Human Molecular Genetics

Human Molecular Genetics Advance Access originally published online on January 20, 2005
Human Molecular Genetics 2005 14(5):693-701; doi:10.1093/hmg/ddi065

This Article Abstract FREE Full Text (PDF) All Versions of this Article: 14/5/693    most recent ddi065v1 Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (47) Request Permissions Google Scholar Articles by Howlett, N. G. Articles by Glover, T. W. Search for Related Content PubMed PubMed Citation Articles by Howlett, N. G. Articles by Glover, T. W. Social Bookmarking          What's this?

Human Molecular Genetics, Vol. 14, No. 5 © Oxford University Press 2005; all rights reserved

The Fanconi anemia pathway is required for the DNA replication stress response and for the regulation of common fragile site stability

Niall G. Howlett^1,*, Toshiyasu Taniguchi^3,, Sandra G. Durkin¹, Alan D. D'Andrea³ and Thomas W. Glover^1,2

¹Department of Human Genetics, ²Pediatrics, University of Michigan, Ann Arbor, MI 48109, USA and ³Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115, USA

^* To whom correspondence should be addressed at: Department of Human Genetics, 4909 Buhl, Box 0618, 1241 E. Catherine Street, University of Michigan, Ann Arbor, MI 48109-0618, USA. Tel: +1 7347636169; Fax: +1 7347633784; Email: niallg{at}umich.edu

Received November 12, 2004; Revised January 5, 2005; Accepted January 14, 2005

	ABSTRACT

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
Fanconi anemia (FA) is a rare multi-genic, autosomal and X-linked recessive disorder characterized by hematological abnormalities, developmental defects and increased cancer susceptibility. Patient-derived FA cells display heightened sensitivity to DNA cross-linking agents such as mitomycin C (MMC). In response to DNA damaging agents, and during S-phase of the cell cycle, the FA pathway is activated via the mono-ubiquitination of FANCD2 (FANCD2-Ub), signaling its translocation to discrete nuclear foci, where it co-localizes with the central DNA repair proteins BRCA1 and RAD51. However, the exact function of activated FANCD2-Ub remains unclear. Here, we have characterized the role of the FA pathway in response to DNA replicative stress by aphidicolin (APH) and hydroxyurea (HU). The FA pathway is strongly activated in response to both agents. In addition, using patient-derived FA cell lines and siRNA targeting FANCD2, we demonstrate a functional requirement for the FA pathway in response to low doses of APH: a replicative stress treatment known to result in chromosome breakage at common fragile sites. Both the total number of chromosome gaps and breaks and breaks at the specific common fragile sites FRA3B and FRA16D were significantly elevated in the absence of an intact FA pathway. Furthermore, we demonstrate that APH activates the mono-ubiquitination of both FANCD2 and PCNA and the phosphorylation of RPA2, signaling processive DNA replication arrest. Following APH treatment, FANCD2-Ub co-localizes with PCNA (early) and RPA2 (late) in discrete nuclear foci. Our results demonstrate an integral role for the FA pathway in the DNA replication stress response.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
Fanconi anemia (FA) is a rare autosomal and X-linked recessive disorder characterized by specific developmental abnormalities, hematological defects and increased susceptibility to cancer (1,2). FA patients are particularly susceptible to acute myelogenous leukemia, myelodysplasia and squamous cell carcinomas of the head, neck and oral cavities (3). At the cellular level, FA is defined by heightened sensitivity to DNA interstrand cross-linking agents such as MMC and cisplatin. There are currently 11 defined FA complementation groups (A, B, C, D1, D2, E, F, G, I, J and L), and the genes underlying nine of these subtypes have been cloned (2,4–6). The FA proteins and the breast cancer-associated proteins BRCA1 and BRCA2 interact in a common pathway essential in the cellular DNA damage response. The FA proteins A, B, C, E, F, G and L assemble in a multi-subunit nuclear complex (6–9). Following exposure to DNA damaging agents, and also during S-phase of the cell cycle, the core FA complex activates the mono-ubiquitination of lysine 561 of the FANCD2 protein, signaling its activation and translocation to discrete nuclear foci, where it co-localizes with the key DNA repair proteins BRCA1 and RAD51 (10,11). Mono-ubiquitination of FANCD2 promotes loading of the BRCA2 protein into chromatin complexes and facilitates the assembly of DNA damage-inducible RAD51 nuclear foci (12,13). Although mono-ubiquitination of FANCD2 is essential for cellular MMC resistance, its exact biochemical function in the DNA damage response and during DNA replication is as yet undefined (11).

The DNA replication process itself has become increasingly recognized as a potential source of chromosomal instability. Replication fork stalling upon encounter of a lesion-damaged template is thought to invoke a homologous recombination-dependent replication restart mechanism (14,15). DNA replication, repair and recombination processes have to be tightly coordinated in order to maintain genomic integrity. Up-regulation of FANCD2-Ub protein during S-phase and localization of FANCD2-Ub to RAD51- and BRCA1-containing nuclear foci during S-phase (10), strongly suggest a role for the FA pathway at the DNA replication–recombination interface.

One manifestation of DNA replication stress is chromosome instability at common fragile sites. Common fragile sites are chromosomal loci that preferentially exhibit gaps and breaks when cells have been cultured under certain conditions of replicative stress such as folate deficiency or treatment with low concentrations of the DNA polymerase and inhibitor APH (16). Common fragile sites are ‘hot spots’ for increased sister chromatid exchanges (SCE), translocations and preferred sites of viral integration. Furthermore, many fragile sites and their associated genes are rearranged or deleted in tumor cells (17). It is hypothesized that fragile sites represent structurally distinct, late-replicating regions particularly susceptible to replication fork stalling or collapse and subsequent incomplete replication and chromosome breakage. Thus, fragile site expression represents a physiologically important means of assessing the mechanisms of replication fork distress signaling and resolution.

