Human Molecular Genetics Advance Access originally published online on January 13, 2005
Human Molecular Genetics 2005 14(5):595-601; doi:10.1093/hmg/ddi056
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Human Molecular Genetics, Vol. 14, No. 5 © Oxford University Press 2005; all rights reserved
Genome-wide identification of cis-regulatory sequences controlling blood and endothelial development
1Department of Haematology, Cambridge Institute for Medical Research, Cambridge University, Hills Road, Cambridge CB2 2XY, UK and 2Schools of Biochemistry and Microbiology and Biomedical Sciences, University of Leeds, Leeds LS2 9JT, UK
* To whom correspondence should be addressed. Tel: +44 1223336822; Fax: +44 1223762670; Email: bg200{at}cam.ac.uk
Received October 27, 2004; Revised December 16, 2004; Accepted January 5, 2005
| ABSTRACT |
|---|
|
|
|---|
The development of blood has long served as a model for mammalian cell type specification and differentiation, and yet the underlying transcriptional networks remain ill defined. Characterization of such networks will require genome-wide identification of cis-regulatory sequences and an understanding of how regulatory information is encoded in the primary DNA sequence. Despite progress in lower organisms, genome-wide computational identification of mammalian cis-regulatory sequences has been hindered by increased genomic complexity and cumbersome transgenic assays. Starting with a well-characterized blood stem cell enhancer from the SCL gene, we have developed computational tools for the identification of functionally related gene regulatory sequences. Two candidate enhancers discovered in this way were located in intron 1 of the Fli-1 and PRH/Hex genes, both transcription factors previously implicated in controlling blood and endothelial development. Subsequent transgenic and biochemical analysis demonstrated that the two computationally identified enhancers are functionally related to the SCL stem cell enhancer. The approach developed here may therefore be useful for identifying additional enhancers involved in the control of early blood and endothelial development, and may be adapted to decipher transcriptional regulatory codes controlling a broad range of mammalian developmental programmes.
| INTRODUCTION |
|---|
|
|
|---|
A major challenge of the post-genome era will be the integration of genomic sequences with transcription factor function and expression to decipher the gene regulatory networks which lie at the heart of development (1
Haematopoiesis has long served as a paradigm for adult stem cell systems and markers are available for mature progeny of all haematopoietic lineages as well as for a plethora of progenitors with varying potentials. Studies over the last 20 years have established that transcriptional control is central to the specification and subsequent differentiation of haematopoietic stem cells (HSCs) (8
,9
). With many of the key transcription factors known, haematopoiesis provides a powerful cellular system for the analysis of mammalian gene regulatory networks. The key missing ingredient, particularly for the stem and progenitor cell stages, is a set of experimentally validated gene regulatory regions together with a molecular understanding of their biological activity.
Here, we describe new computational tools for the identification of mammalian enhancers based on evolutionarily conserved patterns of transcription factor binding sites. Starting with a well-characterized blood stem cell enhancer, we demonstrate that this approach permits identification of enhancers with predicted biological activity in vitro and in vivo. Moreover, molecular and transgenic analysis of these new enhancers allowed us to develop a nascent transcription factor network controlling formation of early blood and endothelium. The approach presented here is therefore likely to allow the characterization of transcriptional regulatory codes controlling a broad range of mammalian developmental programmes.
| RESULTS |
|---|
|
|
|---|
To identify transcriptional control regions active during early embryonic haematopoietic development, we have developed a strategy that is based on a haematopoietic stem cell enhancer (+19 enhancer) identified downstream of the SCL transcription factor, a key regulator of haematopoietic stem cell formation (10
625 000 Ets and 189 000 GATA sites (Fig. 1B).
|
To further enrich for putative regulatory elements with sequence properties similar to those of the SCL +19 enhancer, we developed a new program (TFBScluster) and used it to determine the locations of binding site clusters reflecting the combination of sites found in the SCL +19 core enhancer (at least two conserved Ets sites and one conserved GATA site within a 50 bp sequence window). Clusters found in coding exons or >100 kb away from the first or last exons of the nearest swissprot (15
Enhancer activity is frequently dependent on the precise spacing and orientation of its constituent binding sites, and an understanding of these constraints can help in silico identification of bona fide transcriptional control regions (7
). The SCL +19 enhancer contains two Ets sites and one GATA site, all in the forward orientation and separated by 1.52.5 turns (1724 bp) of the double helix in all four mammalian species studied (Fig. 1A). Previous studies have demonstrated that this spatial arrangement of the constituent binding sites is critical for enhancer activity (13
). We, therefore, extracted only those clusters with a spatial organization similar to the SCL +19 enhancer (two Ets followed by one GATA site, all in the forward orientation and each separated by one to three turns of the double helix). This resulted in the identification of 67 clusters, which were localized to 64 genes (Fig. 1B; for localization procedure see Materials and Methods section and http://hscl.cimr.cam.ac.uk/supplementary_donaldson04.html).
