Skip Navigation


Human Molecular Genetics Advance Access originally published online on January 7, 2005
Human Molecular Genetics 2005 14(4):535-542; doi:10.1093/hmg/ddi050
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
14/4/535    most recent
ddi050v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (17)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Kurotaki, N.
Right arrow Articles by Lupski, J. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kurotaki, N.
Right arrow Articles by Lupski, J. R.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, Vol. 14, No. 4 © Oxford University Press 2005; all rights reserved

Sotos syndrome common deletion is mediated by directly oriented subunits within inverted Sos-REP low-copy repeats

Naohiro Kurotaki1, Pawel Stankiewicz1, Keiko Wakui1,2, Norio Niikawa3,4 and James R. Lupski1,5,6,*

1Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX, USA, 2Department of Medical Genetics, Shinshu University School of Medicine, Matsumoto, Japan, 3Department of Human Genetics, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki, Japan, 4CREST, Japan Science and Technology Agency, Kawaguchi, Japan, 5Department of Pediatrics, Baylor College of Medicine, Houston, TX, USA and 6Texas Children's Hospital, Houston, TX, USA

Received August 30, 2004; Revised December 8, 2004; Accepted December 21, 2004


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Sotos syndrome (Sos) is an overgrowth disorder also characterized clinically by mental retardation, specific craniofacial features and advanced bone age. As NSD1 haploinsufficiency was determined in 2002 to be the major cause of Sos, many intragenic mutations and chromosomal microdeletions involving the entire NSD1 gene have been described. In the Japanese population, half of the cases analyzed appear to have a common microdeletion; however, in the European population, deletion cases account for only 9%. Blast analysis of the Sos genomic region on 5q35 revealed two complex mosaic low-copy repeats (LCRs) that are centromeric and telomeric to NSD1. We termed these proximal Sos-REP (Sos-PREP, ~390 kb) and distal Sos-REP (Sos-DREP, ~429 kb), respectively. On the basis of the analysis of DNA sequence, we determined the size, structure, orientation and extent of sequence identity of these LCRs. We found that Sos-PREP and Sos-DREP are composed of six subunits termed A–F. Each of the homologous subunits, with the exception of one, is located in an inverted orientation and the order of subunits is different between the two Sos-REPs. Only the subunit C' in Sos-DREP is oriented directly with respect to the subunit C in Sos-PREP. These latter C' and C subunits are greater than 99% identical. Using pulsed-field gel electrophoresis analysis in eight Sos patients with a common deletion, we detected an ~550 kb junction fragment that we predicted according to the non-allelic homologous recombination (NAHR) mechanism using directly oriented Sos-PREP C and Sos-DREP C' subunits as substrates. This patient specific junction fragment was not present in 51 Japanese and non-Japanese controls. Subsequently, using long-range PCR with restriction enzyme digestion and DNA sequencing, we identified a 2.5 kb unequal crossover hotspot region in six out of nine analyzed Sos patients with the common deletion. Our data are consistent with an NAHR mechanism for generation of the Sos common deletion.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Sotos syndrome (Sos) (MIM#117550), also called cerebral gigantism, is a disorder characterized by pre- and postnatal overgrowth with advanced bone age, dysmorphic features with macrocephaly and a pointed chin and mental retardation (1,2). The major cause of Sos is NSD1 haploinsufficiency due to intragenic mutations or chromosomal microdeletions encompassing the entire NSD1 gene (3). A total of 87 NSD1 point mutations and 58 microdeletions have been reported; however, the frequencies for microdeletions differ among different populations (3–8). In the Japanese population, about half of the cases (49/95) carry a de novo microdeletion, whereas microdeletions have been observed only in ~9% of the cases (9/100) in the European populations (6). The reason for the different rearrangement frequencies among the populations studied is unknown.

Recently, we analyzed 50 microdeletions and found that 46/50 cases had a common sized deletion described as microdeletion ‘A’ (6). We identified highly homologous low-copy repeats (LCRs) at both common deletion breakpoints and suggested that Sos was likely a genomic disorder (6). We now delineated the genomic architectural features of the proximal Sos-REP (Sos-PREP) and distal Sos-REP (Sos-DREP) LCRs flanking the common Sos deletion and identified a 2.5 kb unequal crossover hotspot region in directly oriented subunits of Sos-REPs, consistent with a non-allelic homologous recombination (NAHR) mechanism for the common Sos chromosome microdeletions.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The genomic architecture of Sos-PREP and Sos-DREP
The DNA sequence gap present in our previous contig (6) has been closed in the May 2004 assembly of the UCSC database. We estimated previously that the size of the Sos common deletion was between 0.7 and 2.2 Mb (3,6).

The analysis of the UCSC databases reveals that there are 22 genes in the common deletion interval. Using Dotblot and BLAST 2, we found that the Sos-PREP is ~390 kb in size (between RP11-91H12 and RP11-843P14) and Sos-DREP is ~429 kb in size (between RP11-1101H11 and CTD-2515I1) (Fig. 1A).