Here, using FA patient-derived cell lines and small interfering RNA (siRNA) directed against the FANCD2 gene, we have assessed the impact of disruption of the FA pathway on DNA replication stress signal transduction pathways in general and on common fragile site stability. Abrogation of the FA pathway leads to an increase in APH-induced chromosome gaps and breaks and instability specifically at common fragile sites. Furthermore, APH up-regulates the mono-ubiquitination of both FANCD2 and the sliding clamp protein proliferating cell nuclear antigen, PCNA, and the phosphorylation of the 32 kDa subunit of the single-stranded DNA (ssDNA) binding replication protein A heterotrimer, RPA2, and promotes their assembly into discrete nuclear foci. These events most likely signal processive DNA replication arrest and the recruitment of DNA repair factors required for homologous recombination-dependent replication restart. Our findings indicate that the FA pathway plays an integral role in the response to DNA replication perturbation.

	RESULTS

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
APH and HU strongly activate the FA pathway
IMR90 SV40-transformed fibroblasts were exposed to 1 mM HU, 0.4 and 4.0 µM APH for 24 h and whole-cell lysates were probed with an anti-FANCD2 antibody. Twenty-four hours following 1.0 mM HU and 4.0 µM APH treatment FANCD2-Ub was almost exclusively present, as indicated by FANCD2L (long form)/FANCD2S (short form) (L/S) ratios of 1.8 and 1.6, respectively (Fig. 1A, lanes 4 and 6). Similarly, even at 0.4 µM APH, which does not completely arrest cell cycle progression yet leads to an increase in fragile site breakage, FANCD2 was mono-ubiquitinated to a significant extent, with an L/S ratio of 1.4 (Fig. 1A, lane 7). Replication inhibition by 0.4 and 4.0 µM APH and 1.0 mM HU also strongly activated the formation of discrete FANCD2 nuclear foci in both IMR90 and HeLa cells. Following 24 h exposure to 0.4 and 4.0 µM APH, 50 and 80% of HeLa nuclei displayed greater than 10 discrete FANCD2 nuclear foci, respectively (Fig. 1B and C).

View larger version (30K): [in this window] [in a new window]   Figure 1. Activation of the FA pathway in response to APH and HU in IMR90 and HeLa fibroblasts. (A) Mono-ubiquitination of FANCD2 following exposure to high and low dose APH and HU in IMR90 fibroblasts. The numbers underneath the FANCD2 lanes indicate the ratio of FANCD2L : FANCD2S. Equal protein loading was confirmed by probing for -tubulin. (B) and (C) APH and HU induces the formation of FANCD2-Ub nuclear foci. HeLa cells were untreated or exposed to 0.4 or 4.0 µM APH or 1 mM HU for 24 h, fixed and stained with polyclonal FANCD2 E35 (green) antibody. The percentage of nuclei with greater than 10 FANCD2 discrete foci were quantified for each treatment. At least 200 nuclei were scored for each treatment. Error bars represent the standard errors of the means. Experiments were preformed at least three times.

 
Patient-derived FA lymphoblasts display increased APH-induced gaps and breaks and specific fragile site instability
Patient-derived FA lymphoblasts and their isogenic FANC cDNA complemented pairs were exposed to 0.4 µM APH for 48 h and the number of ensuing chromatid and chromosome gaps and breaks were scored (Fig. 2 and Table 1). FA-A and FA-D2 lymphoblasts displayed 3–5-fold increased levels of gaps and breaks when compared with corrected FA-A + FANCA and FA-D2 + FANCD2 lymphoblasts, respectively, and a wild-type lymphoblast line (Fig. 2B). These differences were highly significant, with P-values <0.0001, in both cases. The FA-B lymphoblast line HSC230, which also expresses a C-terminal truncated BRCA2 protein (5), had an 4-fold increase in gaps and breaks compared with wild-type lymphoblasts (P<0.0001) (Fig. 2B). Figure 2C shows the characteristic chromosomal anomalies observed following treatment of patient-derived FA-B cells with MMC (tri- and quadri-radials) and APH (chromosome and chromatid gaps and breaks). Trypsin–Giemsa banding was used to confirm the occurrence of gaps and breaks at common fragile sites (Table 1, Fig. 2C). Common fragile site breakage was significantly elevated in FA patient-derived lymphoblasts following APH treatment. For example, for FA-A lymphoblasts 20% of FRA3B loci examined were broken, compared with 6% broken in wild-type cells (P=0.005) (Table 1, Fig. 2Ciii).

View larger version (36K): [in this window] [in a new window]   Figure 2. Patient-derived FA lymphoblasts display increased APH-induced chromosome instability. (A) FANCD2 western blot of the cell lines used. Cellular proteins were separated and immunoblotted with anti-FANCD2 FI-17 antibody. (B) Wild-type, FA-A, FA-A + FANCA, FA-D2, FA-D2 + FANCD2 and FA-B lymphoblasts were untreated (white bars) or exposed to 0.4 µM APH (gray bars) for 48 h, and metaphases examined for total gaps and breaks. At least 50 metaphases were scored for each treatment. Error bars indicate the 95% confidence interval. (C) i and ii show partial representative Giemsa-stained metaphases of FA-B lymphoblasts treated with 20 ng ml–1 MMC and 0.4 µM APH. Quadri- and tri-radial chromosomes, and chromosome and chromatid gaps and breaks are indicated by arrows. iii shows a grayscale representation of a DAPI-stained partial metaphase of FA-B lymphoblasts. Arrows indicate FRA3B breakage on both homologs of chromosome 3.

