudogenes (solid black boxes) are shown. Distances between genes, calculated according to UCSC human genome database (http://genome.ucsc.edu/cgi-bin/hgGateway), are shown on the horizontal bars. 

 
Moreover, because of its primary site of expression at the maternal–fetal interface, its limited polymorphism in the coding region and its ability to inhibit NK and T cells, HLA-G is thought to contribute to maternal tolerance of the allogeneic fetus (6Go–9Go). In fact, HLA-G alleles and mRNA and protein expression levels have been associated with pre-eclampsia, miscarriage and pregnancy success rates following in vitro fertilization (IVF), suggesting a crucial role for HLA-G in pregnancy (7Go,9Go). The immmuno-supressive functions of HLA-G have also been related to other clinical conditions. HLA-G expression was correlated with a decreased number of acute and chronic rejection episodes following heart transplantation (10Go) and acute rejection following combined liver–kidney transplantation (11Go). Viruses and tumors may up-regulate HLA-G to escape host immune attack (7Go,12Go), and HLA-G expression has been associated with asthma and bronchial hyper-responsiveness (13Go,14Go) and other pulmonary diseases (15Go), ulcerative colitis (16Go), psoriasis (17Go) and multiple sclerosis (18Go).

These combined observations suggest that the immunomodulatory properties of HLA-G may be important in immune-mediated conditions and that its expression is under tight regulation. In addition, the fact that high levels of expression appear to protect allogeneic tissues in pregnancy (and transplantation) but might contribute to pathogenicity in adult immune-mediated diseases further suggests that there might be a fine balance between optimal levels of expression from fetal to adult life. Not surprisingly, therefore, the 5'-upstream regulatory region of HLA-G, which includes all of the known promoter elements, is unique among the classical HLA genes (19Go). In particular, the response of the HLA-G promoter to a number of transcription factors differs both qualitatively and quantitatively from all other class I loci (20Go,21Go).

We recently characterized the sequence variation and haplotype structure of the HLA-G promoter region in a founder population with a restricted number of HLA haplotypes (22Go,23Go). In contrast to the modest level of variation in the coding region, the promoter of HLA-G was extraordinarily polymorphic, with 18 SNPs identified in the region approximately 1500 bp upstream of exon 1 (22Go,24Go). Most variants were quite common, and for some, the common allele was the derived allele on the basis of the chimpanzee sequence. These unusual features, combined with the associations with miscarriage (22Go) and asthma (13Go), led us to further investigate the evolutionary history of the HLA-G promoter. Here, we present evidence for selection maintaining two divergent lineages of promoter haplotypes in diverse human populations, consistent with a history of balancing selection.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Sequence variation, frequency spectrum and genetic differentiation of HLA-G promoter
We identified 27 SNPs and 13 haplotypes in the HLA-G promoter region in the African American (AA), European American (EA) and Chinese (CN) populations, using haplotype-specific PCR followed by direct sequencing (Fig. 2, Fig. 3). All of the haplotypes identified in Ober et al. except the G*010103-associated haplotype described in that earlier report (Materials and Methods) were present in these samples. In addition, nine SNPs and seven haplotypes identified here were not found in the previous study. Two haplotypes were present only in the AA sample (G*010301c and G*010301d), one haplotype was present only in the EA sample (G*010102b) and two haplotypes were present only in the CN sample (G*010101e and G*010401b). Lastly, one additional rare haplotype and a third allele (T) at position –725 was present in the Hutterites (G*010301b), but was missed in the earlier study (22Go). We include here for completeness an additional haplotype (G*010102c), defined by the presence of an A at –922, which was identified in two EA individuals with asthma but not in any of the 134 individuals included in the present study. This haplotype was not included in any of the analyses reported subsequently, except where noted.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 2. Haplotype-specific PCR of HLA-G promoter. Chimpanzee DNA was used as a positive control for the A-G haplotype; the G-A haplotype was artificially constructed by site-directed mutagenesis (see Materials and Methods for details).

 


View larger version (41K):
[in this window]
[in a new window]
 
Figure 3. HLA-G promoter polymorphisms and haplotypes. CN, Han Chinese. The haplotypes can be divided into two clades defined by either –1306G/+15G or –1306A/+15A. Alleles shown as black letters on a white background correspond to the chimp sequence and are presumed to be ancestral; alleles shown as white letters on a black background are presumed to be derived alleles, as in Ober et al. TATA, TATA box; CCAAT, CAAT box; S/X1, Pan HLA regulatory elements; ISRE, interferon-specific regulatory element; EnhA, enhancer A; HSE, heat-shock protein element; GAS, gamma (interferon) activated site; LCR, locus control region. Note: (+) G*010101a includes the 010101, 010108 and 010104 HLA-G alleles; (asterisk) G*10102a includes the 010102, 010103, 0105 N and 010601 HLA-G alleles; (caret) G*010102c was present in asthma patients only.

 
Nucleotide diversity ({pi}_it;) in the AA (0.0064), EA (0.0059) and CN (0.0059) samples was about eight times as high as the human genome average (0.00075) (25Go). Human–chimpanzee divergence at the HLA-G promoter is 1.4%, which is close to the average genome divergence of 1.24% (26Go), indicating that the mutation rate at the HLA-G promoter region is not unusual.

Under neutral evolution, polymorphism level is proportional to divergence level. An unusual ratio of diversity to divergence is suggestive of natural selection. We compared the ratio of nucleotide diversity to divergence (with chimpanzee as the outgroup) in the AA and EA samples to 132 human genes from the Seattle SNP database (27Go) (Fig. 4). Strikingly large values were obtained for HLA-G in the AA (0.50) and EA (0.46) samples that were almost twice as high as the largest values in the Seattle SNP genes in the two populations, reflecting the very high polymorphism level at this region.



