Skip Navigation


Human Molecular Genetics Advance Access originally published online on December 15, 2004
Human Molecular Genetics 2005 14(3):429-435; doi:10.1093/hmg/ddi039
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
14/3/429    most recent
ddi039v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (13)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Meikle, L.
Right arrow Articles by Kwiatkowski, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Meikle, L.
Right arrow Articles by Kwiatkowski, D. J.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, Vol. 14, No. 3 © Oxford University Press 2005; all rights reserved

A mouse model of cardiac rhabdomyoma generated by loss of Tsc1 in ventricular myocytes

Lynsey Meikle1,{dagger}, Julie R. McMullen2,{dagger}, Megan C. Sherwood3, Alan S. Lader1, Victoria Walker1, Jennifer A. Chan4 and David J. Kwiatkowski1,*

1Department of Medicine, Brigham and Women's Hospital and Harvard Medical School, Boston, MA 02115, USA, 2Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, MA 02215, USA, 3Department of Cardiology, Children's Hospital; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA and 4Division of Neuropathology, Department of Pathology, Brigham and Women's Hospital and Children's Hospital, Boston, MA 02115, USA

* To whom correspondence should be addressed at: Genetics Laboratory, Hematology, BWH, One Blackfan Circle, 6th Floor, Room 216, Boston, MA 02115, USA. Tel: +1 6173559005; Fax: +1 6173559016; Email: dk{at}rics.bwh.harvard.edu

Received September 24, 2004; Revised November 29, 2004; Accepted December 6, 2004


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS AND DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Tuberous sclerosis is a hamartoma syndrome due to mutations in TSC1 or TSC2 in which cardiac rhabdomyomas are seen in ~60% of patients. These lesions have an unusual natural history as they are usually most prominent immediately after birth and spontaneously resolve in most cases. To develop a mouse model of this lesion, we used a conditional, floxed allele of Tsc1 and a modified myosin light chain 2v allele in which cre recombinase expression occurs in ventricular myocytes. Mice with ventricular loss of Tsc1 had a median survival of 6 months and developed a dilated cardiomyopathy with the occurrence of scattered foci of enlarged ventricular myocytes. The enlarged cells were periodic acid-Schiff positive indicating the presence of excess glycogen and expressed elevated levels of phospho-S6, similar to findings in patient rhabdomyoma cells. The observations confirm that rhabdomyomas occur through a two hit mechanism of pathogenesis. However, the mice showed no evidence of fetal/neonatal demise, and there was no evidence of proliferation in the lesions. We propose that these differences are due to the timing of loss of Tsc1 in the ventricular myocytes and/or the truncated gestational period in the mouse compared with humans, during which progestational hormones may accentuate the growth of patient rhabdomyomas.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS AND DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Tuberous sclerosis (TSC) is an autosomal dominant disorder affecting ~1 in 6000–8000 individuals worldwide (1Go,2Go). The disease is characterized by the development of benign hamartomas in a number of organ systems and often has a prominent neurologic component due to the occurrence of CNS hamartomas that lead to epilepsy and developmental disorders.

Inactivating mutations in either of two genes have been detected in the majority of patients suffering from TSC: TSC1 on 9q34 which encodes the protein hamartin and TSC2 on 16p13 encoding the protein tuberin (3Go). Tuberin and hamartin are known to function as a complex which acts through the Rheb GTPase to inhibit activation of the mammalian target of rapamycin (mTOR) (4Go,5Go). Complete loss of either TSC1 or TSC2 has been demonstrated in a number of TSC hamartomas and occurs through somatic mutation or, more commonly, deletion (in the wild-type allele) of either TSC1 or TSC2, to complement the presence of a germline mutation in the same gene, following the two hit tumor suppressor gene paradigm (3Go). Loss of either tuberin or hamartin prevents formation of a functional tuberin–hamartin complex resulting in constitutive activation of mTOR and hyper phosphorylation of its downstream targets p70S6K1, p70S6K2 (the S6Ks) and 4E-BP1 (4Go,5Go). In cells lacking TSC1 or TSC2, phosphorylated, activated S6Ks result in elevated levels of phospho-S6 (pS6) and phosphorylated 4E-BP1 releases the translation factor eIF4E, and the net effect of these alterations is abnormal translational regulation contributing to cell growth and proliferation.

Cardiac rhabdomyomas are benign tumors which are the most common childhood tumor involving the heart (6Go). Cardiac rhabdomyomas are detected in ~60% of TSC patients and are often the first clinical manifestation of TSC (7Go–10Go). Nearly, all of these tumors are detected either antenatally or upon the first echocardiogram performed on an infant with TSC. Serial observations have demonstrated that the majority of these lesions become less prominent over time, with some disappearing altogether as assessed by ultrasound, so that surgical resection is performed only when they cause life-threatening complications. Pathologically, rhabdomyoma cells are aberrant glycogen-filled myocytes (6Go,11Go). Following routine histologic processing, loss of the glycogen leads to a distinctive appearance referred to as spider cells due to the radial arrangement of residual sarcoplasm extending out from the nucleus. Fifteen TSC cardiac rhabdomyomas have been examined at the molecular level and only four (27%) have shown evidence of loss of heterozygosity (LOH) in either TSC1 or TSC2, providing only limited support for the two hit models for their pathogenesis (12Go–16Go).