View larger version (20K):
[in this window]
[in a new window]
  		Figure 1. The physical map of chromosome 5 Sos common deletion region and sequence-based genomic structure of the Sos-REPs. (A) The Sos-REPs, indicated as black boxes, are proximal and distal to NSD1. Five NotI restriction sites are shown above with the Sos-REP-specific predicted genes and direction of transcription (arrowheads) below the horizontal line and the anonymous DNA genetic markers shown above. THOC3 and NY-REN-7 map to both Sos-PREP and Sos-DREP. (B) There are six subunits of >95% sequence identity between the proximal and the distal Sos-REPs (A–F) and their orientation is depicted by the arrowhead. All subunits except C' are inverted with respect to each other. Dotted lines indicate unique sequence in LCRs. The location of probes PFGE 6, 7 and 8 and the position of NotI restriction site numbers 4 and 5 are given. Three relevant genes are shown above.

 
We found six regions of high identity (>97%) between Sos-PREP and Sos-DREP (subunits A–F) (Fig. 1B). We consider the Sos-REP elements as LCRs located at the proximal and distal common deletion breakpoints and as one block structurally. The size and order of subunits within Sos-PREP and Sos-DREP are not identical. The sum of these high sequence similarity-subunits is ~316 kb (316 500 bp) for Sos-PREP and ~357 kb (356 533 bp) for Sos-DREP. The DNA sequence identity for each subunit in Sos-REPs is between 95.7 and 99.2% (Table 1). The largest subunit A is 123 620 bp in size for Sos-PREP and 119 051 bp for Sos-DREP (Fig. 1B). There are 63 kb of unique sequence between regions D and E in Sos-PREP and 58.7 kb between regions E and C' in Sos-DREP. The subunit E in SoS-DREP is located telomeric to subunit A. The most significant finding from the comparison between both Sos-REPs is that subunit C' maps 59 kb telomeric to the other subunits of Sos-DREP and is in a direct orientation with respect to subunit C of Sos-PREP. Both Sos-REPs contain two genes, THOC3 and NY-REN-7 (Fig. 1). THOC3 and NY-REN-7 have open reading frames that are completely conserved in Sos-PREP and Sos-DREP. The PROP1 gene maps only to the Sos-DREP between subunits E and C' (Fig. 1B).


View this table:
[in this window]
[in a new window]
  		Table 1. DNA sequence size (kb) and identity (%) for subunits of Sos-REPs
 
De novo apparent junction fragment in association with Sos common deletion
From genomic sequence, we identified 27 NotI restriction enzyme sites in the 2.7 Mb Sos genomic region. Five NotI sites are shown in Figure 1, whereas 22 additional sites are evenly scattered between site numbers 2 and 3. We performed genomic Southern blotting analyses using the probes adjacent to the directly oriented subunits C within Sos-REPs. Pulsed-field gel elctrophoresis (PFGE) probes 6 and 7 map 15 kb centromeric and 24 kb telomeric of subunit C in Sos-PREP, respectively, and PFGE probe 8 was designed within the subunit C' in Sos-DREP, but centromeric to the NotI restriction site number 5 (Fig. 1A). Using PFGE probe 8, in addition to 900, 700 and 75 kb expected bands observed in control subjects, we identified a de novo ~550 kb apparent junction fragment in all the eight Sos patients with a common deletion that we examined (Fig. 2). Twenty control individuals from Japan (including 2165, 2172 and 2320) did not have this junction fragment. In addition, we tested 31 non-Japanese control samples and they did not have the junction fragment (data not shown). The junction fragment was also not present in the parents (2184 and 2185) of the patient 2180 with the common deletion. As expected, the predicted junction fragment was also not detected in either the patient with a known smaller sized deletion (2186) or the patient with an intragenic point mutation (147). The size of the junction fragment in eight common deletion cases appeared to be identical in size within the limits of resolution of PFGE. As anticipated, using probe 6, we detected the same junction fragment and did not find any junction fragments using probe 7 (data not shown). We detected an extra ~650 kb band in the patient 2180 and an ~150 kb band in his father (2184) whereas no extra bands were detected in any of the other cases examined. Common deletion in patient 2180 is known to be of paternal origin (9).



View larger version (55K):
[in this window]
[in a new window]
  		Figure 2. PFGE analysis with probe PFGE 8 detected a de novo ~550 kb junction fragment in eight unrelated common deletion patients. These patient-specific junction fragments are depicted by JCT. Patient 2186 has a smaller sized deletion (34) and 147 has an intragenic mutation of NSD1 (7), whereas 2165, 2172 and 2320 are unaffected controls. Parent 2184 and patient 2180 have ~150 and ~650 kb extra band, respectively, shown by arrows.