View larger version (6K):
[in this window]
[in a new window]
 
Figure 4. Comparison of HLA-G and HLA-J with the Seattle SNP genes in the AA and EA. Values of HLA-G (closed circles) and HLA-J (open circles) are shown; the distributions of the Seattle data are shown by box plots. (A) Ratio of nucleotide diversity ({pi}_it;) to human–chimpanzee divergence using 132 Seattle SNP genes. (B) Tajima's D using 232 Seattle SNP genes.

 
We next examined the allele frequency distribution using Tajima's D-test to detect the signature of selection. This test is based on the fact that two measures of polymorphism, {pi}_it; and {theta}_it;W, are affected differently by selection and population history (28Go). Both balancing selection and population subdivision tend to produce an excess of old, intermediate-frequency variants. In these cases, {pi}_it; will be higher than {theta}_it;W and Tajima's D will be positive. In contrast, positive selection and population expansion will result in an excess of young, low frequency variants and Tajima's D will be negative. Under neutrality and population equilibrium, Tajima's D will be 0. At the HLA-G promoter, Tajima's D was high in all three populations: 2.56 in the AA (P<0.05), 1.80 in the EA (P<0.10) and 1.87 in the CN (P<0.10) samples. Because Tajima's test of significance assumes a constant population size, which is not a realistic assumption for human populations, we compared HLA-G with the empirical distribution of Tajima's D based on 232 human genes included in the Seattle SNP database to test for significance. In the AA samples, Tajima's D for HLA-G is higher than those of all the other genes; in the EA samples, Tajima's D for HLA-G is among the top 5% of the highest values, reflecting the excess of alleles at intermediate frequencies (>10%) at the HLA-G promoter region. The fact that Tajima's D was highly positive in three populations with different histories makes it unlikely that these results are due to demography. Rather, they suggest that balancing selection has influenced the patterning of variation in the HLA-G promoter region.

Fu and Li's D and F are additional tests of neutrality based on the frequency spectrum (29Go). Negative values of Fu and Li's D and F reflect an excess of young mutations, and positive values correspond to an excess of old mutations. Here, we used the orangutan as an outgroup because the greater divergence time results in more fixed differences between the two species (compared with chimp) and greater power to detect selection. Fu and Li's D and F were positive in the AA and EA samples and negative in the CN sample (Table 1). Both statistics were significant in the AA samples, but only the F-statistic reached statistical significance in the EA and CN samples (P<0.05). The negative values in the CN sample are due to the presence of proportionally more singletons (particularly those on the G*010301a promoter haplotype) in the CN sample and the greater sensitivity of this test to singletons than Tajima's D. Thus, Fu and Li's D statistics also suggest that the pattern of variation at the HLA-G promoter region shows significant departures from neutral expectations.


View this table:
[in this window]
[in a new window]
 
Table 1. Summary statistics of sequenced regions
 
Population genetic differentiation, quantified by FST, can also be used to detect the signature of natural selection. Geographically restricted directional selection may increase FST, whereas balancing or species-wide directional selection may cause a decrease in FST (30Go,31Go). FST among the three populations is 0.0028, much lower than the genome average of 0.123 among AAs, EAs and East Asians (30Go) and not significantly different from 0. This indicates that genetic differentiation at HLA-G promoter is extremely low and suggests a similar evolutionary history at this locus on the three major continents.

Haplotype structure and haplotype numbers of HLA-G promoter
The haplotype structure at the human HLA-G promoter, visualized by network, also supports a history of balancing selection at this region. The haplotype network patterns are overall quite similar in all three populations, in which the haplotypes are separated by long branch lengths into two clades (Fig. 5), corresponding to their genotypes at –1306 and +15 (Fig. 3). Each clade contains one common haplotype, G*010101a and 010102a, respectively, consistent with long-standing balancing selection preserving two lineages.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 5. Evolutionary relationship of HLA-G promoter haplotypes by reduced median network analysis. The G*010102c haplotype, which was only present in asthma patients, is included in this analysis. Each circle represents a different haplotype, with the size of the circle proportional to the frequency of the haplotype in the AAs (yellow), EAs (blue) and Han Chinese (red). Nucleotide differences between haplotypes are indicated on the branches of the network. The arrow shows where the orangutan haplotype joins the network.

 
Comparisons to a pseudogene HLA-J
The observed pattern of sequence variation in the HLA-G promoter region could be due to natural selection acting on the gene itself or due to neighboring HLA genes that are under strong balancing selection (32Go). For example, the pseudogene HLA-H, which is located less than 100 kb away from HLA-G (Fig. 1), has increased polymorphism levels due to genetic hitchhiking (33Go). To determine whether the pattern of variation that we observed in the HLA-G promoter region could be due to selection at the HLA-A locus, we sequenced the ‘promoter’ region of a pseudogene, HLA-J, in the same individuals from the three populations. HLA-J is 50 kb centrometric to HLA-A (Fig. 1) and probably shared a common ancestor with HLA-G (34Go). Both nucleotide diversity/divergence and Tajima's D at this region are higher than the genome averages when compared with the Seattle SNP data (Table 1 and Fig. 4), reflecting high background variation in the HLA region because of the presence of selected genes (33Go). However, they are still much lower than those observed for HLA-G. Interestingly, FST at HLA-J promoter is also very low (0.033) (Table 1).

We next compared the sequences at the HLA-G and HLA-J loci, using the HKA test, again with the orangutan as the outgroup (35Go). This test compares within-species polymorphism to between-species divergence of two loci. Under neutral evolution, polymorphism level within species is proportional to divergence level between species, both reflecting the mutation rate. If the relative polymorphism to divergence is different between a neutral locus and another locus, it is suggestive of the action of natural selection on the latter locus. Although the HKA tests between HLA-G and HLA-J are not significant (Table 2), in all three populations, HLA-G has more polymorphisms relative to divergence than HLA-J. This is consistent with the expectation for balancing selection, in which mutations accumulate on allelic lineages maintained by selection and increase the within-species polymorphism level. These results also further suggest that this region has had similar evolutionary histories in the three populations studied.