Two null alleles each have been developed for the murine Tsc1 and Tsc2 genes (17Go–20Go). Tsc1+/– and Tsc2+/– mice have normal cardiac structure and function and do not develop rhabdomyomas. Tsc1–/– and Tsc2–/– embryos die at embryonic day 10–13. These null embryos have cardiac enlargement which appears to be due to marked liver hypoplasia and hematopoietic failure (17Go,20Go).

Here, we report the use of a conditional allele of the Tsc1 gene in the mouse in combination with a cre recombinase allele expressed in ventricular myocytes to generate mice that are a model of TSC rhabdomyomas. We also show that rhabdomyomas express elevated levels of pS6, consistent with a two hit pathogenic mechanism.


   RESULTS AND DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
We generated mice with loss of Tsc1 in ventricular myocytes using a conditional allele of Tsc1 (Tsc1c) (17Go) and a modified myosin light chain 2 v allele expressing the cre recombinase (MLC2vcreKI) (21Go). Mice were generated primarily by breeding of Tsc1c/c and Tsc1c/+MLC2vcreKI+, yielding mice with genotypes: Tsc1c/cMLC2vcreKI+, Tsc1c/c, Tsc1c/+ MLC2vcreKI+ and Tsc1c/+. Mice of the latter three genotypes did not demonstrate any unusual cardiac pathology or premature mortality, as expected, and were collectively considered control littermates for these studies. Tsc1c/c mice have normal survival out through age 18 months with no tumor development and normal expression of hamartin. This allele is converted into a null Tsc1 allele following recombination induced by cre, which leads to loss of exons 17 and 18 (17Go). The MLC2vcreKI allele has been shown to lead to recombination of floxed alleles in the majority of ventricular myocytes, with some recombination in slow skeletal muscle, but none elsewhere (21Go).

Using this breeding strategy, we generated cohorts of Tsc1c/cMLC2vcreKI+ and control mice. From birth to age 3 months, Tsc1c/cMLC2vcreKI+ mice had normal development with normal weight gain and grossly normal behavior including breeding success. However, their median survival was 6 months, and none survived past 8 months of age, in contrast to controls (Fig. 1A, P=0.0002). There did not appear to be a difference in survival according to sex (male median 6 m, female median 7 m). Death typically occurred following a prodrome of reduced activity and labored respiration that lasted 3–5 days. Necropsy examination showed evidence of a dilated cardiomyopathy, with heart enlargement and pulmonary congestion in all mice, and the presence of thrombus in the left atrium in some. There were no abnormalities in other organ systems, and in particular no renal or liver tumors, which are commonly seen in Tsc1+/– mice (17Go). Pathologic examination showed the focal appearance of enlarged cardiac myocytes with apparent vacuoles. More detailed studies were carried out on Tsc1c/cMLC2vcreKI+ and control mice at defined ages.



View larger version (31K):
[in this window]
[in a new window]
  		Figure 1. Survival and analysis of Tsc1c/cMLC2vcreKI+ mice. (A) Kaplan–Meier cumulative survival plot of Tsc1c/cMLC2vcreKI+ mice (n=9) and a littermate control population (n=11) with a variety of genotypes (see text) (P=0.0002). (B) Representative northern blot analysis of heart RNA from mice at 2–3 months of age, with five control genotypes and one Tsc1c/cMLC2vcreKl+ (left panel). Equal loading of RNA was verified by reprobing the membrane with GAPDH. Quantitative analysis of northern blots (right panel). Mean values for Tsc1+/+MLC2vcreKl– were normalized to 1 and N=3 in each group. Values represent mean ±SEM. *P<0.05 compared with all other genotypes. Note the markedly increased expression of ANP and ß-MHC in the Tsc1c/cMLC2vcreKI+ samples. (C) Immunoblot analysis of heart lysates and cultured neonatal ventricular myocyte lysates from Tsc1c/cMLC2vcreKI+ mice and littermate controls. Note the markedly increased expression of pS6 in the Tsc1c/cMLC2vcreKI+ samples. (D) PCR genotype analysis of DNA samples from Tsc1c/cMLC2vcreKI+ mice and littermate controls. Note that there is conversion of ~25% of the c allele to the null allele in the heart sample from the Tsc1c/cMLC2vcreKI+ mouse. Molecular weight standards are at left. Murine embryo fibroblast (MEF) DNA samples were used as controls.