These 64 genes included the blood stem cell marker CD34 as well as several other membrane receptors expressed during early blood and endothelial development. Interestingly, the gene list contained 18 transcription factors suggesting that the earlier mentioned strategy may be able to identify those cis-regulatory sequences that constitute the nodes of transcription factor networks. Two of the 18 transcription factors encoding the Fli-1 and PRH (also known as Hex) genes had been linked with blood formation, although their position within a regulatory hierarchy remained ill defined (13
,18
20
). Comparative genomic sequence analysis demonstrated that both the Fli-1 and PRH loci contain multiple non-coding peaks of elevated sequence identity (non-coding homology peaks) (Fig. 2). Indeed, the region of the Fli-1 locus shown in Figure 2 contains more than 60 peaks of homology, all of which are conserved to the same degree as Fli-1 coding exons. However, only the peak situated 12 kb downstream of the start of exon 1 (Fli-1 +12 element) contained an Ets/Ets/GATA cluster similar to the SCL +19 enhancer. Similarly within the PRH locus, only the peak situated in intron 1 (PRH +1 element) contained an analogous Ets/Ets/GATA cluster. The sequence of both the Fli-1 +12 and PRH +1 regions was highly conserved in human/mouse/rat alignments, and revealed the presence of several conserved Ets and GATA sites (Fig. 2, blue shading) in addition to the Ets/Ets/GATA clusters (Fig. 2, yellow shading).
|
To assess enhancer activity of the Fli-1 +12 and PRH +1 homology peaks, 500 and 600 bp fragments were subcloned into luciferase reporter constructs, the activity of which was analysed following stable transfection into haematopoietic cell lines. A 604 bp fragment of the SCL +19 enhancer increased mean luciferase activity 21-fold in a multipotent progenitor cell line (416B), but was inactive in the T-cell line BW5147. Similarly, mean luciferase activity in 416B cells was increased 64-fold and 27-fold by the Fli-1 +12 and PRH +1 elements, whereas both were inactive in BW5147 T-cells (Fig. 3A). Importantly, deletion of the Ets/Ets/GATA cluster from the enhancer fragment abrogated enhancer activity in 416B cells. Taken together, these data demonstrated that genome-wide computational analysis had identified functional enhancers with predictable biological activity in vitro.
|
To compare the biological activity of the Fli-1 +12, PRH +1 and SCL +19 enhancers in vivo, we generated transgenic mice carrying a lacZ reporter transgene driven by the SV40 minimal promoter and the respective enhancers. As previously described, the SV40 promoter alone does not give rise to any consistent pattern of ß-galactosidase expression (21
The expression domains of both Fli-1 and PRH include developing endothelium and a subset of blood cells, including haematopoietic progenitors (22
,23
). Moreover, the PRH +1 enhancer identified in this study lies within a larger 3000 bp fragment shown previously to direct expression to yolk sac blood islands in E7.5 mouse embryos (23
). The Fli-1 +12 and PRH +1 enhancers, therefore, target expression to a subdomain of the normal expression pattern of their corresponding genes. Of particular note, our results demonstrate that both enhancers give rise to a pattern of tissue-specific expression very similar to that generated by the SCL +19 enhancer. The genome-wide strategy described here has therefore resulted in the identification of enhancers with overlapping activity in vivo. With the exception of the one GATA and two Ets sites, the sequences of the SCL +19, Fli-1 +12 and PRH +1 enhancers showed little overall similarity (http://hscl.cimr.cam.ac.uk/supplementary_don04.html) emphasizing the necessity to use motif-based tools rather than sequence homology searches for the computational identification of gene regulatory regions with predicted biological activity.