View this table:
[in this window]
[in a new window]
 
Table 2. HKA tests of HLA-G versus HLA-J, orangutan was used as the outgroup
 
Phylogenetic trees of HLA-A and HLA-G
In addition to comparing HLA-G to the pseudogene HLA-J, we also wanted to directly evaluate the possible influence of HLA-A on HLA-G. We used the HLA-A phylogenetic tree reported by Gu and Nei (36Go), which divides the HLA-A alleles into five clades, A-I to A-V, and constructed a phylogenetic tree for HLA-G, using the same method (Fig. 6). Consistent with the network tree (Fig. 5), the HLA-G phylogenetic tree also has two long branches representing the ‘G-G’ and the ‘A-A’ clades. We then used the previously reported HLA haplotype data in the Hutterites (23Go), which included HLA-A and HLA-G, to calculate the proportion of ‘G-G’ haplotypes and ‘A-A’ haplotypes that are in linkage with HLA-A alleles within each of the five HLA-A clades. The Hutterite HLA haplotypes and alleles are similar to those observed in the outbred Caucasians, although there are fewer of both present in this isolated population (Weitkamp and Ober). If the generation of the two deep branches of the HLA-G tree was due to the linkage disequilibrium between HLA-A and HLA-G, we would expect the HLA-G ‘G-G’ and ‘A-A’ clades to cluster within separate HLA-A clades. Contrary to this expectation, the HLA-G ‘G-G’ haplotypes are associated with four very divergent HLA-A clades and the ‘A-A’ haplotypes are associated with all five HLA-A clades. Therefore, balancing selection at the HLA-A locus was not likely to generate the pattern of diversity present at the HLA-G locus.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 6. Phylogenetic trees of HLA-A and HLA-G. (A) Phylogenetic tree of HLA-G. The ‘G-G’ haplotypes are shown in blue and the ‘A-A’ haplotypes are shown in red. (B) The HLA-A phylogeny was divided into five clades (A-I to A-V), modified from Gu and Nei (36Go). The horizontal bars show the frequencies of the different HLA-A clades in the Hutterites in whom the following alleles are present: A24 (clade A-I); A1, A3, A11, A30 (clade A-II); A31, A32, A33 (clade A-III); A26, A34 (clade A-IV); and A2 (clade A-V). The pie diagrams on the right indicate the proportions of the HLA-G ‘G-G’ haplotypes (blue) and ‘A-A’ haplotypes (red) that are on the same haplotype with the HLA-A alleles in each of the five clades in the Hutterites.

 
Population genetics analysis of chimpanzee MHC-G promoter
Because balancing selection favors more than one allele at a locus, none of the selected alleles will go to extinction or reach fixation. Therefore, balancing selection can maintain old mutations in the mutations. Sometimes, these mutations are sufficiently old to be shared among different species. These so-called ‘trans-species polymorphisms’ are common at HLA loci. For example, phylogenetic tree analyses show that some human HLA-DQB1 alleles are more similar to chimpanzee Patr-DQB1 alleles than to other human alleles (37Go). These clustering patterns of alleles suggest that they arose before the human and chimpanzee divergence.

To examine this possibility for HLA-G promoter haplotypes, we sequenced the MHC-G promoter region in 15 western chimpanzees (Pan troglodytes verus). None of the 27 sites that were polymorphic in humans was polymorphic in the western chimpanzees, suggesting that these polymorphisms are human specific and originated after human–chimpanzee speciation. We also analyzed the sequence variation pattern of the Patr-G promoter in the western chimpanzees. Unlike HLA-G, the Patr-G promoter sequence has little nucleotide diversity (0.00071) and a negative Tajima's D (–0.72) (Table 1), suggesting a different evolutionary history of this gene in western chimpanzees and in humans.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The best known examples of diversifying selection in the human genome are at the class Ia and class II HLA genes, which are characterized by extraordinary levels of polymorphisms in the amino acids that form the peptide-binding pocket (38Go). This selection is presumably driven by the antigen presenting function of MHC molecules, with either heterozygote advantage or frequency-dependent selection, or both, maintaining the unique genetic features of these genes (1Go,39Go). Balancing selection acting on the promoter of a class Ib HLA gene, or any HLA gene, has never been reported before.

The HLA-G promoter is unique among the HLA genes (19Go). Several of the cis-regulatory elements conserved in all other HLA genes are disrupted or deleted in HLA-G. For example, enhancer A, the SXY module and the interferon-stimulated regulatory element (ISRE) have acquired mutations that make them non-functional. As a result, HLA-G does not respond to NF-{kappa}B and class II trans-activator (CIITA) and is less responsive to IFN-{gamma} when compared with the other HLA genes. Moreover, whereas all known regulatory elements are contained within approximately 500 bp upstream of exon 1, the known HLA-G regulatory elements extend to nearly 1500 bp upstream of exon 1. Functional elements in this upstream region, such as a heat-shock element (40Go), an ISRE (41Go) and a tissue (trophoblast)-specific regulatory element (also referred to as ‘locus control region’) (42Go,43Go), likely regulate the expression pattern of this gene. Many of the polymorphisms in the 5'-upstream region either coincide with or are close to these regulatory elements (22Go). Thus, the evidence for balancing selection in the promoter region of HLA-G may be related to its unique expression pattern.