 

View this table: [in this window] [in a new window]   Table 1. Distribution of APH-induced gaps and breaks in wild-type, FA and complemented FA lymphoblasts

 
Disruption of the FA pathway using FANCD2 siRNA results in increased total gaps and breaks and specific fragile site instability
Using an siRNA specific for FANCD2, we significantly reduced FANCD2 protein expression in the diploid human HCT116 colon carcinoma cell line (Fig. 3A). HCT116 was chosen for this particular experiment because of its relatively normal karyotype and high transfection efficiency (18–20). After 24 h treatment with 0.2 and 0.4 µM APH, HCT116 cells transfected with FANCD2 siRNA were characterized by a 3–4-fold increase in total gaps and breaks when compared with control siRNA transfected cells, a highly significant difference (P<0.001) in all cases (Fig. 3B). Induction of chromosome gaps and breaks at both FRA3B and FRA16D fragile sites, as detected by FISH, was also increased 2–3-fold, at 0.2 and 0.4 µM APH, in cells transfected with FANCD2 siRNA when compared with control siRNA transfected cells (Fig. 3C). As with total gaps and breaks, the differences observed in FRA3B and FRA16D instability were significant; for 0.2 µM APH, P=0.006 and 0.03, respectively, and for 0.4 µM APH, P<0.0001 in both cases, as calculated using Fishers exact test.

View larger version (21K): [in this window] [in a new window]   Figure 3. Human HCT116 cells depleted for the FANCD2 protein via siRNA have increased total gaps and breaks and elevated fragile site instability following exposure to APH. (A) FANCD2 western blot demonstrating significantly reduced FANCD2 protein expression in HCT116 cells transfected with a siRNA directed against FANCD2 (lane 4), compared with a non-specific control siRNA (siCtrl.) sequence (lane 3). NBS1 is used as a loading control for lanes 3 and 4. (B) Increased total gaps and breaks in siFANCD2 (gray bars) transfected HCT116 cells compared with siCtrl. (white bars) transfected cells following exposure to APH. (C) Frequency (%) of gaps and breaks at specific fragile sites FRA3B and FRA16D in HCT116 cells after transfection with FANCD2 siRNA (gray bars) or control siRNA (white bars). At least 100 specific fragile site probe hybridizations were examined for each data set. Frequency of fragile site breakage is presented as the percentage of chromosome 3 or 16 homologs with breaks at FRA3B or FRA16D, respectively. Error bars represent the 95% confidence interval. Experiments were preformed at least three times.

 
Replication disruption up-regulates the mono-ubiquitination of both FANCD2 and PCNA, and the phosphorylation of RPA2
It has recently been reported that mono-ubiquitination of the sliding clamp protein PCNA following UV irradiation treatment might signal the switch from processive DNA replication to error-prone translesion synthesis, upon replication fork arrest (21). Phosphorylation of the RPA subunit RPA2 following DNA damage has also been associated with inactivation of RPA and DNA replication arrest (22). We, therefore, examined FANCD2 mono-ubiquitination, PCNA mono-ubiquitination and RPA2 phosphorylation following exposure to high concentrations of APH and HU treatment known to induce replication arrest in HeLa cells (Fig. 4). Twenty-four hours following treatment with either 4.0 µM APH or 1.0 mM HU, a slower migrating form of PCNA, corresponding to the expected size of mono-ubiquitinated PCNA (40 kDa), was observed (Fig. 4B, lanes 4 and 7), consistent with the observation of Kannouche et al. 2004 (21). To confirm that this slower migrating PCNA isoform was indeed mono-ubiquitinated PCNA, we stably transfected HeLa with HA-tagged PCNA and a HA-tagged PCNA containing a lysine 164 to arginine change (HA-PCNA-K164R), the site of PCNA ubiquitination (23). Consistently, an anti-HA-reactive band of the predicted size was observed for HeLa + HA-PCNA, but not for HeLa + HA-PCNA-K164R, after treatment with 4.0 µM APH for 24 h (Fig. 4C, lanes 8 and 9). Also, following APH and HU treatment, we observed a slower migrating form of the RPA2 subunit of RPA indicating that both APH and HU-mediated replication arrest stimulates RPA2 phosphorylation (Fig. 4D, lanes 4, 6 and 7) (22).

View larger version (30K): [in this window] [in a new window]   Figure 4. APH and HU-induced mono-ubiquitination of FANCD2 and PCNA, and RPA2 phosphorylation in HeLa cells. (A) FANCD2 western blot demonstrating up-regulation of FANCD2 mono-ubiquitination following 24 h exposure to APH (lane 4) and HU (lane 7). (B) PCNA western blot demonstrating up-regulation of PCNA mono-ubiquitination following 24 h exposure to APH (lane 4) and HU (lane 7). (C) Anti-HA blot of HeLa stably transfected with pMMP-HA-PCNA and pMMP-HA-PCNA-K164R, respectively, 24 h following exposure to 4.0 µM APH. M, MagicMark XP protein standard (Invitrogen). (D) RPA2 western blot demonstrating RPA2 phosphorylation 24 h following APH (lane 4) and 4 and 24 h following HU (lanes 6 and 7) treatment. (E) Equal protein loading was confirmed by stripping and re-probing the membrane with an anti--tubulin antibody.

 
The presence of an intact FA pathway was not required for APH-induced PCNA mono-ubiquitination or RPA2 phosphorylation. Strong PCNA-Ub and phosphorylated RPA2 bands were observed in both PD20F (FA-D2) + pMMP-empty fibroblasts and complemented PD20F + pMMP-FANCD2, 24 h following exposure to 4.0 µM APH (data not shown).

Mono-ubiquitinated FANCD2 and PCNA, and FANCD2-Ub and RPA2 co-localize strongly at 4 and 24 h, respectively, following treatment with APH and HU
We next examined the kinetics of FANCD2, PCNA and RPA2 nuclear foci formation following APH and HU treatment in HeLa (Fig. 5). Following treatment with APH or HU, we observed an increase in the number of nuclei with focal, as opposed to distributive, PCNA and RPA2 staining (24) (Fig. 5A and B). After exposure to high concentrations of APH and HU, strong overlap between PCNA and FANCD2, and RPA2 and FANCD2 was observed at 4 h and 24 h, respectively. After treatment with 4.0 µM APH or 1.0 mM HU for 4 h, 83 and 77%, respectively, of nuclei displayed strong PCNA and FANCD2 co-localization (Fig. 5A and B). Conversely, at 24 h following treatment with 4.0 µM APH or 1.0 mM HU, 87 and 73%, respectively, of nuclei displayed strong RPA2 and FANCD2 co-localization (Fig. 5A and B). Interestingly, 4 h following exposure to 0.4 µM APH, a concentration used to induce fragile site instability, strong co-localization between PCNA and FANCD2 was evident, when 66% of nuclei with PCNA foci co-stained for FANCD2 (Fig. 5B). However, at this dose and time point, very few RPA2 nuclear foci were observed.