To integrate the new Fli-1 and PRH enhancers into the regulatory network controlling blood formation, it was important to identify transcription factors that bind the enhancers in vivo. Previous studies have shown that the SCL +19 enhancer is bound by GATA-2 and by the Ets factors Fli-1 and Elf-1 (13
). Chromatin immunoprecipitation experiments were therefore performed using 416B cells to identify transcription factors binding to the Fli-1 +12 and PRH +1 enhancers in vivo. The Fli-1 +12 enhancer was enriched in immunoprecipitates generated by Elf-1, Fli-1 and GATA-2 antibodies, demonstrating that this enhancer was occupied by all three factors. The PRH +1 enhancer was enriched in immunoprecipitates generated using Fli-1 and GATA-2 antibodies with a more modest enrichment obtained with an Elf-1 antibody (Fig. 4A). These results therefore place the two new enhancers into the same regulatory network as the SCL +19 enhancer, and have allowed us to assemble a nascent transcriptional network for early embryonic blood and endothelial development (Fig. 4B).
|
| DISCUSSION |
|---|
|
|
|---|
The data presented in this study demonstrate the utility of a genome-wide computational approach for the identification of cis-regulatory elements with defined biological activity. This is a task of considerable magnitude given the size of the human genome and the complexity of transcriptional regulation in mammals (2
Interestingly, deletion of the SCL +19 enhancer from the endogenous SCL locus in ES-cells appears to have little or no effect on the levels of SCL expression or the ability of ES-cells to differentiate into blood cells either in vitro or in vivo (25
). This observation serves to underline the likely high degree of redundancy of mammalian regulatory elements, a point well illustrated by extensive deletion analyses of
- and ß-globin regulatory elements (26
29
). Dissection of transcription factor networks controlling development is currently most advanced in flies, worms and sea urchins. However, none of these three model organisms lends themselves to deleting specific enhancer sequences from the germline in order to study loss of function or possible redundancy of gene regulatory elements. Enhancer redundancy may therefore not be confined to vertebrates, and should be considered as a potential caveat whenever a given regulatory element is designated a network node connecting two transcription factors. Of note, redundancy of regulatory elements, and their subsequent partial specialization, likely represent important mechanisms by which organisms can evolve additional levels of biological complexity.
Two other recently described strategies promise to provide complementary approaches to genome-wide identification of candidate cis-regulatory elements. Firstly, chromatin immunoprecipitation combined with genomic arrays should allow a description of transcription factor binding patterns within a given cell type (30
,31
). Secondly, genome-wide sampling of regions of open chromatin (32
,33
) might provide a way of concentrating motif searches on the portion of the genome involved in regulating gene expression. However, both of these approaches require purification of significant numbers of cells, a particular problem when studying stem cell systems or early developmental programmes. Deciphering regulatory information encoded in the primary DNA sequence circumvents the need for pure cell populations and has the potential to provide information on cis-regulatory elements operating in all mammalian cell types regardless of the amount of biological material available. The approach used in the current study therefore represents a widely applicable strategy to characterize mammalian gene regulatory networks.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Identification of conserved binding site clusters
Genome-wide positions of consensus binding sites were identified in individual and in aligned genomes available from Genome Bioinformatics at the University of California (Santa Cruz) using a program developed by our group called TFBSsearch, which examines a single sequence or global alignment for conserved non-overlapping binding sites (14
A new program (TFBScluster, http://hscl.cimr.cam.ac.uk/supplementary_don04.html) was developed to identify binding site clusters containing a defined number of conserved sites within a user-defined sequence window. Any overlapping clusters are merged together, which can result in clusters larger than the user defined window size. We have developed a suite of integrated Perl scripts to determine whether a cluster is localized to annotate genes, and to aid subsequent analysis (when localizing clusters to genes, only clusters situated in introns and up to 100 kb 5' and 3' flanking sequences are considered. Therefore, some clusters will not be localized to any gene, and some genes can have several clusters). To identify putative functions of localized genes, external references (via db_xref from Ensembl download files) for each transcript are parsed to find SWISS-PROT accessions (http://www.ebi.ac.uk/swissprot/).
