Skip Navigation


Human Molecular Genetics Advance Access originally published online on January 27, 2005
Human Molecular Genetics 2005 14(5):713-724; doi:10.1093/hmg/ddi067
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
14/5/713    most recent
ddi067v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (20)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Liévens, J.-C.
Right arrow Articles by Birman, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liévens, J.-C.
Right arrow Articles by Birman, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Human Molecular Genetics, Vol. 14, No. 5 © Oxford University Press 2005; all rights reserved

Expanded polyglutamine peptides disrupt EGF receptor signaling and glutamate transporter expression in Drosophila

Jean-Charles Liévens1, Thomas Rival1, Magali Iché1, Hervé Chneiweiss2 and Serge Birman1,*

1Laboratoire de Génétique et Physiologie du Développement, Developmental Biology Institute of Marseille, CNRS-INSERM-Université de la Méditerranée, Campus de Luminy, Case 907, F-13288 Marseille Cedex 9, France and 2Inserm U114, Collège de France, 11 place Marcellin-Berthelot, 75231 Paris Cedex 05, France

* To whom correspondence should be addressed. Tel: +33 491269606; Fax: +33 491820682; Email: birman{at}ibdm.univ-mrs.fr

Received December 7, 2004; Revised January 4, 2005; Accepted January 17, 2005


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 NOTE ADDED IN PROOF
 REFERENCES
 
Huntington's disease (HD) is a late onset heritable neurodegenerative disorder caused by expansion of a polyglutamine (polyQ) sequence in the protein huntingtin (Htt). Transgenic models in mice have suggested that the motor and cognitive deficits associated to this disease are triggered by extended neuronal and possibly glial dysfunction, whereas neuronal death occurs late and selectively. Here, we provide in vivo evidence that expanded polyQ peptides antagonize epidermal growth factor receptor (EGFR) signaling in Drosophila glia. We targeted the expression of the polyQ-containing domain of Htt or an extended polyQ peptide alone in a subset of Drosophila glial cells, where the only fly glutamate transporter, dEAAT1, is detected. This resulted in formation of nuclear inclusions, progressive decrease in dEAAT1 transcription and shortened adult lifespan, but no significant glial cell death. We observed that brain expression of dEAAT1 is normally sustained by the EGFR-Ras-extracellular signal-regulated kinase (ERK) signaling pathway, suggesting that polyQ could act by antagonizing this pathway. We found that the presence of polyQ peptides indeed abolished dEAAT1 upregulation by constitutively active EGFR and potently inhibited EGFR-mediated ERK activation in fly glial cells. Long polyQ also limited the effect of activated EGFR on Drosophila eye development. Our results further indicate that the polyQ acts at an upstream step in the pathway, situated between EGFR and ERK activation. This suggests that disruption of EGFR signaling and ensuing glial cell dysfunction could play a direct role in the pathogenesis of HD and other polyQ diseases in humans.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 NOTE ADDED IN PROOF
 REFERENCES
 
Nine progressive neurodegenerative diseases are caused by the expansion of a CAG repeat sequence in specific genes, leading to abnormally long polyglutamine (polyQ) tracts in the corresponding proteins. These disorders include Huntington's disease (HD), spinocerebellar ataxia 1 (SCA1), SCA2, SCA3 (Machado–Joseph disease), SCA6, SCA7 and SCA17, as well as dentatorubral pallidoluysian atrophy (DRPLA) and spinal bulbar muscular atrophy (SMA, Kennedy's disease) (reviewed in 1Go,2Go). All these diseases show, as common features, the progressive degeneration of neuronal subsets in distinct brain areas and the formation of polyQ-containing protein aggregates forming characteristic nuclear or cytoplasmic inclusions. The age at which the first symptoms appear correlates with the length of the glutamine repeat. For instance, HD symptoms are observed when patients carry more than 36 CAG repeats in the first exon of the huntingtin (Htt) gene (3Go,4Go), and juvenile-onset HD patients present more than 65 CAG repeats (5Go). It is now assumed that brain cell dysfunction precedes the late and selective neuronal loss in these diseases (2Go,6Go). Although the role of expanded polyQ tract expression in the pathogenesis is well established, the contribution of aggregates remains unclear (7Go).