 
Echocardiographic analysis of 2- to 3-month-old Tsc1c/cMLC2vcreKI+ mice showed clear evidence of a dilated cardiomyopathy with a significant increase in LV end-diastolic diameter (4.2±0.2 mm) and LV end-systolic diameter (3.0±0.4 mm), and a reduction in fractional shortening (FS) (29±4%) in comparison with control mice with a variety of genotypes (Table 1). Necropsy analysis at this same age also showed an increase in heart weight, heart/body weight ratio and heart weight/tibial length ratio, which was highly significant in comparison with these measures for the several sets of control mice (Table 2). The heart/body weight ratio difference was the largest among these comparisons, ranging from a 14 to 29% increase in comparison with mice with control genotypes and P values ranging from 0.00005 to 0.01 (Table 2). These observations are also consistent with a dilated cardiomyopathy leading to cardiac failure in Tsc1c/cMLC2vcreKI+ mice. To confirm these findings, we also assessed the expression of two fetal genes: atrial natriuretic peptide (ANP) and ß-myosin heavy chain (ß-MHC). These genes are normally expressed in the embryonic and neonatal heart and are re-expressed in the stressed heart. Expression of both ANP and MHC was found to be significantly elevated in Tsc1c/cMLC2vcreKI+ mice at 2–3 months of age in comparison with several controls as assessed by northern blot (Fig. 1B).


View this table:
[in this window]
[in a new window]
  		Table 1. Echocardiographic analysis of mice at 2–3 months of age
 

View this table:
[in this window]
[in a new window]
  		Table 2. Postmortem analysis of mice at 2–3 months of age
 
Histologic studies at 2 and 5 months of age revealed scattered intramural foci of enlarged cells in the ventricles of Tsc1c/cMLC2vcreKI+ mice (Fig. 2A and B, top rows). The majority of the enlarged cells contained vacuoles which appeared to contribute to this enlargement. The periodic acid-schiff (PAS) stain was positive in these enlarged abnormal cells (Fig. 2A and B, middle row) indicating the presence of excess glycogen. Similar but more extensive findings were seen in the analysis of rhabdomyomas derived from TSC patients, with extensive clear spaces due to loss of glycogen deposits during processing and marked PAS positivity.




View larger version (243K):
[in this window]
[in a new window]
  		Figure 2. Pathology and pS6 expression in the Tsc1c/cMLC2vcreKI+ mouse heart and a rhabdomyoma: (A) low power and (B) high power views. Note the focal strong positivity for the PAS stain (middle panels) and pS6 (lower panels) in the Tsc1c/cMLC2vcreKI+ heart sections and more global strong PAS and pS6 positivity in the rhabdomyoma sections.

 
To confirm that recombination at the Tsc1 locus had occurred in the ventricular myocytes of Tsc1c/cMLC2vcreKI+ mice, several studies were performed. One hallmark of cells lacking either Tsc1 or Tsc2 is high-level expression of pS6 (4Go,17Go). Immunohistochemical analysis of cardiac sections showed the presence of increased amounts of pS6 specifically in the enlarged cells (Fig. 2, bottom row). Similarly TSC cardiac rhabdomyomas also showed elevated levels of pS6 expression (Fig. 2, bottom right). Elevated levels of pS6 were also seen by immunoblotting of lysates prepared directly from Tsc1c/cMLC2vcreKI+ heart and from cultured Tsc1c/cMLC2vcreKI+ cardiac myocytes in comparison with controls (Fig. 1C). In addition, both Southern blot and PCR analyses showed evidence of conversion of the Tsc1c allele to the Tsc1– allele (Fig. 1D). This non-quantitative analysis suggested that ~25% of the cells contributing DNA to the analysis had undergone recombination, consistent both with previous reports on the efficiency of the MLC2vcreKI+ allele at inducing recombination of loxP-targetted genes (21Go) and with the proportion of enlarged PAS+, pS6+ cells seen in histologic studies.

Rhabdomyomas are distinctive cardiac tumors, with an unusual natural history, and are common in TSC but also occur as single lesions in non-TSC patients (6Go,8Go–10Go,22Go–25Go). Their prominence in the prenatal and immediate postnatal period, followed by spontaneous regression in most cases, have been characterized in multiple detailed clinical studies utilizing ultrasonography as an assessment tool. The mechanism of this regression is completely unknown as the lesions cannot be sampled serially during this process. A relationship between their growth pattern and exposure of the fetus to high levels of maternal progestational hormones followed by abrupt withdrawal at birth seems possible. This hypothesis is supported by the observation that female sex hormone signaling plays an important role in the development of lymphangioleiomyomatosis, another TSC-associated lesion (26Go,27Go). The molecular basis of the development of rhabdomyomas is also uncertain, as only four of 15 (27%) rhabdomyomas studied have shown LOH for markers near TSC1 or TSC2, casting doubt on a two hit mechanism of pathogenesis (12Go–16Go). Here, we demonstrate that each of two patient rhabdomyomas studied shows high-level expression of pS6, a marker for mTOR activation seen consistently in a variety of other TSC-related lesions, most of which have been shown to follow a two hit pathogenic mechanism (3Go,28Go–30Go).