Functional analysis of candidate enhancers
Candidate enhancer sequences were amplified by PCR from human DNA and subcloned into the reporter plasmid pGl2-promoter (Promega). Cell lines were grown and transfected as described (13
). At least eight independent pools of stably transfected cells were assayed for each construct using a microplate luminometer as described previously (13
). Deletions in the Fli-1 and PRH enhancer constructs were generated by PCR and confirmed by sequencing. Chromatin immunoprecipitation assays were performed in the haematopoietic progenitor cell line 416B as described (13
). Primer sequences used to amplify the Fli-1 and PRH/Hex enhancers were Fli-1E-FW TGTTCTGCCACAGGTAAAGGAA, Fli-1E-Rev TATGTTTGCTCCCAACGATCC, PRHE-Fw GACCCTTTCCGTTCATACAGGA and PRHE-Rev AAGTCACATCCCACACAGAGGA.
Transgenic mice were generated using pronuclear injection into CBA3C57/Bl.6 fertilized mouse oocytes which were allowed to divide into two cells prior to implantation into the oviducts of pseudopregnant CD1 female mice. For analysis of embryonic enhancer activity, recipient females were sacrificed and embryos analyzed at E11.5 days of gestation (F0 analysis). Embryos were stained with X-gal for ß-galactosidase activity as described (21
). For genotyping, DNA from yolk sac was prepared and tested for the presence of the lacZ transgene by PCR with an internal myogenin control.
| ACKNOWLEDGEMENTS |
|---|
We are grateful for many stimulating discussions with members of our laboratories and also with D. Vetrie, P. Couttet and D. Bentley (Wellcome Trust Sanger Institute). Work in the authors' laboratory is funded by the Leukaemia Research Fund, Wellcome Trust, BBSRC, Cambridge MIT Institute, an IBM SUR equipment grant and the Canadian Institute of Health Research.
| REFERENCES |
|---|
|
|
|---|
-
Davidson, E.H., Rast, J.P., Oliveri, P., Ransick, A., Calestani, C., Yuh, C.H., Minokawa, T., Amore, G., Hinman, V., Arenas-Mena, C. et al. (2002) A genomic regulatory network for development. Science, 295, 16691678.
[Abstract/Free Full Text] - Levine, M. and Tjian, R. (2003) Transcription regulation and animal diversity. Nature, 424, 147151.[CrossRef][Medline]
- Pilpel, Y., Sudarsanam, P. and Church, G.M. (2001) Identifying regulatory networks by combinatorial analysis of promoter elements. Nat. Genet., 29, 153159.[CrossRef][Web of Science][Medline]
- Segal, E., Shapira, M., Regev, A., Pe'er, D., Botstein, D., Koller, D. and Friedman, N. (2003) Module networks: identifying regulatory modules and their condition-specific regulators from gene expression data. Nat. Genet., 34, 166176.[CrossRef][Web of Science][Medline]
-
Markstein, M., Markstein, P., Markstein, V. and Levine, M.S. (2002) Genome-wide analysis of clustered dorsal binding sites identifies putative target genes in the Drosophila embryo. Proc. Natl Acad. Sci. USA, 99, 763768.
[Abstract/Free Full Text] - Stathopoulos, A., Van Drenth, M., Erives, A., Markstein, M. and Levine, M. (2002) Whole-genome analysis of dorsalventral patterning in the Drosophila embryo. Cell, 111, 687701.[CrossRef][Web of Science][Medline]
- Senger, K., Armstrong, G.W., Rowell, W.J., Kwan, J.M., Markstein, M. and Levine, M. (2004) Immunity regulatory DNAs share common organizational features in Drosophila. Mol. Cell, 13, 1932.[CrossRef][Web of Science][Medline]
-
Shivdasani, R.A. and Orkin, S.H. (1996) The transcriptional control of hematopoiesis. Blood, 87, 40254039.
[Free Full Text] - Gottgens, B. and Green, A.R. (2004) Transcriptional regulation of hematopoietic stem cells. In Lanza, R., Blau, H.M., Melton, D.A., Moore, M., Donnall Thomas, E., Verfaillie, C.M., Weissman, I.L. and West, M. (eds.), Handbook of Stem Cells. Elsevier Academic Press, Vol. 2.
- Lecuyer, E. and Hoang, T. (2004) SCL: from the origin of hematopoiesis to stem cells and leukemia. Exp. Hematol., 32, 1124.[CrossRef][Web of Science][Medline]
- Sanchez, M., Gottgens, B., Sinclair, A.M., Stanley, M., Begley, C.G., Hunter, S. and Green, A.R. (1999) An SCL 3' enhancer targets developing endothelium together with embryonic and adult haematopoietic progenitors. Development, 126, 38913904.[Abstract]
-
Sanchez, M.J., Bockamp, E.O., Miller, J., Gambardella, L. and Green, A.R. (2001) Selective rescue of early haematopoietic progenitors in Scl(/) mice by expressing Scl under the control of a stem cell enhancer. Development, 128, 48154827.