 
Our data are consistent with the Sos deletion resulting from NAHR between directly oriented subunit C in Sos-PREP and subunit C' in Sos-DREP. Further support for a Sos-REP subunit C mediated NAHR comes from mapping the common deletion breakpoints. We mapped the proximal breakpoint between probes PFGE 6 and 7 (distance of 102 kb). The distal breakpoint maps to 75 kb between NotI site numbers 4 and 5. Hence, we calculated the deletion size is ~2 Mb that is the distance between the proximal ends of subunit C in Sos-PREP and subunit C' in Sos-DREP, as one copy of subunit C is predicted to be deleted during NAHR.

A 2.5 kb NAHR hotspot region
To further narrow the recombination breakpoints within the recombinant Sos-REP, we analyzed the DNA sequence within directly oriented subunits C in Sos-PREP and C' in Sos-DREP for the presence of cis-morphic restriction enzyme sites (10) or paralogous sequence variants (PSVs). These PSVs could potentially be used to identify crossovers between highly homologous Sos-REP copies. We identified two cis-morphic restriction enzyme sites, ClaI unique to Sos-PREP subunit C and NaeI unique to Sos-DREP subunit C', that are not present in Sos-DREP subunit C (Fig. 3A). Using long-range PCR, we amplified the 11.2 kb region. As a result of digestion of this fragment from nine patients and two controls, six Sos patients with common deletion 2229, 27, 2180, 2230, 2231 and 2232 showed the predicted 6.9 kb junction fragment (Fig. 3B). Their parents (3F, 3M, 27F, 27M, 2184 and 2185), three other patients with common deletion (2175, 2176 and 2181) and two controls (2165 and 2172) did not have this apparent junction fragment. As predicted by the sequence analysis, we also identified a 9.8 kb band from BAC clone RP11-546L14 (mapped to Sos-PREP subunit C), an 11.2 kb band from BAC clone RP11-1026M7 (mapped to Sos-DREP subunit C) and an 8.3 kb band from BAC clone RP11-2515I1 (mapped to Sos-DREP subunit C').



View larger version (40K):
[in this window]
[in a new window]
  		Figure 3. Novel junction fragments identified in six Sos patients with common deletion using long-range PCR–restriction enzyme assay. (A) DNA sequence prediction of the novel junction fragment from recombinant Sos-REPs. Sos-PREP subunit C and Sos-DREP subunit C' are shown with blue and pink rectangles depicting homology segments. Both restriction enzyme sites, ClaI, unique to Sos-PREP subunit C, and NaeI, unique to Sos-DREP subunit C', are not present in Sos-DREP subunit C. Using a similar approach in three Sos patients (2175, 2176 and 2181), we excluded an ~10 kb region upstream of ClaI site and the most distal ~10 kb of Sos-PREP subunit C and Sos-DREP subunit C' as a crossover region. However, we were not able to exclude the ~16 kb segment due to the lack of restriction enzyme sites (dotted line with arrows under Sos-DREP subunit C'). Dotted diagonal line over Sos-DREP subunit C' indicates the crossover region. (B) An 11.2 kb fragment from the Sos-DREP subunit C is not digested by either ClaI or NaeI. The 9.8 and 1.4 kb fragments from Sos-PREP subunit C and the 8.3 and 2.9 kb fragments from Sos-DREP subunit arose after digestion of genomic DNA with ClaI and NaeI. The three control lanes contain long-range PCR products from BAC clone DNAs (RP11-546L14 from Sos-PREP subunit C RP11-1026M7 from Sos-DREP subunit C, and RP11-2515I1 from Sos-DREP subunit C'). In addition, a 6.9 kb junction fragment from six patients with the Sos deletion is depicted. This junction fragment was observed only in six individuals among nine Sos patients with common deletion but not in their unaffected family members.

 
Using a similar approach, we were able to exclude the crossover region in other portions of the C and C' subunits (Fig. 3A). Unfortunately, in Sos patients 2175, 2176 and 2181, we could not exclude the 16 kb region distal to the NaeI site in Sos-DREP subunit C' because there were no informative restriction enzyme sites.

Sequence analysis of the crossover breakpoints
DNA sequencing was performed for the precise determination of the site of strand exchange in the 6.9 kb region in six patients (2229, 2231, 2232, 2230, 2180 and 27). Nucleotide differences between the Sos-PREP subunit C and Sos-DREP subunit C' (i.e. cis-morphisms or PSVs) (10) were determined on the basis of the available DNA sequence of this region. To confirm the sequence data, we sequenced the 6.9 kb region in the corresponding BAC clones RP11-546L14, RP11-1026M7 and RP11-2515I1. The DNA sequences from the recombinant Sos-REPs were compared to identify the crossover as evidenced by the transition from the Sos-PREP subunit C to the Sos-DREP subunit C' specific PSVs (Fig. 4). Within the 6.9 kb region analyzed, there were 42 cis-morphic nucleotide differences between the Sos-PREP subunit C and Sos-DREP subunit C' copies. We confirmed all these nucleotide differences were cis-morphisms from the sequence data of corresponding BAC clones.