The mouse model presented here in which Tsc1 is inactivated selectively in a proportion of cardiac myocytes has a number of similarities to cardiac rhabdomyomas, providing further evidence for a two hit mechanism of rhabdomyoma pathogenesis. In both pathologic lesions, there are cell size enlargement, accumulation of glycogen, accumulation of pS6 reflecting mTOR activation, and physiological dysfunction, reflected in the cardiomyopathy seen in the Tsc1c/cMLC2vcreKI+ mice. In addition, several TSC patients have been described in which intraventricular rhabdomyoma caused a clinical picture of cardiomyopathy (6Go,31Go,32Go).

However, there are also major differences between this mouse model and the usual presentation of rhabdomyomas. There was no evidence that proliferative cardiac tumors developed in the Tsc1c/cMLC2vcreKI+ mice based on analyses of cardiac sections at ages 1–6 months, in contrast to the proliferative nature of the rhabdomyomas that occur in TSC. In addition, there was no evidence of fetal or early postnatal wastage, as genotype ratios among the pups were Mendelian (data not shown). This is despite relatively high-level recombination at embryonic day 8.5 in ventricular myocytes (21Go), in theory providing ample opportunity for tumor development.

We consider two possibilities to explain this difference in biologic behavior. The first is that expression of the cre recombinase is limited to ventricular precursors and definitive ventricular tissue in the modified MLC2vcreKI allele (21Go). Although the timing of cre recombinase expression is relatively early (E8.5), actual recombination within the Tsc1 allele and effective loss of Tsc1 protein within these cells may be delayed by up to several days, permitting progression of differentiation and loss of proliferative capacity that is characteristic of ventricular myocytes. Furthermore, it is possible that the cells in which second hit events occur in TSC patients leading to rhabdomyomas are not those already committed to the ventricular lineage, but rather are cardiac progenitor cells with an intrinsically higher proliferation potential.

A second potential explanation for this difference in biologic behavior is the accelerated gestational period in the mouse in comparison with humans, which leads to a much shorter period of exposure to high-level gestational hormones. Following the hypothesis stated earlier that gestational hormone exposure is critical for the growth of patient rhabdomyomas, this markedly reduced exposure in the mouse might account for the reduced growth potential of the cells in which recombination and loss of Tsc1 occur.

The observation that glycogen accumulation occurs in both patient rhabdomyomas and Tsc1c/cMLC2vcreKI+ ventricular myocytes indicates that loss of the Tsc1/Tsc2 complex has effects on myocyte cellular metabolism. Although activation of mTOR is the major direct effect of Tsc1/Tsc2 loss, recent studies have highlighted an important feedback effect such that Tsc1/Tsc2 loss leads to relative inactivation of Akt (33Go–35Go). As Akt is the major kinase which regulates the activity of GSK-3, which in turn regulates glycogen synthase activity and therefore glycogen synthesis (36Go), it is possible that reduced Akt activity in Tsc1 null cardiac myocytes leads to enhanced glycogen synthesis and the glycogen overload seen here. However, further study of glycogen metabolism in Tsc1 null myocytes is required to explore the mechanism of these observations in detail. It is notable that a transgenic mouse overexpressing an activated allele of PRKAG2, the gamma subunit of AMP-activated protein kinase (AMPK), in the heart develops cardiac glycogen storage overload along with a hypertrophic cardiomyopathy that progresses to a dilated cardiomyopathy (37Go). AMPK acts in the same pathway as Tsc1/Tsc2, and it is possible that a common mechanism explains the glycogen storage defect in the two models and in rhabdomyoma.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Mice bearing the Tsc1c (17Go) and those bearing the MLC2vcreKI allele (21Go) were interbred to generate a colony of mice with a range of genotypes. The main breeding to generate affected and control mice was between Tsc1c/c and Tsc1c/+MLC2vcreKI+ mice. Other matings within the same colony (e.g. Tsc1c/+xTsc1c/+MLC2vcreKI+) were also performed to generate additional controls including wild-type and Tsc1+/+MLC2vcreKI+. All animal experimentation was conducted in accordance with the Guide for the Humane Use and Care of Laboratory Animals. These studies were approved by the Harvard Medical Area Standing Committee on Animals. Mice were euthanized and weighed prior to dissection. The heart was immediately removed and placed in phosphate buffered saline to remove excess blood. Connective tissue and fat were carefully dissected, and the heart was gently blotted dry on gauze and weighed. The lungs were also dissected, gently blotted dry and weighed. Tibia was dissected after digestion in 1 M NaOH and measured using high-precision vernier calipers.