[Abstract/Free Full Text] - Gottgens, B., Nastos, A., Kinston, S., Piltz, S., Delabesse, E.C., Stanley, M., Sanchez, M.J., Ciau-Uitz, A., Patient, R. and Green, A.R. (2002) Establishing the transcriptional programme for blood: the SCL stem cell enhancer is regulated by a multiprotein complex containing Ets and GATA factors. EMBO J., 21, 30393050.[CrossRef][Web of Science][Medline]
-
Chapman, M.A., Donaldson, I.J., Gilbert, J., Grafham, D., Rogers, J., Green, A.R. and Gottgens, B. (2004) Analysis of multiple genomic sequence alignments: a web resource, online tools, and lessons learned from analysis of mammalian SCL loci. Genome Res., 14, 313318.
[Abstract/Free Full Text] -
Boeckmann, B., Bairoch, A., Apweiler, R., Blatter, M.C., Estreicher, A., Gasteiger, E., Martin, M.J., Michoud, K., O'Donovan, C., Phan, I. et al. (2003) The SWISS-PROT protein knowledgebase and its supplement TrEMBL in 2003. Nucleic Acids Res., 31, 365370.
[Abstract/Free Full Text] -
Kolbe, D., Taylor, J., Elnitski, L., Eswara, P., Li, J., Miller, W., Hardison, R. and Chiaromonte, F. (2004) Regulatory potential scores from genome-wide three-way alignments of human, mouse, and rat. Genome Res., 14, 700707.
[Abstract/Free Full Text] -
Loots, G.G., Ovcharenko, I., Pachter, L., Dubchak, I. and Rubin, E.M. (2002) rVista for comparative sequence-based discovery of functional transcription factor binding sites. Genome Res., 12, 832839.
[Abstract/Free Full Text] - Walmsley, M., Ciau-Uitz, A. and Patient, R. (2002) Adult and embryonic blood and endothelium derive from distinct precursor populations which are differentially programmed by BMP in Xenopus. Development, 129, 56835695.[CrossRef][Web of Science][Medline]
- Liao, W., Ho, C.Y., Yan, Y.L., Postlethwait, J. and Stainier, D.Y. (2000) Hhex and scl function in parallel to regulate early endothelial and blood differentiation in zebrafish. Development, 127, 43034313.[Abstract]
-
Guo, Y., Chan, R., Ramsey, H., Li, W., Xie, X., Shelley, W.C., Martinez-Barbera, J.P., Bort, B., Zaret, K., Yoder, M. et al. (2003) The homeoprotein Hex is required for hemangioblast differentiation. Blood, 102, 24282435.
[Abstract/Free Full Text] - Sinclair, A.M., Gottgens, B., Barton, L.M., Stanley, M.L., Pardanaud, L., Klaine, M., Gering, M., Bahn, S., Sanchez, M., Bench, A.J. et al. (1999) Distinct 5' SCL enhancers direct transcription to developing brain, spinal cord, and endothelium: neural expression is mediated by GATA factor binding sites. Dev. Biol., 209, 128142.[CrossRef][Web of Science][Medline]
- Brown, L.A., Rodaway, A.R., Schilling, T.F., Jowett, T., Ingham, P.W., Patient, R.K. and Sharrocks, A.D. (2000) Insights into early vasculogenesis revealed by expression of the ETS-domain transcription factor Fli-1 in wild-type and mutant zebrafish embryos. Mech. Dev., 90, 237252.[CrossRef][Web of Science][Medline]
- Rodriguez, T.A., Casey, E.S., Harland, R.M., Smith, J.C. and Beddington, R.S. (2001) Distinct enhancer elements control Hex expression during gastrulation and early organogenesis. Dev. Biol., 234, 304316.[CrossRef][Web of Science][Medline]
- Beer, M.A. and Tavazoie, S. (2004) Predicting gene expression from sequence. Cell, 117, 185198.[CrossRef][Web of Science][Medline]
-
Gottgens, B., Broccardo, C., Sanchez, M.J., Deveaux, S., Murphy, G., Gothert, J.R., Kotsopoulou, E., Kinston, S., Delaney, L., Piltz, S. et al. (2004) The scl +18/19 stem cell enhancer is not required for hematopoiesis: identification of a 5' bifunctional hematopoietic-endothelial enhancer bound by Fli-1 and Elf-1. Mol. Cell. Biol., 24, 18701883.