View larger version (34K):
[in this window]
[in a new window]
  		Figure 4. Mapping the sites of strand exchanges in recombinant Sos-REPs using PCR–restriction enzyme assays. The nucleotide differences between the Sos-PREP subunit C (above) and the Sos-DREP subunit C' (below) are indicated at the top. A mark (:) denotes the absence of the corresponding nucleotide. A total of 42 (capital letters) DNA sequence differences between Sos-PREP subunit C and Sos-DREP subunit C' were used for mapping the sites of strand exchange. These represent paralogous sequence variations (PSVs), also known as cis-morphisms (10), between proximal and distal copies and thus enable distinctions between both copies. Ten sites (lower case) are polymorphic and thus non-informative (small circles) for mapping recombinants. Each horizontal line below represents the recombinant Sos-REP of an individual with the patient number given to the left. The DNA sequence differences between Sos-PREP subunit C and Sos-DREP subunit C' are represented by circles for ease of analysis; white circles denote matches to Sos-PREP subunit C and gray circles denote matches to Sos-DREP subunit C'. The cis-morphic restriction sites (ClaI and NaeI) used for the identification of novel junction fragments and their genomic position in either Sos-PREP subunit C or Sos-DREP subunit C' are indicated. The regions of strand exchange in each patients are highlighted using a thick black line and arrows above the black line and summarized at the bottom of the figure as the black arrowed lines.

 
All six of the strand exchanges examined occurred in a 2.5 kb hotspot region. We did not identify any common repetitive elements (Alu, LINE and SINE elements) or cruciform structures in this region. With the exception of the recombinant Sos-REP from patient 2180, the breakpoints were actually narrowed to between 132 and 671 bp. Patient 2180 had a relatively large crossover region (2117 bp) and this region contains other patients' crossover regions except 2231. Sequence comparison between the Sos-PREP subunit C and Sos-DREP subunit C' in the 2.5 kb indicated that there were only two stretches of >300 bp perfect sequence identity. The crossover regions from the three patients, 2230, 27 and 2180, contain identical >300 bp stretches in their crossover region. Gene conversion events adjacent to the crossover were detected in three patients (2230, 27 and 2180), consistent with a double-strand break repair mechanism for initiating the NAHR.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
Sos-REPs are substrates of DNA rearrangements resulting in Sos common deletion
Several genomic disorders result from NAHR between LCRs (10–15). Genomic disorder associated LCRs are usually ~10–400 kb in size and share >97% sequence identity. In general, directly oriented LCRs are utilized as substrates of NAHR and result in chromosomal deletions or reciprocal duplications, whereas inverted oriented LCRs induce chromosomal inversion (11,14,15). In LCRs with a more complex and mosaic structure, specific subunits of the complex LCRs can be used as NAHR substrates and can lead to either an inversion or a deletion/duplication, depending on the orientation of the substrates utilized (16).

Sos-PREP and Sos-DREP have a mosaic structure and their orientation is inverted. Only subunit C in Sos-PREP and subunit C' in Sos-DREP are directly oriented. Similar mosaic patterns for LCRs at breakpoints of recurrent rearrangements associated with genomic disorders have been described for nephronophthisis 1 (17), Williams–Beuren syndrome (18) and Smith–Magenis syndrome (SMS) (19,20). Alternate directly oriented LCRs may be substrates for NAHR in uncommon but recurrent SMS deletions (21), whereas other complex architectural features can be associated with rare non-recurrent SMS associated deletions occurring by both homologous and non-homologous mechanisms (22,23).

As anticipated, these directly oriented subunits of Sos-REPs serve as substrates for NAHR and result in a common 5q35 microdeletion. Similar to LCR-based NAHR reciprocal deletion/duplication in CMT1A/HNPP and SMS/dup(17) (p11.2p11.2) (24–27), we predict a reciprocal duplication of the Sos common deletion region.

The 99.2% sequence identity observed between subunit C in Sos-PREP and C' in Sos-DREP may reflect homogenization due to more frequent gene conversions in contrast to other subunits. It remains to be determined why there is an observed frequency difference for the Sos common deletion between Japanese and non-Japanese populations. Whether this reflects population-specific sequence variation of the recombination substrates or recombination hotspot differences (28) between the populations will require substantial further experimentation.