The studies reported here suggest that selection has maintained two allelic lineages at the HLA-G locus. It is tempting to speculate that these two allelic lineages may have different promoter activities. These differences could result in different spatio-temporal expression patterns that meet different immunologic needs and be tissue and/or development stage-specific. In particular, the competing needs of the feto-placental unit to inactivate maternal immune cells to ensure its survival, at the same time to maintain a sufficient number of immune competent maternal cells in the uterus to ward off infection, may have required a fine balance between high-expressing and low-expressing HLA-G haplotypes. During pregnancy, high-expressing haplotypes might be favored in the absence of infection, whereas low-expressing haplotypes might be favored in the presence of infection. Selection for high-expressing haplotypes in some circumstances is supported by observations of greater implantation rates after IVF of embryos that express HLA-G when compared with embryos that do not (44Go–46Go) and increased fetal loss rates among couples with recurrent miscarriage, who carry a null allele for the HLA-G1 and -G5 isoforms (47Go,48Go). In contrast, the high frequency of the null allele, called G*0105 N, in African populations and populations of African descent and the evidence for positive selection acting on this null allele raised the possibility that under some circumstances, reduced levels of HLA-G might be advantageous (47Go). Given the distribution of the null allele among populations with high pathogen load, we previously suggested that reduced expression levels of HLA-G might allow for a more robust maternal immune response against invading pathogens during pregnancy (47Go). Thus, among populations in environments with a high pathogen load, low-expressing haplotypes might be advantageous.

The recent discovery of the expression of HLA-G in adult cells, particularly in the presence of immune-mediated diseases (13Go,14Go,16Go,17Go), suggests other possible selection scenarios at this locus. At the maternal–fetal interface, the expression of HLA-G contributes to the skew toward Th2 cytokine-producing T cells in pregnancy (49Go–51Go). If HLA-G serves a similar function in the periphery, its expression might enhance the Th2 response against parasitic infections, but inhibit the important Th1 response against viral infections. This hypothesis is supported by recent reports of increased survival of transplanted tissues that express HLA-G because of decreased T cell-mediated cytotoxicity and of HLA-G expression in two Th2-associated diseases, asthma (13Go,14Go) and ulcerative colitis (16Go). Moreover, the fact that HLA-G can be up-regulated in peripheral cells by class I and class II interferons suggests that it could have unwarranted immunosuppressive effects in the presence of viral infections. Thus, it is possible that the need for both high-expressing and low-expressing HLA-G promoters in response to infection post-natally also contributes to the maintenance of two families of haplotypes at this locus.

Additionally, balancing selection of the HLA-G promoter region may be related to the different functions of HLA-G isoforms. Promoter activity can influence alternative splicing (52Go), making it possible that the different promoter sequences or activity levels influence the relative abundance of the different HLA-G isoforms. Perturbations of the relative abundance of alternatively spliced transcripts have been associated with pre-eclampsia (53Go,54Go), and there is tight regulation of the expression of the HLA-G isoforms in placental cells (3Go). However, because the functions of HLA-G and the mechanisms of its regulation are still largely unknown, more work is needed to elucidate the mechanism(s) underlying the balancing selection acting at this locus.

In conclusion, we observed strong evidence of balancing selection at the HLA-G promoter. In three major human populations, there are extraordinarily high levels of nucleotide variation. Population genetic statistics indicate a significant excess of intermediate frequency alleles, more polymorphism relative to divergence, negligible differentiation between populations representing three major continents and a genealogy with two deep clades. We ruled out another HLA locus as an explanation for these features and suggest that the genetic characteristics of the HLA-G promoter are consistent with an old balanced polymorphism maintaining two divergent promoter sequences in the human species.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
DNA samples
We included in these studies DNA from 44 AAs and 47 EAs who participated as controls in our studies of asthma in Chicago (55Go,56Go) and 43 Han Chinese from the International Hapmap Project (HAPMAPPT02 plate). The Chicago controls identified themselves as having at least three grandparents of either European ancestry or of AA ancestry. We also included DNA from one orangutan, one chimpanzee and one gorilla, used previously in our laboratory (33Go), and 15 western chimpanzees (Pan troglodytes verus) from Coriell Cell Repositories, repository numbers: NA03448, NA03450, NG06939, NG03489, NS03612, NS03622, NS03623, NS03639, NS03641, NS03646, NS03650, NS03656, NS03657, NS03659 and NS03660.

PCR and sequencing
Haplotype-specific PCR was used to amplify the promoter region of HLA-G. On the basis of a previous study in the Hutterites (22Go), HLA-G promoter haplotypes were divided into two groups. One group of haplotypes had a G at position –1306 at the distal end of the promoter and a G at position +15 in exon 1 (referred to as G-G haplotypes). All other haplotypes had an A at –1306 and an A at +15 (referred to as A-A haplotypes). We selected these two SNPs for a haplotype-specific PCR that amplifies the segment that included all the known regulatory element. Because we had not observed an A-G or G-A haplotype in any human samples, we used a chimpanzee sample as an A-G control and created by site-directed mutagenesis an artificial haplotype with a G at position –1306 and an A at position +15. All numbering is relative to the translation initiation site (ATG) in exon 1; the transcription start site begins at –20 (unpublished data).

We used two forward primers with the 3' ends corresponding to –1306G and –1306A, and two reverse primers with the 3' ends complementary to +15G and +15A. The primer sequences are: HLA-GAS-FW-G: aacagtgctagagccacag; HLA-GAS-RE-G: gaagagggttcggggc; HLA-GAS-FW-A: aacagtgctagagccacaa; HLA-GAS-RE-A: gaagagggttcggggt. The four combinations of primer pairs were used to amplify each sample, to identify four possible haplotype groups (Fig. 2). For samples that amplified with only one set of primers (either A-A or G-G) but had more than one heterozygous site in the sequence, we deduced their haplotypes using previously reported haplotypes (22Go) and haplotypes identified as part of these studies. Primers HLA-J-fw: ccttaagtgggtctgcttaaaaa and HLA-J-re: gtggacctttcgctcct were used to amplify –1122 to +128 (relative to the ‘translation’ start site) of the HLA-J pseudogene.