[Abstract/Free Full Text] -
Anguita, E., Sharpe, J.A., Sloane-Stanley, J.A., Tufarelli, C., Higgs, D.R. and Wood, W.G. (2002) Deletion of the mouse alpha-globin regulatory element (HS -26) has an unexpectedly mild phenotype. Blood, 100, 34503456.
[Abstract/Free Full Text] -
Bender, M.A., Roach, J.N., Halow, J., Close, J., Alami, R., Bouhassira, E.E., Groudine, M. and Fiering, S.N. (2001) Targeted deletion of 5'HS1 and 5'HS4 of the beta-globin locus control region reveals additive activity of the DNaseI hypersensitive sites. Blood, 98, 20222027.
[Abstract/Free Full Text] -
Bender, M.A., Reik, A., Close, J., Telling, A., Epner, E., Fiering, S., Hardison, R. and Groudine, M. (1998) Description and targeted deletion of 5' hypersensitive site 5 and 6 of the mouse beta-globin locus control region. Blood, 92, 43944403.
[Abstract/Free Full Text] - Ley, T.J., Hug, B., Fiering, S., Epner, E., Bender, M.A. and Groudine, M. (1998) Reduced beta-globin gene expression in adult mice containing deletions of locus control region 5' HS-2 or 5' HS-3. Ann. N Y Acad. Sci., 850, 4553.[CrossRef][Web of Science][Medline]
-
Odom, D.T., Zizlsperger, N., Gordon, D.B., Bell, G.W., Rinaldi, N.J., Murray, H.L., Volkert, T.L., Schreiber, J., Rolfe, P.A., Gifford, D.K. et al. (2004) Control of pancreas and liver gene expression by HNF transcription factors. Science, 303, 13781381.
[Abstract/Free Full Text] - Cawley, S., Bekiranov, S., Ng, H.H., Kapranov, P., Sekinger, E.A., Kampa, D., Piccolboni, A., Sementchenko, V., Cheng, J., Williams, A.J. et al. (2004) Unbiased mapping of transcription factor binding sites along human chromosomes 21 and 22 points to widespread regulation of noncoding RNAs. Cell, 116, 499509.[CrossRef][Web of Science][Medline]
-
Crawford, G.E., Holt, I.E., Mullikin, J.C., Tai, D., Blakesley, R., Bouffard, G., Young, A., Masiello, C., Green, E.D., Wolfsberg, T.G. et al. (2004) Identifying gene regulatory elements by genome-wide recovery of DNase hypersensitive sites. Proc. Natl Acad. Sci. USA, 101, 992997.
[Abstract/Free Full Text] -
Sabo, P.J., Humbert, R., Hawrylycz, M., Wallace, J.C., Dorschner, M.O., McArthur, M. and Stamatoyannopoulos, J.A. (2004) Genome-wide identification of DNaseI hypersensitive sites using active chromatin sequence libraries. Proc. Natl Acad. Sci. USA, 101, 45374542.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
R. C. Hardison It takes (LMO) 2 to tango Blood, June 4, 2009; 113(23): 5693 - 5693. [Full Text] [PDF] |
||||
![]() |
J.-R. Landry, N. Bonadies, S. Kinston, K. Knezevic, N. K. Wilson, S. H. Oram, M. Janes, S. Piltz, M. Hammett, J. Carter, et al. Expression of the leukemia oncogene Lmo2 is controlled by an array of tissue-specific elements dispersed over 100 kb and bound by Tal1/Lmo2, Ets, and Gata factors Blood, June 4, 2009; 113(23): 5783 - 5792. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. K. Wilson, D. Miranda-Saavedra, S. Kinston, N. Bonadies, S. D. Foster, F. Calero-Nieto, M. A. Dawson, I. J. Donaldson, S. Dumon, J. Frampton, et al. The transcriptional program controlled by the stem cell leukemia gene Scl/Tal1 during early embryonic hematopoietic development Blood, May 28, 2009; 113(22): 5456 - 5465. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Pimanda, W. Y. I. Chan, N. K. Wilson, A. M. Smith, S. Kinston, K. Knezevic, M. E. Janes, J.-R. Landry, A. Kolb-Kokocinski, J. Frampton, et al. Endoglin expression in blood and endothelium is differentially regulated by modular assembly of the Ets/Gata hemangioblast code Blood, December 1, 2008; 112(12): 4512 - 4522. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Smith, M.