Positional recombination hotspots in the Sos-REP
We identified a 2.5 kb positional hotspot for strand exchange during NAHR between Sos-PREP subunit C and Sos-DREP subunit C'. Among nine Sos patients with common deletion, six patients had a crossover in this region. The 2.5 kb region represents a unique sequence and does not have any specific repetitive DNA elements or other unique architectural features. Thus, the factors that could either stimulate double-strand breaks or promote the crossover event of DNA strands are unknown. It has been proposed that a certain length of perfect identity (300–500 bp) or a minimal efficient processing segments in human may be required in NAHR (14,29,30). In the CMT1A region, the breakpoints were localized to a 1.7 Kb region within the ~24 kb CMT1A-REPs. The narrowed breakpoint contained ~500 bp of perfect sequence identity (29,31,32). In NF1 deletion on 17q11.2, most breakpoints for DNA strand exchanges occurred in a 2 kb segment in NF1-REPs (30). There is a 501 bp stretch of perfect identity in the 1.1 kb SMS hotspot (27). Sos common deletion hotspot contains two >300 bp stretches of perfect sequence identity in 2.5 kb. In this 2.5 kb hotspot region, there are seven polymorphisms. This observation suggests that gene conversion and strand exchange events, alternate resolutions of a Holliday structure (28), may be coincident in position as reported in SMS (27).

Our results are consistent with other genomic disorders (CMT1A, SMS and NF1) in that sequence identity may promote the NAHR event in the Sos common deletion. Like other genomic disorders, a recombination hotspot appears to be associated with the NAHR event. Further study may reveal why there is such a dramatic population difference for the Sos common deletion and will likely identify a potential phenotype associated with the predicted reciprocal duplication.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Genome sequence analysis of the Sos common deletion region
A preliminary map of the 5q35 Sos critical region was reported previously (6). To further characterize the Sos-REP genomic structure, we removed the repetitive sequences using Repeat Masker (http://www.repeatmasker.org/) and assembled Sos-PREP and Sos-DREP using Pipmaker with Dotplot (33), the Sequencher software (Gene Codes) and NCBI BLAST 2 analyses. The analyzed clones were identified from the latest complete physical map of the Sos chromosome region (May 2004 assembly) in the UCSC Genome Browser (http://genome.cse.ucsc.edu/index.html).

Subject and cell lines
We analyzed the peripheral blood lymphocytes and/or Epstein-Barr virus-transformed lymphoblastoid cells and extracted DNA after obtaining informed consent from each patient and their parents. We analyzed 11 patients with Sos four parents of patients with Sos and 51 Japanese and non-Japanese control individuals. Nine patients (2180, 2232, 2229, 2175, 2176, 2230, 2231, 2181 and 27) with Sos had a common de novo deletion (described as deletion ‘A’) that was confirmed previously by FISH studies (6). Among nine patients with the common deletion, we obtained the cell line from only eight patients 2180, 2232, 2229, 2175, 2176, 2230, 2231 and 2181. Sos patient 2186 had a smaller sized deletion (34), whereas 147 had a NSD1 point mutation (7). Individuals 2184 and 2185, 2187 and 2188, 3F and 3M as well as 27F and 27M are parents of Sos patients 2180, 2186, 3 and 27, respectively. Fifty-one other cases including 2165, 2172 and 2320 were unaffected individuals used as controls. Among all subjects analyzed in this study, the patient with small deletion (2186), the patient with intragenic mutation (147) and 31 control samples are not of Japanese origin. Twenty nine other subjects are all from Japan.

PFGE analysis
High-molecular weight DNA was isolated and embedded in agarose plugs from peripheral blood samples and/or Epstein-Barr virus-transformed lymphoblastoid cells established from patients and their parents. DNA in plugs was digested by NotI (New England Biolabs, MA, USA). Separation of DNA fragments was achieved using a CHEF MAPPER (BioRAD) for 27 h in 0.5XTBE running buffer with pulse time 86.54 s ramp at 6 V/cm. After treatment with 0.25 N HCl for 30 min and 0.4 N NaOH for 40 min, gels were blotted onto a nylon membrane.

To identify putative junction fragments and to determine possible substrates of NAHR in the Sos common deletions, we used three probes, PFGE 6, 7 and 8. The probes were constructed by PCR amplification of BAC substrate DNA from genomic clones located around predicted proximal and distal breakpoints of the common deletion and were flanking the subunit C and located in the direct subunit C' (Fig. 1). Forward and reverse primers designed for probe amplifications were 5'-CTAGTGTCTACTTGGAGCTG-3' and 5'-ATCCTTCTCGTACTTTCTTT-3' (probe 6), 5'-TCATTTACCAAGAGAGGTTA-3' and 5'-GACCTATTGGGATATTTTCT-3' (probe 7) and 5'-TAGCTGAGGTCAGATTAGG-3' and 5'-AGTTTTTAAACCAAACTTCC-3' (probe 8). DNAs of BAC clones RP11-826N14 (for PFGE probes 6 and 7) and RP11-889L3 (for PFGE probe 8) were extracted and used for PCR amplification.

Long-range PCR and restriction enzyme digestion
Using long-range PCR (TaKaRa, Japan) with primers F: TCTGTTGCATGATCCATCCTGTGTTGCAATGCTGGC and R: TTAATTGTCAACAACTGAATAGAAAATTGGGCAGG, we amplified a 11.2 kb fragment (Fig. 3). Both primers annealed to Sos-PREP subunit C, Sos-DREP subunit C and Sos-DREP subunit C'. After purifying PCR products using QIAquick PCR purification kit (QIAGEN), we digested each samples with 10 U of ClaI (New England Biolabs) and 10 U of NaeI (New England Biolabs) in 40 µl buffer. The digested products were subject to electrophoresis in a 0.8% agarose gel. The 6.9 kb junction fragment was separated from other bands, extracted from the agarose gel using a Gel Extraction Kit (QIAGEN) and then used as a template in subsequent PCR reactions for DNA sequencing.