PCR genotyping of the conditional and null alleles of Tsc1 was performed using the following primers: F4536 AGGAGGCCTCTTCTGCTACC, R4830 CAGCTCCGACCATGAAGTG, and R6548 TGGGTCCTGACCTATCTCCTA. When used simultaneously in a PCR reaction, amplification products are of size 295 for a wild-type allele, 486 for a conditional allele and 368 for a null allele. Tail and paw snips were used to prepare DNA for PCR analysis. The presence of the MLC2vcreKI allele was assessed by amplification of the cre recombinase sequence using universal cre primer sequences.

Pathological studies on mice were done according to routine methods following fixation in 4% paraformaldehyde, with PAS staining performed by the DFHCC Rodent HistoPathology Core Laboratory. All mouse pathologies were reviewed by Roderick Bronson, director of that facility. Immunohistochemistry was performed on 5 µm paraffin-embedded tissue sections that were deparaffinized in xylene and rehydrated in an ethanol/water series. Sections were stained by the peroxidase method (goat ImmunoCruz staining kits—Santa Cruz Biotechnology) using a primary antibody against pS6 (Ser235/236, Cell Signaling Technology) and counterstained with hematoxylin (38Go). Images were captured on a Nikon Eclipse E400 microscope with Spot version 4.0.5 software.

Echocardiographic assessment of mice was performed as described previously using a Philips Sonos 5500 sector scanner equipped with a 15 MHz linear-array transducer (model 21390A) (39Go). Measurements were made according to the leading-edge method of the American Society of Echocardiography (40Go). All images and measurements were obtained by an echocardiographer who was blinded to the genotype of the mice. FS was calculated from the equation: FS=(LVEDD–LVESD)/LVEDD, where LVEDD is the left ventricular end-diastolic diameter and LVESD is the left ventricular end-systolic diameter.

Immunoblot analyses were performed as described (17Go). Heart muscle extracts were prepared by lysis in 60 mM Tris–HCl pH 6.8, 2% SDS, 10% glycerol and 100 mM DTT. Primary cultures of neonatal mouse cardiac myocytes were prepared using a commercial kit (Worthington) as described (41Go). Immunoblot analyses of these cells were performed between 1 and 5 days after initiation of culture.

For northern blot analysis, total RNA from ventricles was isolated from 2- to 3-month-old mice using TRIzol Reagent (Life Technologies). Ten micrograms of RNA was separated by agarose gel electrophoresis, blotted and probed with 32P-labelled probes following standard methods. cDNA probes for mouse ANP, GAPDH and rat ß-MHC were described previously (42Go).

Formalin-fixed, paraffin-embedded rhabdomyoma specimens (n=2, ages 1 and 9 months) were retrieved from the pathology archives at Children's Hospital, Boston. For each case, hematoxylin and eosin-stained slides were reviewed to confirm the diagnosis. These children were not subjected to a full TSC diagnostic evaluation but did not meet diagnostic criteria for TSC. Tissues were used in accordance with the policies of the institutional review board.

Kaplan–Meier cumulative survival plots were calculated using Prism version 4 (GraphPad Software, Inc.) and comparisons made using the log-rank (Mantel-Cox) test. The unpaired t-test was performed with two tails to assess differences among cardiac measures in mice of different genotypes. Data are presented as mean ± SEM.


   ACKNOWLEDGEMENTS
 
We thank Rod Bronson and the DFHCC Rodent HistoPathology Core Laboratory for assistance with pathology stains and interpretation. We thank Ken Chien for provision of mice with the MLC2vcreKI allele, Adam L. Dorfman for assistance with echocardiography, Li Zhang for technical assistance, Seigo Izumo for support and Serguisz Jozwiak for discussions on the natural history of rhabdomyomas. Supported by NIH grants NS31535, NS24279 and HL65742.


   FOOTNOTES
 
{dagger} The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors. Back


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS AND DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Osborne, J.P., Fryer, A. and Webb, D. (1991) Epidemiology of tuberous sclerosis. Ann. NY Acad. Sci., 615, 125–127.[Medline]

  2. Gomez, M., Sampson, J. and Whittemore, V. (eds) (1999) The Tuberous Sclerosis Complex, 3rd edn. Oxford University Press, Oxford, England.

  3. Cheadle, J.P., Reeve, M.P., Sampson, J.R. and Kwiatkowski, D.J. (2000) Molecular genetic advances in tuberous sclerosis. Hum. Genet., 107, 97–114.[CrossRef][ISI][Medline]

  4. Kwiatkowski, D.J. (2003) Rhebbing up mTOR: new insights on TSC1 and TSC2 and the pathogenesis of tuberous sclerosis. Cancer Biol. Ther., 2, 471–476.[ISI][Medline]

  5. Fingar, D.C. and Blenis, J. (2004) Target of rapamycin (TOR): an integrator of nutrient and growth factor signals and coordinator of cell growth and cell cycle progression. Oncogene, 23, 3151–3171.[CrossRef][ISI][Medline]

  6. Mair, D.D., Edwards, W.D. and Seward, J.B. (1999) Cardiac manifestations. In Gomez, M.R., Sampson, J.R. and Whittemore, V.H. (eds), Tuberous Sclerosis Complex. Oxford University Press, Oxford, pp. 194–206.