View larger version (60K): [in this window] [in a new window]   Figure 5. FANCD2, PCNA and RPA2 nuclear foci formation in response to DNA replication inhibition in HeLa cells. HeLa cells were either untreated or treated with 0.4 and 4.0 µM APH, or 1.0 mM HU for 4 and 24 h, fixed and co-stained with anti-FANCD2 (green) and anti-PCNA (red) (A, top panel), or anti-FANCD2 (green) and anti-RPA2 (red) (A, bottom panel). Greater numbers of FANCD2 (green) nuclear foci, than PCNA or RPA2 (both red), were consistently observed. Where green and red signals overlap (merge, A) a yellow pattern is seen, indicating co-localization of FANCD2, and PCNA and RPA2, respectively. (B) Quantification of FANCD2 (white bars) and PCNA (gray bars) foci-positive nuclei (B, top panel), and FANCD2 (white bars) and RPA2 (gray bars) foci-positive nuclei (B, bottom panel), 4 and 24 h following treatment with 0.4 and 4.0 µM APH or 1.0 mM HU. The black bars indicate the percentage of nuclei with greater than five discrete double positive, overlapping foci. Error bars represent the standard errors of the means. Experiments were preformed at least three times.

 

	DISCUSSION

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
Mono-ubiquitination of the FANCD2 protein is highly regulated during S-phase. Through association with BRCA1 and RAD51 during S-phase, it has been proposed that the FANCD2-Ub protein might play a role in an S-phase-dependent DNA repair process, e.g. homologous recombination (10). Here we describe that activation of the FA pathway occurs under conditions of replicative stress, specifically APH-induced DNA polymerase and inhibition, and HU-mediated inhibition of deoxyribonucleotide reductase, as reported elsewhere (25). Both agents have previously been demonstrated to strongly stimulate homologous recombination between two inactive neo repeats (26). We also demonstrate that the kinetics of FANCD2 and PCNA mono-ubiquitination, as well as phosphorylation of RPA2 are similar following replication arrest. Early, following high and low dose APH treatment, FANCD2-Ub co-localizes with PCNA. Conversely, only at high concentrations of APH for 24 h, FANCD2-Ub co-localizes with RPA2. In addition, we have established a functional requirement for activation of the FA pathway in response to DNA replication perturbation. Abrogation of the FA pathway increases chromosome instability, particularly at common fragile sites, consequent to DNA polymerase and inhibition by low concentrations of APH.

Our findings are consistent with several recent studies on early and late signaling events in the FA pathway and on the regulation of fragile site stability. First, using several in vitro ATR inactivation methods and Seckel syndrome patient-derived cells, the ATR kinase has been established as a critical regulator of fragile site stability, even in the absence of replicative inhibitors (19,27). Using similar approaches, the ATR kinase has been shown to be required for activation of the FA pathway (25). Andreassen et al. (25) have also demonstrated that the ATR kinase phosphorylates several GST–FANCD2 fragments (25). Thus, it seems likely that following DNA replication stress, the ATR kinase directly phosphorylates FANCD2 and promotes its mono-ubiquitination. Whether ATR-mediated FANCD2 phosphorylation is required for damage-inducible FANCD2 mono-ubiquitination remains to be established. Nevertheless, our results establish a functional requirement for the ATR–FANCD2 signal transduction pathway in the repair of chromosome gaps and breaks following DNA replication perturbation.

The ssDNA binding protein complex RPA, recently established as a critical sensor of DNA damage required for activation of the ATR–ATRIP heterodimer (28), has also been demonstrated to be required for DNA damage-induced FANCD2 mono-ubiquitination (25). We demonstrate similar kinetics of mono-ubiquitination of FANCD2 and RPA2 phosphorylation following DNA replication inhibition. Furthermore, 24 h following replication inhibition, FANCD2 and RPA2 co-localize strongly in discrete nuclear foci. Our results and those of others suggest that phosphorylated RPA2 may recruit mono-ubiquitinated FANCD2 to sites of replication inhibition-induced ssDNA (25). Chromatin-associated FANCD2-Ub subsequently acts to recruit essential homologous recombination factors such as BRCA2 and RAD51 (10,12). Mono-ubiquitinated FANCD2 has recently been demonstrated to be required for the recruitment of BRCA2 and RAD51 to chromatin (12). Furthermore, cells defective in either BRCA1 (20) or BRCA2 display elevated fragile site instability, consistent with a role for these proteins in the repair of stalled DNA replication forks (29).

Post-translational modification of the sliding clamp protein PCNA in yeast and humans has been recently reported to mediate the switch between processive DNA synthesis and UV-induced error-prone translesion synthesis (21,23,30). Saccharomyces cerevisiae PCNA protein is modified via mono- and multi-ubiquitin-, and SUMO-conjugation during S-phase of the cell cycle and following exposure to DNA damaging agents such as MMS and UV irradiation (23,30). Here we also observed mono-ubiquitination of PCNA following both APH and HU treatment. Consistent with the observations of Kannouche et al., we did not observe any poly-ubiquitination or SUMO-ylation of PCNA; however, we cannot rule out the existence of these PCNA isoforms in human cells. The RAD6 and RAD18 proteins have been established as the ubiquitin conjugating system for PCNA lysine 164 in yeast and humans, whereas PHF9/FANCL has been established as the probable FANCD2 E3 ubiquitin ligase (4,23). It remains to be seen whether the mono-ubiquitinated PCNA and FANCD2 proteins share a common de-ubiquitination mechanism, signaling replication fork repair and restart.