We sequenced exons 2, 3 and 4 in each human sample to determine the HLA-G allele and inferred associations of each allele with the promoter haplotypes from our previous studies (22Go). We named the promoter haplotype using the name of the HLA-G allele that was associated with each haplotype (such as G*010101, G*010401, etc.) and lettered consecutively (a, b, c, etc.) if there were more than one promoter haplotype associated with a particular HLA-G allele. If the same promoter haplotype was associated with more than one HLA-G allele, we used the name of the most common allele in that group. As in our previous report (22Go), the G*010101, G*010104, and G*010108 alleles had identical promoter sequences (all referred to as G*010101a here) and the G*010102a, G*010105 N and G*010106 alleles had identical promoters (all referred to as G*010102a here). However, since our previous report, we determined that the G*010103 promoter is also identical to the G*010102 group of promoters and include it within that group in this report.

PCR products were sequenced on a 3100 DNA sequencer (Applied Biosystems).

Data analysis
DNA polymorphisms were identified using Polyphred (57Go). Population genetic tests were performed using Dnasp (version 4.00.4) (58Go). Haplotype networks were constructed by using the median joining algorithm of the program Network 4.1.0.9 [EC] (http://www.fluxus-engineering.com) (59Go). A HLA-G phylogenetic tree was constructed by the neighbor-joining method (60Go), with the distance matrix computed by Kimura's two-parameter method (61Go) as implemented in the MEGA3 program (62Go). Sequence data for 24 AAs and 23 EAs, available from the Seattle SNP database (http://pga.gs.washington.edu), were used to generate empirical distributions of nucleotide diversity ({pi}_it;)/human–chimpanzee divergence (132 genes) and Tajima's D (232 genes) in each sample. The AA samples in the Seattle SNP data set were obtained from the African-American Panel (HD50AA) of the Human Variation Panel from the Coriell Institute; the EA samples were unrelated individuals from CEPH pedigrees. Similar to the Chicago samples used in this study, the Seattle SNP samples were assigned to racial groups by self-identification and likely belong to similar broadly defined pools of individuals. Furthermore, because the chimpanzee sequence was included in the Seattle SNP database, we used the chimpanzee as the outgroup for all comparisons between our data and the Seattle SNP data.


    ACKNOWLEDGEMENTS
 
The authors gratefully acknowledge Anna Di Rienzo and Molly Przeworski for helpful comments and discussion, Deborah Nickerson and Joshua Akey for providing Seattle SNP sequence data and Katinka Vigh and Jeffrey Goodenbour for technical assistance. This work was supported partly by NIH grants HD21244 and HL72414 to C.O. and MOI RR00055 to The University of Chicago General Clinical Research Center.

Conflicts of Interest statement. None declared.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Meyer, D. and Thomson, G. (2001) How selection shapes variation of the human major histocompatibility complex: a review. Ann. Hum. Genet., 65, 1–26.[CrossRef][Web of Science][Medline]

  2. O'Callaghan, C.A. and Bell, J.I. (1998) Structure and function of the human MHC class Ib molecules HLA-E, HLA-F and HLA-G. Immunol. Rev., 163, 129–138.[CrossRef][Web of Science][Medline]

  3. Morales, P.J., Pace, J.L., Platt, J.S., Phillips, T.A., Morgan, K., Fazleabas, A.T. and Hunt, J.S. (2003) Placental cell expression of HLA-G2 isoforms is limited to the invasive trophoblast phenotype. J. Immunol., 171, 6215–6224.[Abstract/Free Full Text]

  4. Ishitani, A. and Geraghty, D.E. (1992) Alternative splicing of HLA-G transcripts yields proteins with primary structures resembling both class I and class II antigens. Proc. Natl Acad. Sci. USA, 89, 3947–3951.[Abstract/Free Full Text]

  5. Fujii, T., Ishitani, A. and Geraghty, D.E. (1994) A soluble form of the HLA-G antigen is encoded by a messenger ribonucleic acid containing intron 4. J. Immunol., 153, 5516–5524.[Abstract]

  6. Hunt, J.S. and Orr, H.T. (1992) HLA and maternal–fetal recognition. FASEB J., 6, 2344–2348.[Abstract]

  7. LeMaoult, J., Le Discorde, M., Rouas-Freiss, N., Moreau, P., Menier, C., McCluskey, J. and Carosella, E.D. (2003) Biology and functions of human leukocyte antigen-G in health and sickness. Tissue Antigens, 62, 273–284.[CrossRef][Web of Science][Medline]

  8. Le Bouteiller, P., Legrand-Abravanel, F. and Solier, C. (2003) Soluble HLA-G1 at the materno-foetal interface—a review. Placenta, 24 (Suppl. A), S10–S15.