  7. Jozwiak, S., Schwartz, R.A., Janniger, C.K. and Bielicka-Cymerman, J. (2000) Usefulness of diagnostic criteria of tuberous sclerosis complex in pediatric patients. J. Child Neurol., 15, 652–659.[ISI][Medline]

  8. DiMario, F.J., Jr, Diana, D., Leopold, H. and Chameides, L. (1996) Evolution of cardiac rhabdomyoma in tuberous sclerosis complex. Clin. Pediatr. (Phila), 35, 615–619.[Abstract/Free Full Text]

  9. Watson, G.H. (1991) Cardiac rhabdomyomas in tuberous sclerosis. Ann. NY Acad. Sci., 615, 50–57.[Abstract]

  10. Smythe, J.F., Dyck, J.D., Smallhorn, J.F. and Freedom, R.M. (1990) Natural history of cardiac rhabdomyoma in infancy and childhood. Am. J. Cardiol., 66, 1247–1249.[CrossRef][ISI][Medline]

  11. Fenoglio, J.J., Jr, McAllister, H.A., Jr and Ferrans, V.J. (1976) Cardiac rhabdomyoma: a clinicopathologic and electron microscopic study. Am. J. Cardiol., 38, 241–251.[CrossRef][ISI][Medline]

  12. Carbonara, C., Longa, L., Grosso, E., Mazzucco, G., Borrone, C., Garre, M.L., Brisigotti, M., Filippi, G., Scabar, A., Giannotti, A. et al. (1996) Apparent preferential loss of heterozygosity at TSC2 over TSC1 chromosomal region in tuberous sclerosis hamartomas. Genes Chromosomes Cancer, 15, 18–25.[CrossRef][ISI][Medline]

  13. Henske, E.P., Scheithauer, B.W., Short, M.P., Wollmann, R., Nahmias, J., Hornigold, N., van Slegtenhorst, M., Welsh, C.T. and Kwiatkowski, D.J. (1996) Allelic loss is frequent in tuberous sclerosis kidney lesions but rare in brain lesions. Am. J. Hum. Genet., 59, 400–406.[ISI][Medline]

  14. Niida, Y., Stemmer-Rachamimov, A.O., Logrip, M., Tapon, D., Perez, R., Kwiatkowski, D.J., Sims, K., MacCollin, M., Louis, D.N. and Ramesh, V. (2001) Survey of somatic mutations in tuberous sclerosis complex (TSC) hamartomas suggests different genetic mechanisms for pathogenesis of TSC lesions. Am. J. Hum. Genet., 69, 493–503.[CrossRef][ISI][Medline]

  15. Green, A.J., Smith, M. and Yates, J.R. (1994) Loss of heterozygosity on chromosome 16p13.3 in hamartomas from tuberous sclerosis patients. Nat. Genet., 6, 193–196.[CrossRef][ISI][Medline]

  16. Sepp, T., Yates, J.R.W. and Green, A.J. (1996) Loss of heterozygosity in tuberous sclerosis hamartomas. J. Med. Genet., 33, 962–964.[Abstract]

  17. Kwiatkowski, D.J., Zhang, H., Bandura, J.L., Heiberger, K.M., Glogauer, M., el-Hashemite, N. and Onda, H. (2002) A mouse model of TSC1 reveals sex-dependent lethality from liver hemangiomas, and up-regulation of p70S6 kinase activity in Tsc1 null cells. Hum. Mol. Genet., 11, 525–534.[Abstract/Free Full Text]

  18. Kobayashi, T., Minowa, O., Sugitani, Y., Takai, S., Mitani, H., Kobayashi, E., Noda, T. and Hino, O. (2001) A germ-line Tsc1 mutation causes tumor development and embryonic lethality that are similar, but not identical to, those caused by Tsc2 mutation in mice. Proc. Natl Acad. Sci. USA, 98, 8762–8767.[Abstract/Free Full Text]

  19. Kobayashi, T., Minowa, O., Kuno, J., Mitani, H., Hino, O. and Noda, T. (1999) Renal carcinogenesis, hepatic hemangiomatosis, and embryonic lethality caused by a germ-line Tsc2 mutation in mice. Cancer Res., 59, 1206–1211.[Abstract/Free Full Text]