DNA sequencing
For sequencing the 6.9 kb junction fragment, eight pairs of overlapping primers were designed. They are F1: TTCTGCTAACAATACCATTT and R1: AACATACAACCAGATTTGAC, F2: CAGTCAGGTAGGATTTTACA and R2: AAACTGGGAATACATAGTCA, F3: ACTTCTGCTTAATTCCATAA and R3: TGCTATGAAAAACTTAGCTC, F4: GTTTTAATAATACAAAGTAGGTC and R4: AAGGAGGATAGCTCTGAAC, F5: TATTCCAAGCTGTTTCCT and R5: CCAAGCTGTTTCCTTGGG, F6: CTGAGTTTAGGTGTCAAGAG and R6: CTTAGATGAGGACCACTGT, F7: CTGTTCATAGCTGTCTTCAT and R7: AAGAAATCTGGAAACCTCTA and F8: GATGCAGGTGACTTGTGC and R8: ACTTACCCACCTGCTTGT.

The PCR products were extracted from the agarose gel and sequenced using ABI PRISM BigDye Terminators version 3.1 Cycle Sequencing Kit (PE Applied Biosystems).


   ACKNOWLEDGEMENTS
 
We thank the participating families for their cooperation in this study. We also thank Drs K. Inoue and M.E. Hurles for critical reviews, Dr W. Bi for helpful discussion, Drs Y. Fukushima, H. Ohashi, J.J. Shen, H. Kawame and S. Raskin for clinical samples and M. Withers and Y. Noguchi for technical assistance. This work was supported in part by grants from National Institute of Neurological Disorders and Stroke, National Institutes of Health (R01NS27042) the National Institute of Child Health and Human Development (NIH) (P01 HD38420) and the Baylor College of Medicine Mental Retardation Research Center (HD 2406407). N.K. is a recipient of grant for Medical Research of Alumni Association of Nagasaki University School of Medicine and a Nagasaki Medical Association Research Subsidy.


   FOOTNOTES
 
* To whom correspondence should be addressed at: One Baylor Plaza, Room 604B, Houston, TX 77030, USA. Tel: +1 7137986530; Fax: +1 7137985073; Email: jlupski{at}bcm.tmc.edu


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Sotos, J.F., Dodge, P.R., Muirhead, D., Crawford, J.D. and Talbot, N.B. (1964) Cerebral gigantism in childhood. A syndrome of excessively rapid growth with acromegalic features and a nonprogressive neurologic disorder. N. Engl. J. Med., 271, 109–116.[ISI][Medline]

  2. Cole, T.R.P. and Hughes, H.E. (1994) Sotos syndrome: a study of the diagnostic criteria and natural history. J. Med. Genet., 31, 20–32.[Abstract]

  3. Kurotaki, N., Imaizumi, K., Harada, N., Masuno, M., Kondoh, T., Nagai, T., Ohashi, H., Naritomi, K., Tsukahara, M., Makita, Y. et al. (2002) Haploinsufficiency of NSD1 causes Sotos syndrome. Nat. Genet., 30, 365–366.[CrossRef][ISI][Medline]

  4. Douglas, J., Hanks, S., Temple, I.K., Davies, S., Murray, A., Upadhyaya, M., Tomkins, S., Hughes, H.E., Cole, T.R.P. and Rahman, N. (2003) NSD1 mutations are the major cause of Sotos syndrome and occur in some cases of Weaver syndrome but are rare in other overgrowth phenotypes. Am. J. Hum. Genet., 72, 132–143.[CrossRef][ISI][Medline]

  5. Rio, M., Clech, L., Amiel, J., Faivre, L., Lyonnet, S., Le Merrer, M., Odent, S., Lacombe, D., Edery, P., Brauner, R. et al. (2003) Spectrum of NSD1 mutations in Sotos and Weaver syndromes. J. Med. Genet., 40, 436–440.[Abstract/Free Full Text]

  6. Kurotaki, N., Harada, N., Shimokawa, O., Miyake, N., Kawame, H., Uetake, K., Makita, Y., Kondoh, T., Ogata, T., Hasegawa, T. et al. (2003) Fifty microdeletions among 112 cases of Sotos syndrome: low copy repeats possibly mediate the common deletion. Hum. Mutat., 22, 378–387.[CrossRef][ISI][Medline]

  7. Kamimura, J., Endo, Y., Kurotaki, N., Kinoshita, A., Miyake, N., Shimokawa, O., Harada, N., Visser, R., Ohashi, H., Miyakawa, K. et al. (2003) Identification of eight novel NSD1 mutations in Sotos syndrome. J. Med. Genet., 40, e126.[Free Full Text]