We propose a model whereby following replication arrest or stalling, PCNA and FANCD2 proteins become mono-ubiquitinated, signaling the arrest of processive DNA synthesis. At high concentrations of APH and HU, which could result in replication fork collapse, mono-ubiquitinated FANCD2 is subsequently recruited to phosphorylated RPA2-coated ssDNA. Here, FANCD2 acts to recruit DNA repair factors such as BRCA2 and RAD51, potentially signaling a homologous recombination-mediated replication fork restart process. Our findings have significant implications for our understanding of the repair mechanisms and signal transduction pathways activated upon DNA replication fork arrest. Furthermore, given the strong association of many fragile sites with tumorigenesis, our results provide further insight into the increased cancer susceptibility of FA patients.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
Cell lines and culture conditions
PD20L (FA-D2), HSC72L (FA-A), HSC230L (FA-B) and PD7L (wild-type) Epstein–Barr virus-transformed lymphoblasts were grown in RPMI 1640 medium with 15% v/v FBS. HSC72L (FA-A) and PD20L (FA-D2) lymphoblasts were complemented with the pMMP-FANCA and pMMP-FANCD2 retroviral vectors (11), respectively, and maintained in RPMI 1640 medium supplemented with 1 µg ml^–1 puromycin. HCT116, HeLa and IMR90 SV40-transformed fibroblasts were maintained in DMEM supplemented with 15% v/v FBS. The retroviral expression vector pMMP-puro has been described previously (31). pMMP-puro-HA-PCNA(wt) was generated by adding the influenza hemagglutinin (HA) tag (AYPYDVPDYA) at the N-terminus of PCNA. The K164R mutation was generated by site-directed mutagenesis using QuikChange (Stratagene). PD20F + pMMP-Empty, PD20F + pMMP-FANCD2, HeLa + pMMP-HA-PCNA and HeLa + pMMP-HA-PCNA-K164R fibroblasts were maintained in DMEM medium supplemented with 1 µg ml^–1 puromycin.

Immunoblotting
Whole-cell extracts were prepared by lysis of cells in RIPA buffer for 30 min on ice. Cell debris was removed by centrifugation at 13 000g at 4°C for 10 min. Protein concentrations were determined using the Pierce BCA protein assay. Proteins were resolved using NuPAGE 3–8% w/v Tris–acetate or 4–12% w/v, or 10% w/v bis–tris (MOPS) gels (Invitrogen) transferred to polyvinylidene difluoride membranes (Bio-Rad). Membranes were probed with rabbit polyclonal antisera against FANCD2 [affinity-purified E35 (11)] and NBS1 (NB100–143; Novus Biologicals), or mouse monoclonal sera against FANCD2 (FI-17; Santa Cruz Biotech), HA (HA.11; Covance), PCNA (PC10; Santa Cruz Biotech), RPA2 (Ab-2; Oncogene Research) and -tubulin (Ab-2; Lab Vision). Membranes were then probed with horseradish peroxidase-conjugated goat anti-rabbit IgG or goat anti-mouse IgG, and antibody binding detected by enhanced chemiluminescence (Amersham Pharmacia).

Immunocytochemistry
Cells were prepared for immunocytochemistry essentially as described previously (11). For the detection of chromatin-associated PCNA (21), cells were pre-permeabilized in Triton buffer (32) for 5 min on ice and fixed with 100% v/v –20°C methanol. For the detection of FANCD2 and RPA2, cells were fixed in 4% w/v paraformaldehyde at 4°C followed by permeabilization in 0.3% v/v Triton X-100 in PBS. Fixed cells were incubated with primary antibodies in 5% v/v goat serum, 0.1% v/v NP-40, in PBS for 2 h, washed three times in PBS and incubated for 1 h at room temperature with species-specific fluorescein- or Texas Red-conjugated secondary antibodies (Molecular Probes). Cells were counterstained and mounted in vectashield plus 4'6-diamidine-2-phenylindole dihydrochloride (DAPI) (Vector Laboratories). Cells were visualized and images acquired using a Zeiss Axioscope epifluorescence microscope with Quips PathVysion imaging software (Vysis Inc., Downers Grove, IL, USA).

Chromosome analyses and fragile site FISH
Cells were exposed to 0.2–0.4 µM APH for 24 (fibroblasts) or 48 h (lymphoblasts) prior to harvest. Harvesting of cells, chromosome preparations, trypsin–Giemsa banding and FISH protocols using YAC 850a6 to detect FRA3B and BAC 264L1 (RP-11) to detect FRA16D, were performed as previously described (19,20).

RNA interference
siRNA directed against FANCD2 (target sequence: AACAGCCATGGATACACTTGA) and negative control siRNA sequences were obtained from Qiagen. Introduction of siRNAs into HCT116 and HeLa cells was carried out using Oligofectamine (Invitrogen). Seventy-two hours following siRNA transfection, APH was added to the cultures for a further 24 h, and cells were subsequently harvested for metaphase preparation as described previously.

Statistical analysis
Total gaps and breaks data were analyzed using the Student's t-test for equal or unequal variance. Variance for each data set was determined using the sample variance F-test. Fisher's exact test (two sided) was used for analysis of specific fragile site expression data.

	ACKNOWLEDGEMENTS

 
We thank members of the Glover and D'Andrea Laboratories for helpful discussion, Sara Hamon for assistance with statistical analyses, and Martin F. Arlt and David O. Ferguson for critical reading of this manuscript. This work was supported by National Institutes of Health grants RO1CA43222 (T.W.G.), RO1HL52725 (A.D.D.) RO1DK43889 (A.D.D.) and PO1HL54785 (A.D.D.). N.G.H. is the recipient of a Leukemia Research Foundation Postdoctoral Fellowship award. T.T. is a Scholar Fellow of the American Society of Hematology.