-J. Sanchez, G. A. Follows, S. Kinston, I. J. Donaldson, A. R. Green, and B. Gottgens A novel mode of enhancer evolution: The Tal1 stem cell enhancer recruited a MIR element to specifically boost its activity Genome Res., September 1, 2008; 18(9): 1422 - 1432. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-R. Landry, S. Kinston, K. Knezevic, M. F.T.R. de Bruijn, N. Wilson, W. T. Nottingham, M. Peitz, F. Edenhofer, J. E. Pimanda, K. Ottersbach, et al. Runx genes are direct targets of Scl/Tal1 in the yolk sac and fetal liver Blood, March 15, 2008; 111(6): 3005 - 3014. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. T. Nottingham, A. Jarratt, M. Burgess, C. L. Speck, J.-F. Cheng, S. Prabhakar, E. M. Rubin, P.-S. Li, J. Sloane-Stanley, J. Kong-a-San, et al. Runx1-mediated hematopoietic stem-cell emergence is controlled by a Gata/Ets/SCL-regulated enhancer Blood, December 15, 2007; 110(13): 4188 - 4197. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Pimanda, K. Ottersbach, K. Knezevic, S. Kinston, W. Y. I. Chan, N. K. Wilson, J.-R. Landry, A. D. Wood, A. Kolb-Kokocinski, A. R. Green, et al. Gata2, Fli1, and Scl form a recursively wired gene-regulatory circuit during early hematopoietic development PNAS, November 6, 2007; 104(45): 17692 - 17697. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Y. I. Chan, G. A. Follows, G. Lacaud, J. E. Pimanda, J.-R. Landry, S. Kinston, K. Knezevic, S. Piltz, I. J. Donaldson, L. Gambardella, et al. The paralogous hematopoietic regulators Lyl1 and Scl are coregulated by Ets and GATA factors, but Lyl1 cannot rescue the early Scl-/- phenotype Blood, March 1, 2007; 109(5): 1908 - 1916. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Pimanda, I. J. Donaldson, M. F. T. R. de Bruijn, S. Kinston, K. Knezevic, L. Huckle, S. Piltz, J.-R. Landry, A. R. Green, D. Tannahill, et al. The SCL transcriptional network and BMP signaling pathway interact to regulate RUNX1 activity PNAS, January 16, 2007; 104(3): 840 - 845. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, Y. Zhang, Y. Cheng, Y. Zhou, D. C. King, J. Taylor, F. Chiaromonte, J. Kasturi, H. Petrykowska, B. Gibb, et al. Experimental validation of predicted mammalian erythroid cis-regulatory modules Genome Res., December 1, 2006; 16(12): 1480 - 1492. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. R. Mollica, J. T. B. Crawley, K. Liu, J. B. Rance, P. N. Cockerill, G. A. Follows, J.-R. Landry, D. J. Wells, and D. A. Lane Role of a 5'-enhancer in the transcriptional regulation of the human endothelial cell protein C receptor gene Blood, August 15, 2006; 108(4): 1251 - 1259. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. J. Donaldson and B. Gottgens TFBScluster web server for the identification of mammalian composite regulatory elements. Nucleic Acids Res., July 1, 2006; 34(Web Server issue): W524 - W528. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Pimanda, W.Y. I. Chan, I. J. Donaldson, M. Bowen, A. R. Green, and B. Gottgens Endoglin expression in the endothelium is regulated by Fli-1, Erg, and Elf-1 acting on the promoter and a -8-kb enhancer Blood, June 15, 2006; 107(12): 4737 - 4745. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ovcharenko and M. A. Nobrega Identifying synonymous regulatory elements in vertebrate genomes Nucleic Acids Res., July 1, 2005; 33(suppl_2): W403 - W407. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. J. Donaldson, M. Chapman, and B. Gottgens TFBScluster: a resource for the characterization of transcriptional regulatory networks Bioinformatics, July 1, 2005; 21(13): 3058 - 3059. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