  8. Türkmen, S., Gillessen-Kaesbach, G., Meinecke, P., Albrecht, B., Neumann, L.M., Hesse, V., Palanduz, S., Balg, S., Majewski, F., Fuchs, S. et al. (2003) Mutations in NSD1 are responsible for Sotos syndrome, but are not a frequent finding in other overgrowth phenotypes. Eur. J. Hum. Genet., 11, 858–865.[CrossRef][ISI][Medline]

  9. Miyake, N., Kurotaki, N., Sugawara, H., Shimokawa, O., Harada, N., Kondoh, T., Tsukahara, M., Ishikiriyama, S., Sonoda, T., Miyoshi, Y. et al. (2003) Preferential paternal origin of microdeletions caused by prezygotic chromosome or chromatid rearrangements in Sotos syndrome. Am. J. Hum. Genet., 72, 1331–1337.[CrossRef][ISI][Medline]

  10. Lupski, J.R. (2003) 2002 Curt Stern Award Address. Genomic disorders recombination-based disease resulting from genomic architecture. Am. J. Hum. Genet., 72, 246–252.[CrossRef][ISI][Medline]

  11. Lupski, J.R. (1998) Genomic disorders: structural features of the genome can lead to DNA rearrangements and human disease traits. Trends Genet. 14, 417–422.[CrossRef][ISI][Medline]

  12. Mazzarella, R. and Schlessinger, D. (1998) Pathological consequences of sequence duplications in the human genome. Genome Res., 8, 1007–1021.[Abstract/Free Full Text]

  13. Emanuel, B.S. and Shaikh T.H. (2001) Segmental duplications: an ‘expanding’ role in genomic instability and disease. Nat. Rev. Genet., 2, 791–800.[ISI][Medline]

  14. Inoue, K. and Lupski, J.R. (2002) Molecular mechanisms for genomic disorders. Annu. Rev. Genomics Hum. Genet., 3, 199–242.[CrossRef][ISI][Medline]

  15. Stankiewicz, P. and Lupski, J.R. (2002) Genome architecture, rearrangements and genomic disorders. Trends Genet., 18, 74–82.[CrossRef][ISI][Medline]

  16. Shaffer, L.G. and Lupski, J.R. (2000) Molecular mechanisms for constitutional chromosomal rearrangements in humans. Annu. Rev. Genet., 34, 297–329.[CrossRef][ISI][Medline]

  17. Saunier, S., Calado, J., Benessy, F., Silbermann, F., Heilig, R., Weissenbach, J. and Antignac, C. (2000) Characterization of the NPHP1 locus: mutational mechanism involved in deletions in familial juvenile nephronophthisis. Am. J. Hum. Genet., 66, 778–789.[CrossRef][ISI][Medline]

  18. Bayés, M., Magano, L.F., Rivera, N., Flores, R. and Pérez Jurado, L.A. (2003) Mutational mechanisms of Williams–Beuren syndrome deletions. Am. J. Hum. Genet., 73, 131–151.[CrossRef][ISI][Medline]

  19. Chen, K.-S., Manian, P., Koeuth, T., Potocki, L., Zhao, Q., Chinault, A.C., Lee, C.C. and Lupski, J.R. (1997) Homologous recombination of a flanking repeat gene cluster is a mechanism for a common contiguous gene deletion syndrome. Nat. Genet., 17, 154–163.[CrossRef][ISI][Medline]

  20. Park, S.-S., Stankiewicz, P., Bi, W., Shaw, C.J., Lehoczky, J., Dewar, K., Birren, B. and Lupski, J.R. (2002) Structure and evolution of the Smith–Magenis syndrome repeat gene clusters, SMS-REPs. Genome Res., 12, 729–738.[Abstract/Free Full Text]

  21. Shaw, C.J., Withers, M.A. and Lupski, J.R. (2004) Uncommon deletions of the Smith–Magenis syndrome region can be recurrent when alternate low-copy repeats act as homologous recombination substrates. Am. J. Hum. Genet., 75, 75–81.[CrossRef][ISI][Medline]

  22. Stankiewicz, P., Shaw, C.J., Dapper, J.D., Wakui, K., Shaffer. L.G., Withers., M.A., Elizondo, L., Park, S.-S. and Lupski, J.R. (2003) Genome architecture catalyzes nonrecurrent chromosomal rearrangements. Am. J. Hum. Genet., 72, 1101–1116.[CrossRef][ISI][Medline]

  23. Shaw, C.J. and Lupski, J.R. (2004) Implications of human genome architecture for rearrangement-based disorders: the genomic basis of disease. Hum. Mol. Genet., 13, R57–R64.[Abstract/Free Full Text]