	FOOTNOTES

 
Present address: Division of Human Biology, Fred Hutchinson Cancer Research Center, Seattle, WA 98109, USA.

	REFERENCES

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 

1. Grompe, M. and D'Andrea, A. (2001) Fanconi anemia and DNA repair. Hum. Mol. Genet., 10, 2253–2259.[Abstract/Free Full Text]

2. Joenje, H. and Patel, K.J. (2001) The emerging genetic and molecular basis of Fanconi anaemia. Nat. Rev. Genet., 2, 446–459.[CrossRef][Web of Science][Medline]

3. Alter, B.P. (1996) Fanconi's anemia and malignancies. Am. J. Hematol., 53, 99–110.[CrossRef][Web of Science][Medline]

4. Meetei, A.R., de Winter, J.P., Medhurst, A.L., Wallisch, M., Waisfisz, Q., van de Vrugt, H.J., Oostra, A.B., Yan, Z., Ling, C., Bishop, C.E. et al. (2003) A novel ubiquitin ligase is deficient in Fanconi anemia. Nat. Genet., 35, 165–170.[CrossRef][Web of Science][Medline]

5. Howlett, N.G., Taniguchi, T., Olson, S., Cox, B., Waisfisz, Q., De Die-Smulders, C., Persky, N., Grompe, M., Joenje, H., Pals, G. et al. (2002) Biallelic inactivation of BRCA2 in Fanconi anemia. Science, 297, 606–609.[Abstract/Free Full Text]

6. Meetei, A.R., Levitus, M., Xue, Y., Medhurst, A.L., Zwaan, M., Ling, C., Rooimans, M.A., Bier, P., Hoatlin, M., Pals, G. et al. (2004) X-linked inheritance of Fanconi anemia complementation group B. Nat. Genet., 36, 1219–1224.[CrossRef][Web of Science][Medline]

7. Medhurst, A.L., Huber, P.A., Waisfisz, Q., de Winter, J.P. and Mathew, C.G. (2001) Direct interactions of the five known Fanconi anaemia proteins suggest a common functional pathway. Hum. Mol. Genet., 10, 423–429.[Abstract/Free Full Text]

8. Meetei, A.R., Sechi, S., Wallisch, M., Yang, D., Young, M.K., Joenje, H., Hoatlin, M.E. and Wang, W. (2003) A multiprotein nuclear complex connects Fanconi anemia and Bloom syndrome. Mol. Cell. Biol., 23, 3417–3426.[Abstract/Free Full Text]

9. Garcia-Higuera, I., Kuang, Y., Naf, D., Wasik, J. and D'Andrea, A.D. (1999) Fanconi anemia proteins FANCA, FANCC, and FANCG/XRCC9 interact in a functional nuclear complex. Mol. Cell. Biol., 19, 4866–4873.[Abstract/Free Full Text]

10. Taniguchi, T., Garcia-Higuera, I., Andreassen, P.R., Gregory, R.C., Grompe, M. and D'Andrea, A.D. (2002) S-phase-specific interaction of the Fanconi anemia protein, FANCD2, with BRCA1 and RAD51. Blood, 100, 2414–2420.[Abstract/Free Full Text]

11. Garcia-Higuera, I., Taniguchi, T., Ganesan, S., Meyn, M.S., Timmers, C., Hejna, J., Grompe, M. and D'Andrea, A.D. (2001) Interaction of the Fanconi anemia proteins and BRCA1 in a common pathway. Mol. Cell, 7, 249–262.[CrossRef][Web of Science][Medline]

12. Wang, X., Andreassen, P.R. and D'Andrea, A.D. (2004) Functional interaction of monoubiquitinated FANCD2 and BRCA2/FANCD1 in chromatin. Mol. Cell. Biol., 24, 5850–5862.[Abstract/Free Full Text]

13. Hussain, S., Wilson, J.B., Medhurst, A.L., Hejna, J., Witt, E., Ananth, S., Davies, A., Masson, J.Y., Moses, R., West, S.C. et al. (2004) Direct interaction of FANCD2 with BRCA2 in DNA damage response pathways. Hum. Mol. Genet., 13, 1241–1248.[Abstract/Free Full Text]

14. Marians, K.J. (2004) Mechanisms of replication fork restart in Escherichia coli. Philos. Trans. R. Soc. Lond. B. Biol. Sci., 359, 71–77.[Abstract/Free Full Text]

15. Haber, J.E. (1999) DNA recombination: the replication connection. Trends Biochem. Sci., 24, 271–275.[CrossRef][Web of Science][Medline]

16. Glover, T.W., Berger, C., Coyle, J. and Echo, B. (1984) DNA polymerase alpha inhibition by aphidicolin induces gaps and breaks at common fragile sites in human chromosomes. Hum. Genet., 67, 136–142.[CrossRef][Web of Science][Medline]

17. Arlt, M.F., Casper, A.M. and Glover, T.W. (2003) Common fragile sites. Cytogenet. Genome Res., 100, 92–100.[CrossRef][Web of Science][Medline]

18. Masramon, L., Ribas, M., Cifuentes, P., Arribas, R., Garcia, F., Egozcue, J., Peinado, M.A. and Miro, R. (2000) Cytogenetic characterization of two colon cell lines by using conventional G-banding, comparative genomic hybridization, and whole chromosome painting. Cancer Genet. Cytogenet., 121, 17–21.[CrossRef][Web of Science][Medline]

19. Casper, A.M., Nghiem, P., Arlt, M.F. and Glover, T.W. (2002) ATR regulates fragile site stability. Cell, 111, 779–789.[CrossRef][Web of Science][Medline]