  20. Onda, H., Lueck, A., Marks, P.W., Warren, H.B. and Kwiatkowski, D.J. (1999) Tsc2(+/–) mice develop tumors in multiple sites that express gelsolin and are influenced by genetic background. J. Clin. Invest., 104, 687–695.[ISI][Medline]

  21. Chen, J., Kubalak, S.W. and Chien, K.R. (1998) Ventricular muscle-restricted targeting of the RXRalpha gene reveals a non-cell-autonomous requirement in cardiac chamber morphogenesis. Development, 125, 1943–1949.[Abstract]

  22. Bader, R.S., Chitayat, D., Kelly, E., Ryan, G., Smallhorn, J.F., Toi, A. and Hornberger, L.K. (2003) Fetal rhabdomyoma: prenatal diagnosis, clinical outcome, and incidence of associated tuberous sclerosis complex. J. Pediatr., 143, 620–624.[CrossRef][ISI][Medline]

  23. Nir, A., Tajik, A.J., Freeman, W.K., Seward, J.B., Offord, K.P., Edwards, W.D., Mair, D.D. and Gomez, M.R. (1995) Tuberous sclerosis and cardiac rhabdomyoma. Am. J. Cardiol., 76, 419–421.[CrossRef][ISI][Medline]

  24. Smith, H.C., Watson, G.H., Patel, R.G. and Super, M. (1989) Cardiac rhabdomyomata in tuberous sclerosis: their course and diagnostic value. Arch. Dis. Child., 64, 196–200.[Abstract]

  25. Webb, D., Thomas, R.D. and Osborne, J. (1993) Cardiac rhabdomyomas and their association with tuberous sclerosis. Arch. Dis. Child., 68, 367–370.[Abstract]

  26. Johnson, S.R. and Tattersfield, A.E. (2000) Clinical experience of lymphangioleiomyomatosis in the UK. Thorax, 55, 1052–1057.[Abstract/Free Full Text]

  27. Hancock, E., Tomkins, S., Sampson, J. and Osborne, J. (2002) Lymphangioleiomyomatosis and tuberous sclerosis. Respir. Med., 96, 7–13.[CrossRef][ISI][Medline]

  28. Goncharova, E.A., Goncharov, D.A., Eszterhas, A., Hunter, D.S., Glassberg, M.K., Yeung, R.S., Walker, C.L., Noonan, D., Kwiatkowski, D.J., Chou, M.M. et al. (2002) Tuberin regulates p70 S6 kinase activation and ribosomal protein S6 phosphorylation: a role for the TSC2 tumor suppressor gene in pulmonary lymphangioleiomyomatosis (LAM). J. Biol. Chem., 277, 30958–30967.[Abstract/Free Full Text]

  29. El-Hashemite, N., Zhang, H., Henske, E.P. and Kwiatkowski, D.J. (2003) Mutation in TSC2 and activation of mammalian target of rapamycin signalling pathway in renal angiomyolipoma. Lancet, 361, 1348–1349.[CrossRef][ISI][Medline]

  30. Karbowniczek, M., Yu, J. and Henske, E.P. (2003) Renal angiomyolipomas from patients with sporadic lymphangiomyomatosis contain both neoplastic and non-neoplastic vascular structures. Am. J. Pathol., 162, 491–500.[Abstract/Free Full Text]

  31. Jozwiak, S. (2003) Cardiac and vascular Involvement. In Curatolo, P. (ed.), Tuberous Sclerosis Complex: From Basic Science to Clinical Phenotypes. Mac Keith Press, London.

  32. See, J.S., Shen, E.Y., Chiu, N.C., Ho, C.S., Lee, Y.L., Chen, M.R. and Tsai, J.D. (1999) Tuberous sclerosis with visceral organ involvement. Acta Paediatr. Taiwan, 40, 305–308.[Medline]

  33. Zhang, H., Cicchetti, G., Onda, H., Koon, H.B., Asrican, K., Bajraszewski, N., Vazquez, F., Carpenter, C.L. and Kwiatkowski, D.J. (2003) Loss of Tsc1/Tsc2 activates mTOR and disrupts PI3K-Akt signaling through downregulation of PDGFR. J. Clin. Invest., 112, 1223–1233.[CrossRef][ISI][Medline]

  34. Harrington, L.S., Findlay, G.M., Gray, A., Tolkacheva, T., Wigfield, S., Rebholz, H., Barnett, J., Leslie, N.R., Cheng, S., Shepherd, P.R. et al. (2004) The TSC1–2 tumor suppressor controls insulin-PI3K signaling via regulation of IRS proteins. J. Cell Biol., 166, 213–223.[Abstract/Free Full Text]

  35. Shah, O.J., Wang, Z. and Hunter, T. (2004) Inappropriate activation of the TSC/Rheb/mTOR/S6K cassette induces IRS1/2 depletion, insulin resistance, and cell survival deficiencies. Curr. Biol., 14, 1650–1656.[CrossRef][ISI][Medline]