  24. Chance, P.F., Abbas, N., Lensch, M.W., Pentao, L., Roa, B.B., Patel, P.I. and Lupski, J.R. (1994) Two autosomal dominant neuropathies result from reciprocal DNA duplication/deletion of a region on chromosome 17. Hum. Mol. Genet., 3, 223–228.[Abstract/Free Full Text]

  25. Reiter, L.T., Murakami, T., Koeuth, T., Pentao, L., Muzny, D.M., Gibbs, R.A. and Lupski, J.R. (1996) A recombination hotspot responsible for two inherited peripheral neuropathies is located near a mariner transposon-like element. Nat. Genet., 12, 288–297.[CrossRef][ISI][Medline]

  26. Potocki, L., Chen, K.-S., Park, S.-S., Osterholm, D.E., Withers, M.A., Kimonis, V., Summers, A.M., Meschino, W.S., Anyane-Yeboa, K., Kashork, C.D. et al. (2000) Molecular mechanism for duplication 17p11.2—the homologous recombination reciprocal of the Smith–Magenis microdeletion. Nat. Genet., 24, 84–87.[CrossRef][ISI][Medline]

  27. Bi, W., Park, S.-S., Shaw, C.J., Withers, M.A., Patel, P.I. and Lupski, J.R. (2003) Reciprocal crossovers and a positional preference for strand exchange in recombination events resulting in deletion or duplication of chromosome 17p11.2. Am. J. Hum. Genet., 73, 1302–1315.[CrossRef][ISI][Medline]

  28. Lupski, J.R. (2004) Hotspots of homologous recombination in the human genome: not all homologous sequences are equal. Genome Biol., 5, 242.[CrossRef][Medline]

  29. Reiter, L.T., Hastings, P.J., Nelis, E., De Jonghe, P., Van Broeckhoven, C. and Lupski, J.R. (1998) Human meiotic recombination products revealed by sequencing a hotspot for homologous strand exchange in multiple HNPP deletion patients. Am. J. Hum. Genet., 62, 1023–1033.[CrossRef][ISI][Medline]

  30. López-Correa, C., Dorschner, M., Brems, H., Lázaro, C., Clementi, M., Upadhyaya, M., Dooijes, D., Moog, U., Kehrer-Sawatzki, H., Rutkowski, J.L. et al. (2001) Recombination hotspot in NF1 microdeletion patients. Hum. Mol. Genet., 10, 1387–1392.[Abstract/Free Full Text]

  31. Lopes, J., Ravisé, N., Vandenberghe, A., Palau, F., Ionasescu, V., Mayer, M., Lévy, N., Wood, N., Tachi, N., Bouche, P. et al. (1998) Fine mapping of de novo CMT1A and HNPP rearrangements within CMT1A-REPs evidences two distinct sex-dependent mechanisms and candidate sequences involved in recombination. Hum. Mol. Genet., 7, 141–148.[Abstract/Free Full Text]

  32. Lopes, J., Tardieu, S., Silander, K., Blair, I., Vandenberghe, A., Palau, F., Ruberg, M., Brice, A. and LeGuern, E. (1999) Homologous DNA exchanges in humans can be explained by the yeast double-strand break repair model: a study of 17p11.2 rearrangements associated with CMT1A and HNPP. Hum. Mol. Genet., 8, 2285–2292.[Abstract/Free Full Text]

  33. Schwartz, S., Zhang, Z., Frazer, K.A., Smit, A., Riemer, C., Bouck, J., Gibbs, R., Hardison, R. and Miller, W. (2000) PipMaker—a web server for aligning two genomic DNA sequences. Genome Res., 10, 577–586.[Abstract/Free Full Text]

  34. Shen, J.J., Kurotaki, N., Patel, A., Lupski, J.R. and Brown, C.W. (2004) Low factor XII level in an individual with Sotos syndrome. Pediatr. Blood Cancer, 44, 187–189.[CrossRef]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Hum Mol GenetHome page
A. J. Sharp, R. R. Selzer, J. A. Veltman, S. Gimelli, G. Gimelli, P. Striano, A. Coppola, R. Regan, S. M. Price, N. V. Knoers, et al.
Characterization of a recurrent 15q24 microdeletion syndrome
Hum. Mol. Genet., March 1, 2007; 16(5): 567 - 572.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
J. A. Lee, K. Inoue, S. W. Cheung, C. A. Shaw, P. Stankiewicz, and J. R. Lupski
Role of genomic architecture in PLP1 duplication causing Pelizaeus-Merzbacher disease
Hum. Mol. Genet., July 15, 2006; 15(14): 2250 - 2265.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
R Visser, O Shimokawa, N Harada, N Niikawa, and N Matsumoto
Non-hotspot-related breakpoints of common deletions in Sotos syndrome are located within destabilised DNA regions
J. Med. Genet., November 1, 2005; 42(11): e66 - e66.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
14/4/535    most recent
ddi050v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (17)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Kurotaki, N.
Right arrow Articles by Lupski, J. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kurotaki, N.
Right arrow Articles by Lupski, J. R.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?