20. Arlt, M.F., Xu, B., Durkin, S.G., Casper, A.M., Kastan, M.B. and Glover, T.W. (2004) BRCA1 is required for common-fragile-site stability via its G2/M checkpoint function. Mol. Cell. Biol., 24, 6701–6709.[Abstract/Free Full Text]

21. Kannouche, P.L., Wing, J. and Lehmann, A.R. (2004) Interaction of human DNA polymerase eta with monoubiquitinated PCNA: a possible mechanism for the polymerase switch in response to DNA damage. Mol. Cell, 14, 491–500.[CrossRef][Web of Science][Medline]

22. Vassin, V.M., Wold, M.S. and Borowiec, J.A. (2004) Replication protein A (RPA) phosphorylation prevents RPA association with replication centers. Mol. Cell. Biol., 24, 1930–1943.[Abstract/Free Full Text]

23. Hoege, C., Pfander, B., Moldovan, G.L., Pyrowolakis, G. and Jentsch, S. (2002) RAD6-dependent DNA repair is linked to modification of PCNA by ubiquitin and SUMO. Nature, 419, 135–141.[CrossRef][Medline]

24. Barbie, D.A., Kudlow, B.A., Frock, R., Zhao, J., Johnson, B.R., Dyson, N., Harlow, E. and Kennedy, B.K. (2004) Nuclear reorganization of mammalian DNA synthesis prior to cell cycle exit. Mol. Cell. Biol., 24, 595–607.[Abstract/Free Full Text]

25. Andreassen, P.R., D'Andrea, A.D. and Taniguchi, T. (2004) ATR couples FANCD2 monoubiquitination to the DNA-damage response. Genes Dev., 18, 1958–1963.[Abstract/Free Full Text]

26. Saintigny, Y., Delacote, F., Vares, G., Petitot, F., Lambert, S., Averbeck, D. and Lopez, B.S. (2001) Characterization of homologous recombination induced by replication inhibition in mammalian cells. EMBO J., 20, 3861–3870.[CrossRef][Web of Science][Medline]

27. Casper, A.M., Durkin, S.G., Arlt, M.F. and Glover, T.W. (2004) Chromosomal instability at common fragile sites in Seckel syndrome. Am. J. Hum. Genet., 75, 654–660.[CrossRef][Web of Science][Medline]

28. Zou, L. and Elledge, S.J. (2003) Sensing DNA damage through ATRIP recognition of RPA–ssDNA complexes. Science, 300, 1542–1548.[Abstract/Free Full Text]

29. Lomonosov, M., Anand, S., Sangrithi, M., Davies, R. and Venkitaraman, A.R. (2003) Stabilization of stalled DNA replication forks by the BRCA2 breast cancer susceptibility protein. Genes Dev., 17, 3017–3022.[Abstract/Free Full Text]

30. Stelter, P. and Ulrich, H.D. (2003) Control of spontaneous and damage-induced mutagenesis by SUMO and ubiquitin conjugation. Nature, 425, 188–191.[CrossRef][Medline]

31. Ory, D.S., Neugeboren, B.A. and Mulligan, R.C. (1996) A stable human-derived packaging cell line for production of high titer retrovirus/vesicular stomatitis virus G pseudotypes. Proc. Natl Acad. Sci. USA, 93, 11400–11406.[Abstract/Free Full Text]

32. Scully, R., Chen, J., Ochs, R.L., Keegan, K., Hoekstra, M., Feunteun, J. and Livingston, D.M. (1997) Dynamic changes of BRCA1 subnuclear location and phosphorylation state are initiated by DNA damage. Cell, 90, 425–435.[CrossRef][Web of Science][Medline]

CiteULike    Connotea    Del.icio.us    What's this?

This article has been cited by other articles:

				A. N. Suhasini, J. A. Sommers, A. C. Mason, O. N. Voloshin, R. D. Camerini-Otero, M. S. Wold, and R. M. Brosh Jr. FANCJ Helicase Uniquely Senses Oxidative Base Damage in Either Strand of Duplex DNA and Is Stimulated by Replication Protein A to Unwind the Damaged DNA Substrate in a Strand-specific Manner J. Biol. Chem., July 3, 2009; 284(27): 18458 - 18470. [Abstract] [Full Text] [PDF]

				D. Kumari, V. Somma, A. J. Nakamura, W. M. Bonner, E. D'Ambrosio, and K. Usdin The role of DNA damage response pathways in chromosome fragility in Fragile X syndrome Nucleic Acids Res., May 21, 2009; (2009) gkp391v1. [Abstract] [Full Text] [PDF]

				Q. Fan, F. Zhang, B. Barrett, K. Ren, and P. R. Andreassen A role for monoubiquitinated FANCD2 at telomeres in ALT cells Nucleic Acids Res., April 1, 2009; 37(6): 1740 - 1754. [Abstract] [Full Text] [PDF]

				M. Tanwar, R. Kumar, A. Goyal, M. Kumar, T. Dada, G. Singh, R. Sihota, and R. Dada Rieger syndrome with multiple chromosomal breaks and chromosome 4 deletion BMJ Case Reports, February 16, 2009; 2009(feb04_1): bcr0620080297 - bcr0620080297. [Abstract] [Full Text]

				H. Ishii, K. Mimori, K. Ishikawa, H. Okumura, F. Pichiorri, T. Druck, H. Inoue, A. Vecchione, T. Saito, M. Mori, et al. Fhit-Deficient Hematopoietic Stem Cells Survive Hydroquinone Exposure Carrying Precancerous Changes Cancer Res., May 15, 2008; 68(10): 3662 - 3670. [Abstract] [Full Text] [PDF]

				L. M. Pirzio, P. Pichierri, M. Bignami, and A. Franchitto Werner syndrome helicase activity is essential in maintaining fragile site stability J. Cell Biol., January 28, 2008; 180(2): 305 - 314. [Abstract] [Full Text] [PDF]