  9. Hunt, J.S., Petroff, M.G., McIntire, R.H. and Ober, C. (2005) HLA-G and immune tolerance in pregnancy. FASEB J., 19, 681–693.[Abstract/Free Full Text]

  10. Lila, N., Carpentier, A., Amrein, C., Khalil-Daher, I., Dausset, J. and Carosella, E.D. (2000) Implication of HLA-G molecule in heart-graft acceptance. Lancet, 355, 2138.[CrossRef][Web of Science][Medline]

  11. Creput, C., Le Friec, G., Bahri, R., Amiot, L., Charpentier, B., Carosella, E., Rouas-Freiss, N. and Durrbach, A. (2003) Detection of HLA-G in serum and graft biopsy associated with fewer acute rejections following combined liver–kidney transplantation: possible implications for monitoring patients. Hum. Immunol., 64, 1033–1038.[CrossRef][Web of Science][Medline]

  12. Wiendl, H., Mitsdoerffer, M., Hofmeister, V., Wischhusen, J., Bornemann, A., Meyermann, R., Weiss, E.H., Melms, A. and Weller, M. (2002) A functional role of HLA-G expression in human gliomas: an alternative strategy of immune escape. J. Immunol., 168, 4772–4780.[Abstract/Free Full Text]

  13. Nicolae, D., Cox, N.J., Lester, L.A., Schneider, D., Tan, Z., Billstrand, C., Kuldanek, S., Donfack, J., Kogut, P., Patel, N.M. et al. (2005) Fine mapping and positional candidate studies identify HLA-G as an asthma susceptibility gene on chromosome 6p21. Am. J. Hum. Genet., 76, 349–357.[CrossRef][Web of Science][Medline]

  14. Rizzo, R., Mapp, C.E., Melchiorri, L., Maestrelli, P., Visentin, A., Ferretti, S., Bononi, I., Miotto, D. and Baricordi, O.R. (2005) Defective production of soluble HLA-G molecules by peripheral blood monocytes in patients with asthma. J. Allergy Clin. Immunol., 115, 508–513.[CrossRef][Web of Science][Medline]

  15. Pangault, C., Le Friec, G., Caulet-Maugendre, S., Lena, H., Amiot, L., Guilloux, V., Onno, M. and Fauchet, R. (2002) Lung macrophages and dendritic cells express HLA-G molecules in pulmonary diseases. Hum. Immunol., 63, 83–90.[CrossRef][Web of Science][Medline]

  16. Torres, M.I., Le Discorde, M., Lorite, P., Rios, A., Gassull, M.A., Gil, A., Maldonado, J., Dausset, J. and Carosella, E.D. (2004) Expression of HLA-G in inflammatory bowel disease provides a potential way to distinguish between ulcerative colitis and Crohn's disease. Int. Immunol., 16, 579–583.[Abstract/Free Full Text]

  17. Aractingi, S., Briand, N., Le Danff, C., Viguier, M., Bachelez, H., Michel, L., Dubertret, L. and Carosella, E.D. (2001) HLA-G and NK receptor are expressed in psoriatic skin: a possible pathway for regulating infiltrating T cells? Am. J. Pathol., 159, 71–77.[Abstract/Free Full Text]

  18. Mitsdoerffer, M., Schreiner, B., Kieseier, B.C., Neuhaus, O., Dichgans, J., Hartung, H.P., Weller, M. and Wiendl, H. (2005) Monocyte-derived HLA-G acts as a strong inhibitor of autologous CD4 T cell activation and is upregulated by interferon-beta in vitro and in vivo: rationale for the therapy of multiple sclerosis. J. Neuroimmunol., 159, 155–164.[CrossRef][Web of Science][Medline]

  19. Solier, C., Mallet, V., Lenfant, F., Bertrand, A., Huchenq, A. and Le Bouteiller, P. (2001) HLA-G unique promoter region: functional implications. Immunogenetics, 53, 617–625.[CrossRef][Web of Science][Medline]

  20. Gobin, S.J., Keijsers, V., van Zutphen, M. and van den Elsen, P.J. (1998) The role of enhancer A in the locus-specific transactivation of classical and nonclassical HLA class I genes by nuclear factor kappa B. J. Immunol., 161, 2276–2283.[Abstract/Free Full Text]

  21. Gobin, S.J. and van den Elsen, P.J. (2000) Transcriptional regulation of the MHC class Ib genes HLA-E, HLA-F, and HLA-G. Hum. Immunol., 61, 1102–1107.[CrossRef][Web of Science][Medline]

  22. Ober, C., Aldrich, C.L., Chervoneva, I., Billstrand, C., Rahimov, F., Gray, H.L. and Hyslop, T. (2003) Variation in the HLA-G promoter region influences miscarriage rates. Am. J. Hum. Genet., 72, 1425–1435.[CrossRef][Web of Science][Medline]

  23. Weitkamp, L.R. and Ober, C. (1999) Ancestral and recombinant 16-locus HLA haplotypes in the Hutterites. Immunogenetics, 49, 491–497.[CrossRef][Web of Science][Medline]

  24. Hviid, T.V., Sorensen, S. and Morling, N. (1999) Polymorphism in the regulatory region located more than 1.1 kilobases 5' to the start site of transcription, the promoter region, and exon 1 of the HLA-G gene. Hum. Immunol., 60, 1237–1244.[CrossRef][Web of Science][Medline]

  25. Sachidanandam, R., Weissman, D., Schmidt, S.C., Kakol, J.M., Stein, L.D., Marth, G., Sherry, S., Mullikin, J.C., Mortimore, B.J., Willey, D.L. et al. (2001) A map of human genome sequence variation containing 1.42 million single nucleotide polymorphisms. Nature, 409, 928–933.[CrossRef][Medline]

  26. Ebersberger, I., Metzler, D., Schwarz, C. and Paabo, S. (2002) Genomewide comparison of DNA sequences between humans and chimpanzees. Am. J. Hum. Genet., 70, 1490–1497.[CrossRef][Web of Science][Medline]

  27. Akey, J.M., Eberle, M.A., Rieder, M.J., Carlson, C.S., Shriver, M.D., Nickerson, D.A. and Kruglyak, L. (2004) Population history and natural selection shape patterns of genetic variation in 132 genes. PLoS Biol., 2, e286.[CrossRef][Medline]