  36. Halse, R., Rochford, J.J., McCormack, J.G., Vandenheede, J.R., Hemmings, B.A. and Yeaman, S.J. (1999) Control of glycogen synthesis in cultured human muscle cells. J. Biol. Chem., 274, 776–780.[Abstract/Free Full Text]

  37. Arad, M., Moskowitz, I.P., Patel, V.V., Ahmad, F., Perez-Atayde, A.R., Sawyer, D.B., Walter, M., Li, G.H., Burgon, P.G., Maguire, C.T. et al. (2003) Transgenic mice overexpressing mutant PRKAG2 define the cause of Wolff-Parkinson-White syndrome in glycogen storage cardiomyopathy. Circulation, 107, 2850–2856.[Abstract/Free Full Text]

  38. El-Hashemite, N., Zhang, H., Walker, V., Hoffmeister, K.M. and Kwiatkowski, D.J. (2004) Perturbed IFN-gamma-Jak-signal transducers and activators of transcription signaling in tuberous sclerosis mouse models: synergistic effects of rapamycin-IFN-gamma treatment. Cancer Res., 64, 3436–3443.[Abstract/Free Full Text]

  39. Manning, W.J., Wei, J.Y., Katz, S.E., Litwin, S.E. and Douglas, P.S. (1994) In vivo assessment of LV mass in mice using high-frequency cardiac ultrasound: necropsy validation. Am. J. Physiol., 266, H1672–H1675.

  40. Sahn, D.J., DeMaria, A., Kisslo, J. and Weyman, A. (1978) Recommendations regarding quantitation in M-mode echocardiography: results of a survey of echocardiographic measurements. Circulation, 58, 1072–1083.[Abstract/Free Full Text]

  41. Lader, A.S., Xiao, Y.F., Ishikawa, Y., Cui, Y., Vatner, D.E., Vatner, S.F., Homcy, C.J. and Cantiello, H.F. (1998) Cardiac Gsalpha overexpression enhances L-type calcium channels through an adenylyl cyclase independent pathway. Proc. Natl Acad. Sci. USA, 95, 9669–9674.[Abstract/Free Full Text]

  42. McMullen, J.R., Sherwood, M.C., Tarnavski, O., Zhang, L., Dorfman, A.L., Shioi, T. and Izumo, S. (2004) Inhibition of mTOR signaling with rapamycin regresses established cardiac hypertrophy induced by pressure overload. Circulation, 109, 3050–3055.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 J. Neurosci.Home page
L. Meikle, K. Pollizzi, A. Egnor, I. Kramvis, H. Lane, M. Sahin, and D. J. Kwiatkowski
Response of a Neuronal Model of Tuberous Sclerosis to Mammalian Target of Rapamycin (mTOR) Inhibitors: Effects on mTORC1 and Akt Signaling Lead to Improved Survival and Function
J. Neurosci., May 21, 2008; 28(21): 5422 - 5432.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
S. Li, F. Takeuchi, J.-a. Wang, Q. Fan, T. Komurasaki, E. M. Billings, G. Pacheco-Rodriguez, J. Moss, and T. N. Darling
Mesenchymal-epithelial interactions involving epiregulin in tuberous sclerosis complex hamartomas
PNAS, March 4, 2008; 105(9): 3539 - 3544.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
L. Meikle, D. M. Talos, H. Onda, K. Pollizzi, A. Rotenberg, M. Sahin, F. E. Jensen, and D. J. Kwiatkowski
A Mouse Model of Tuberous Sclerosis: Neuronal Loss of Tsc1 Causes Dysplastic and Ectopic Neurons, Reduced Myelination, Seizure Activity, and Limited Survival
J. Neurosci., May 23, 2007; 27(21): 5546 - 5558.
[Abstract] [Full Text] [PDF]

Home page
 PediatricsHome page
S. Jozwiak, K. Kotulska, J. Kasprzyk-Obara, D. Domanska-Pakiela, M. Tomyn-Drabik, P. Roberts, and D. Kwiatkowski
Clinical and Genotype Studies of Cardiac Tumors in 154 Patients With Tuberous Sclerosis Complex
Pediatrics, October 1, 2006; 118(4): e1146 - e1151.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
J. Luo, J. R. McMullen, C. L. Sobkiw, L. Zhang, A. L. Dorfman, M. C. Sherwood, M. N. Logsdon, J. W. Horner, R. A. DePinho, S. Izumo, et al.
Class IA Phosphoinositide 3-Kinase Regulates Heart Size and Physiological Cardiac Hypertrophy
Mol. Cell. Biol., November 1, 2005; 25(21): 9491 - 9502.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
14/3/429    most recent
ddi039v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (13)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Meikle, L.
Right arrow Articles by Kwiatkowski, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Meikle, L.
Right arrow Articles by Kwiatkowski, D. J.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?