				S. G. Durkin, R. L. Ragland, M. F. Arlt, J. G. Mulle, S. T. Warren, and T. W. Glover Replication stress induces tumor-like microdeletions in FHIT/FRA3B PNAS, January 8, 2008; 105(1): 246 - 251. [Abstract] [Full Text] [PDF]

				N. Spardy, A. Duensing, D. Charles, N. Haines, T. Nakahara, P. F. Lambert, and S. Duensing The Human Papillomavirus Type 16 E7 Oncoprotein Activates the Fanconi Anemia (FA) Pathway and Causes Accelerated Chromosomal Instability in FA Cells J. Virol., December 1, 2007; 81(23): 13265 - 13270. [Abstract] [Full Text] [PDF]

				K. Debacker, B. Winnepenninckx, N. Ben-Porat, D. FitzPatrick, R. Van Luijk, S. Scheers, B. Kerem, and R Frank Kooy FRA18C: a new aphidicolin-inducible fragile site on chromosome 18q22, possibly associated with in vivo chromosome breakage J. Med. Genet., May 1, 2007; 44(5): 347 - 352. [Abstract] [Full Text] [PDF]

				E. Gallmeier and S. E. Kern Targeting Fanconi Anemia/BRCA2 Pathway Defects in Cancer: The Significance of Preclinical Pharmacogenomic Models Clin. Cancer Res., January 1, 2007; 13(1): 4 - 10. [Abstract] [Full Text] [PDF]

				J. Dunn, M. Potter, A. Rees, and T. M. Runger Activation of the Fanconi Anemia/BRCA Pathway and Recombination Repair in the Cellular Response to Solar Ultraviolet Light Cancer Res., December 1, 2006; 66(23): 11140 - 11147. [Abstract] [Full Text] [PDF]

				H. Ishii, K. Mimori, H. Inoue, T. Inageta, K. Ishikawa, S. Semba, T. Druck, F. Trapasso, K. Tani, A. Vecchione, et al. Fhit Modulates the DNA Damage Checkpoint Response Cancer Res., December 1, 2006; 66(23): 11287 - 11292. [Abstract] [Full Text] [PDF]

				Y. Wang, T. Wiltshire, J. Senft, S. L. Wenger, E. Reed, and W. Wang Fanconi anemia D2 protein confers chemoresistance in response to the anticancer agent, irofulven Mol. Cancer Ther., December 1, 2006; 5(12): 3153 - 3161. [Abstract] [Full Text] [PDF]

				E. Barroso, R.L. Milne, L.P. Fernandez, P. Zamora, J.I. Arias, J. Benitez, and G. Ribas FANCD2 associated with sporadic breast cancer risk Carcinogenesis, September 1, 2006; 27(9): 1930 - 1937. [Abstract] [Full Text] [PDF]

				T. Taniguchi and A. D. D'Andrea Molecular pathogenesis of Fanconi anemia: recent progress Blood, June 1, 2006; 107(11): 4223 - 4233. [Abstract] [Full Text] [PDF]

				A. Sobeck, S. Stone, V. Costanzo, B. de Graaf, T. Reuter, J. de Winter, M. Wallisch, Y. Akkari, S. Olson, W. Wang, et al. Fanconi Anemia Proteins Are Required To Prevent Accumulation of Replication-Associated DNA Double-Strand Breaks Mol. Cell. Biol., January 15, 2006; 26(2): 425 - 437. [Abstract] [Full Text] [PDF]

				R. D. Kennedy and A. D. D'Andrea The Fanconi Anemia/BRCA pathway: new faces in the crowd Genes & Dev., December 15, 2005; 19(24): 2925 - 2940. [Abstract] [Full Text] [PDF]

				E. El Achkar, M. Gerbault-Seureau, M. Muleris, B. Dutrillaux, and M. Debatisse Premature condensation induces breaks at the interface of early and late replicating chromosome bands bearing common fragile sites PNAS, December 13, 2005; 102(50): 18069 - 18074. [Abstract] [Full Text] [PDF]

				M. Schwartz, E. Zlotorynski, M. Goldberg, E. Ozeri, A. Rahat, C. l. Sage, B. P.C. Chen, D. J. Chen, R. Agami, and B. Kerem Homologous recombination and nonhomologous end-joining repair pathways regulate fragile site stability Genes & Dev., November 15, 2005; 19(22): 2715 - 2726. [Abstract] [Full Text] [PDF]

				T. W. Glover, M. F. Arlt, A. M. Casper, and S. G. Durkin Mechanisms of common fragile site instability Hum. Mol. Genet., October 15, 2005; 14(suppl_2): R197 - R205. [Abstract] [Full Text] [PDF]

				M. Finnis, S. Dayan, L. Hobson, G. Chenevix-Trench, K. Friend, K. Ried, D. Venter, E. Woollatt, E. Baker, and R. I. Richards Common chromosomal fragile site FRA16D mutation in cancer cells Hum. Mol. Genet., May 15, 2005; 14(10): 1341 - 1349. [Abstract] [Full Text] [PDF]

This Article Abstract FREE Full Text (PDF) All Versions of this Article: 14/5/693    most recent ddi065v1 Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (47) Request Permissions Google Scholar Articles by Howlett, N. G. Articles by Glover, T. W. Search for Related Content PubMed PubMed Citation Articles by Howlett, N. G. Articles by Glover, T. W. Social Bookmarking          What's this?

Online ISSN 1460-2083 - Print ISSN 0964-6906

Copyright © 2009 Oxford University Press

Oxford Journals Oxford University Press

• Site Map
• Privacy Policy
• Frequently Asked Questions

Other Oxford University Press sites: Oxford University Press Oxford Journals China Oxford Journals Japan American National Biography Booksellers' Information Service Children's Fiction and Poetry Children's Reference Corporate & Special Sales Dictionaries Dictionary of National Biography Digital Reference English Language Teaching Higher Education Textbooks Humanities International Education Unit Law Medicine Music Online Products Oxford English Dictionary Reference Rights and Permissions Science School Books Social Sciences Very Short Introductions World's Classics