  28. Tajima, F. (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics, 123, 585–595.[Abstract/Free Full Text]

  29. Fu, Y.X. and Li, W.H. (1993) Statistical tests of neutrality of mutations. Genetics, 133, 693–709.[Abstract]

  30. Akey, J.M., Zhang, G., Zhang, K., Jin, L. and Shriver, M.D. (2002) Interrogating a high-density SNP map for signatures of natural selection. Genome Res., 12, 1805–1814.[Abstract/Free Full Text]

  31. Bowcock, A.M., Kidd, J.R., Mountain, J.L., Hebert, J.M., Carotenuto, L., Kidd, K.K. and Cavalli-Sforza, L.L. (1991) Drift, admixture, and selection in human evolution: a study with DNA polymorphisms. Proc. Natl Acad. Sci. USA, 88, 839–843.[Abstract/Free Full Text]

  32. Thomson, G. (1977) The effect of a selected locus on linked neutral loci. Genetics, 85, 753–788.[Abstract/Free Full Text]

  33. Grimsley, C., Mather, K.A. and Ober, C. (1998) HLA-H: a pseudogene with increased variation due to balancing selection at neighboring loci. Mol. Biol. Evol., 15, 1581–1588.[Abstract]

  34. Messer, G., Zemmour, J., Orr, H.T., Parham, P., Weiss, E.H. and Girdlestone, J. (1992) HLA-J, a second inactivated class I HLA gene related to HLA-G and HLA-A. Implications for the evolution of the HLA-A-related genes. J. Immunol., 148, 4043–4053.[Abstract]

  35. Hudson, R.R., Kreitman, M. and Aguade, M. (1987) A test of neutral molecular evolution based on nucleotide data. Genetics, 116, 153–159.[Abstract/Free Full Text]

  36. Gu, X. and Nei, M. (1999) Locus specificity of polymorphic alleles and evolution by a birth-and-death process in mammalian MHC genes. Mol. Biol. Evol., 16, 147–156.[Abstract]

  37. Hughes, A.L. and Yeager, M. (1998) Natural selection at major histocompatibility complex loci of vertebrates. Annu. Rev. Genet., 32, 415–435.[CrossRef][Web of Science][Medline]

  38. Hughes, A.L. and Nei, M. (1988) Pattern of nucleotide substitution at major histocompatibility complex class I loci reveals overdominant selection. Nature, 335, 167–170.[CrossRef][Medline]

  39. Takahata, N. and Nei, M. (1990) Allelic genealogy under overdominant and frequency-dependent selection and polymorphism of major histocompatibility complex loci. Genetics, 124, 967–978.[Abstract]

  40. Ibrahim, E.C., Morange, M., Dausset, J., Carosella, E.D. and Paul, P. (2000) Heat shock and arsenite induce expression of the nonclassical class I histocompatibility HLA-G gene in tumor cell lines. Cell Stress Chaperones, 5, 207–218.[CrossRef][Web of Science][Medline]

  41. Lefebvre, S., Berrih-Aknin, S., Adrian, F., Moreau, P., Poea, S., Gourand, L., Dausset, J., Carosella, E.D. and Paul, P. (2001) A specific interferon (IFN)-stimulated response element of the distal HLA-G promoter binds IFN-regulatory factor 1 and mediates enhancement of this nonclassical class I gene by IFN-beta. J. Biol. Chem., 276, 6133–6139.[Abstract/Free Full Text]

  42. Schmidt, C.M., Chen, H.L., Chiu, I., Ehlenfeldt, R.G., Hunt, J.S. and Orr, H.T. (1995) Temporal and spatial expression of HLA-G messenger RNA in extraembryonic tissues of transgenic mice. J. Immunol., 155, 619–629.[Abstract]

  43. Moreau, P., Paul, P., Gourand, L., Prost, S., Dausset, J., Carosella, E. and Kirszenbaum, M. (1997) HLA-G gene transcriptional regulation in trophoblasts and blood cells: differential binding of nuclear factors to a regulatory element located 1.1 kb from exon 1. Hum. Immunol., 52, 41–46.[CrossRef][Web of Science][Medline]

  44. Fuzzi, B., Rizzo, R., Criscuoli, L., Noci, I., Melchiorri, L., Scarselli, B., Bencini, E., Menicucci, A. and Baricordi, O.R. (2002) HLA-G expression in early embryos is a fundamental prerequisite for the obtainment of pregnancy. Eur. J. Immunol., 32, 311–315.[CrossRef][Web of Science][Medline]

  45. Noci, I., Fuzzi, B., Rizzo, R., Melchiorri, L., Criscuoli, L., Dabizzi, S., Biagiotti, R., Pellegrini, S., Menicucci, A. and Baricordi, O.R. (2005) Embryonic soluble HLA-G as a marker of developmental potential in embryos. Hum. Reprod., 20, 138–146.[Abstract/Free Full Text]

  46. Sher, G., Keskintepe, L., Nouriani, M., Roussev, R. and Batzofin, J. (2004) Expression of sHLA-G in supernatants of individually cultured 46-h embryos: a potentially valuable indicator of ‘embryo competency’ and IVF outcome. Reprod. Biomed. Online, 9, 74–78.[Web of Science][Medline]

  47. Aldrich, C.L., Stephenson, M.D., Karrison, T., Odem, R.R., Branch, D.W., Scott, J.R., Schreiber, J.R. and Ober, C. (2001) HLA-G genotypes and pregnancy outcome in couples with unexplained recurrent miscarriage. Mol. Hum. Reprod., 7, 1167–1172.[Abstract/Free Full Text]

  48. Pfeiffer, K.A., Fimmers, R., Engels, G., van der Ven, H. and van der Ven, K. (2001) The HLA-G genotype is potentially associated with idiopathic recurrent spontaneous abortion. Mol. Hum. Reprod., 7, 373–378.[Abstract/Free Full Text]

  49. Kanai, T., Fujii, T., Unno, N., Yamashita, T., Hyodo, H., Miki, A., Hamai, Y., Kozuma, S. and Taketani, Y. (2001) Human leukocyte antigen-G-expressing cells differently modulate the release of cytokines from mononuclear cells present in the decidua versus peripheral blood. Am. J. Reprod. Immunol., 45, 94–99.

  50. Kapasi, K., Albert, S.E., Yie, S., Zavazava, N. and Librach, C.L. (2000) HLA-G has a concentration-dependent effect on the generation of an allo-CTL response. Immunology, 101, 191–200.[CrossRef][Web of Science][Medline]

  51. Fujii, T., Hamai, Y., Kozuma, S., Miki, A., Yamashita, T., Hyodo, H., Unno, N. and Taketani, Y. (1999) Effects of sairei-to and tokishakuyaku-san on cytokine release from peripheral blood mononuclear cells upon recognition of HLA-G protein in the treatment of recurrent abortion. Methods Find. Exp. Clin. Pharmacol., 21, 261–264.[CrossRef][Web of Science][Medline]

  52. Cramer, P., Pesce, C.G., Baralle, F.E. and Kornblihtt, A.R. (1997) Functional association between promoter structure and transcript alternative splicing. Proc. Natl Acad. Sci. USA, 94, 11456–11460.[Abstract/Free Full Text]

  53. Emmer, P.M., Joosten, I., Schut, M.H., Zusterzeel, P.L., Hendriks, J.C. and Steegers, E.A. (2004) Shift in expression of HLA-G mRNA spliceforms in pregnancies complicated by preeclampsia. J. Soc. Gynecol. Invest., 11, 220–226.[Abstract/Free Full Text]

  54. O'Brien, M., McCarthy, T., Jenkins, D., Paul, P., Dausset, J., Carosella, E.D. and Moreau, P. (2001) Altered HLA-G transcription in pre-eclampsia is associated with allele specific inheritance: possible role of the HLA-G gene in susceptibility to the disease. Cell. Mol. Life Sci., 58, 1943–1949.[CrossRef][Web of Science][Medline]

  55. Donfack, J., Kogut, P., Forsythe, S., Solway, J. and Ober, C. (2003) Sequence variation in the promoter region of the cholinergic receptor muscarinic 3 gene and asthma and atopy. J. Allergy Clin. Immunol., 111, 527–532.[CrossRef][Web of Science][Medline]

  56. Weiss, L.A., Lester, L.A., Gern, J.E., Wolf, R.L., Parry, R., Lemanske, R.F., Solway, J. and Ober, C. (2005) Variation in ITGB3 is associated with asthma and sensitization to mold allergen in four populations. Am. J. Respir. Crit. Care Med., 172, 67–73.[Abstract/Free Full Text]

  57. Nickerson, D.A., Tobe, V.O. and Taylor, S.L. (1997) PolyPhred: automating the detection and genotyping of single nucleotide substitutions using fluorescence-based resequencing. Nucleic Acids Res., 25, 2745–2751.[Abstract/Free Full Text]

  58. Rozas, J., Sanchez-DelBarrio, J.C., Messeguer, X. and Rozas, R. (2003) DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics, 19, 2496–2497.[Abstract/Free Full Text]

  59. Bandelt, H.J., Forster, P., Sykes, B.C. and Richards, M.B. (1995) Mitochondrial portraits of human populations using median networks. Genetics, 141, 743–753.[Abstract]

  60. Saitou, N. and Nei, M. (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol., 4, 406–425.[Abstract]

  61. Kimura, M. (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol., 16, 111–120.[CrossRef][Web of Science][Medline]

  62. Kumar, S., Tamura, K. and Nei, M. (2004) MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform., 5, 150–163.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
LupusHome page
T. Veit, E. Cordero, T Mucenic, O. Monticielo, J. Brenol, R. Xavier, A Delgado-Canedo, and J. Chies
Association of the HLA-G 14 bp polymorphism with systemic lupus erythematosus
Lupus, April 1, 2009; 18(5): 424 - 430.
[Abstract] [PDF]


Home page
Mol Biol EvolHome page
T. Miyake, N. Takebayashi, and D. E. Wolf
Possible Diversifying Selection in the Imprinted Gene, MEDEA, in Arabidopsis
Mol. Biol. Evol., April 1, 2009; 26(4): 843 - 857.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. K. Kulski, A. Shigenari, T. Shiina, M. Ota, K. Hosomichi, I. James, and H. Inoko
Human Endogenous Retrovirus (HERVK9) Structural Polymorphism With Haplotypic HLA-A Allelic Associations
Genetics, September 1, 2008; 180(1): 445 - 457.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
P. Moreau, L. Contu, F. Alba, S. Lai, R. Simoes, S. Orru, C. Carcassi, M. Roger, M. Rabreau, and E. D. Carosella
HLA-G Gene Polymorphism in Human Placentas: Possible Association of G*0106 Allele with Preeclampsia and Miscarriage
Biol Reprod, September 1, 2008; 79(3): 459 - 467.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. A. Loisel, M. V. Rockman, G. A. Wray, J. Altmann, and S. C. Alberts
Ancient polymorphism and functional variation in the primate MHC-DQA1 5' cis-regulatory region
PNAS, October 31, 2006; 103(44): 16331 - 16336.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
C. Ober, C. Billstrand, S. Kuldanek, and Z. Tan
The miscarriage-associated HLA-G -725G allele influences transcription rates in JEG-3 cells
Hum. Reprod., July 1, 2006; 21(7): 1743 - 1748.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
14/23/3619    most recent
ddi389v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (15)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tan, Z.
Right arrow Articles by Ober, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tan, Z.
Right arrow Articles by Ober, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?