The different polyQ disorders share common deleterious gain-of-function mechanisms that could trigger neuronal dysfunction. PolyQ disease proteins interact with molecular chaperones and proteasome subunits and this would inhibit the degradation of misfolded proteins and increase their accumulation (8Go). The mutant proteins could also interfere with gene expression by binding directly to transcriptional regulatory proteins (9Go–14Go). Neurotransmitter signaling pathways are affected by the HD mutation in transgenic mouse models (15Go–18Go), as well as the expression of brain-derived neurotrophic factor (BDNF), a neuromodulator and survival factor (19Go). Finally, recent evidence indicates that both HD and Kennedy's disease proteins disrupt axonal transport (20Go,21Go).

Some data suggest that glial cell function is also compromised in polyQ pathologies. In mouse HD models, glial glutamate uptake is reduced (22Go,23Go). This is because of selective downregulation of the glutamate transporter GLT1/EAAT2, which is mainly expressed in astrocytes. The expression of glutamine synthetase, an enzyme that converts glutamate to glutamine in glia, was also found to be altered (22Go,23Go). However, the potential implication of glial cells in HD pathogenesis has not been thoroughly investigated. Whether glial dysfunction is secondary to neuronal impairment or results from a direct mechanism remains to be clarified.

The fruit fly Drosophila melanogaster recently proved to be a powerful model organism to study human neurodegenerative diseases and in particular polyQ-mediated diseases (reviewed in 6Go,24Go–28Go). Here, we used Drosophila models to investigate the potential roles of glial cell dysfunction and alteration in epidermal growth factor receptor (EGFR) signaling in HD pathogenesis. In Drosophila, a single glutamate transporter (dEAAT1) is present, which is expressed at all developmental stages in a glia subset (29Go–32Go) and it is required for glutamate buffering and adult fly survival (33Go). Using the UAS–GAL4 bipartite system (34Go), we expressed selectively the polyQ-containing domain of human Htt (Httex1p) or an expanded polyQ alone (13Go) in the dEAAT1-expressing glial cells. This led to a progressive decrease in glutamate transporter expression, as in mouse HD models, and a marked shortening of adult fly lifespan. We provide evidence that the polyQ peptides potently antagonize EGFR signaling in Drosophila glia, as well as in the fly eye, by acting at a step upstream of extracellular signal-regulated kinase (ERK) activation and that this can at least in part account for glutamate transporter downregulation. Therefore, our results suggest that glial cell dysfunction directly contributes to the pathogenesis in HD and results from a disruption of the EGFR signaling pathway induced by expanded polyQ peptide accumulation.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 NOTE ADDED IN PROOF
 REFERENCES
 
Expression of expanded polyQ peptides in Drosophila glia
The transgenes we used to express polyQ peptides in Drosophila contained either the first exon of human Htt with 20 or 93 CAG repeats (Httex1p Q20 or Httex1p Q93) or 48 CAG repeats only with a myc/flag tag (Q48-myc) (13Go). To activate expression, the corresponding UAS strains were crossed with dEAAT1-GAL4 flies, which express GAL4 in a subset of glia under regulation of the glutamate transporter promoter (33Go). The somas of these cells lie in the cortex at the periphery of the brain (Fig. 1B), and they send cytoplasmic projections in the central neuropil, where synaptic contacts occur and glutamate transporter is selectively addressed (33Go). Control flies heterozygous for the dEAAT1-GAL4 insertion or dEAAT1-GAL4, UAS-Httex1p Q20 flies showed no behavioral deficits and lived ≥60 days at 25°C. In contrast, flies expressing Q48-myc or Httex1p Q93 in dEAAT1-GAL4-positive glia subsets died much earlier (Fig. 1A) and were found to be lethargic, a few days before dying. The mean lifespan was ~21 days for Q48-myc and Httex1p Q93-expressing flies. Few of them survived >30 days. The Httex1p Q93- and Q48-expressing flies exhibited no significant loss of dEAAT1-expressing cells in the brain and optic lobes when compared with wild-type flies as late as at 21 days (Fig. 1C). This indicates that the early lethality of these flies most likely resulted from glial dysfunction rather than cell death.



View larger version (60K):
[in this window]
[in a new window]
 
Figure 1. Expression of expanded polyQ peptides in Drosophila glial cells reduces adult lifespan. (A) Lifespan analysis of adult flies expressing the polyQ-containing peptides Httex1p Q20, Httex1p Q93 or Q48-myc in a subset of glial cells, which express the glutamate transporter dEAAT1. (B) Whole-mount adult Drosophila CNS showing ubiquitous distribution of the dEAAT1-expressing glial cell bodies in brain (Br) and optic lobe (OL). Glial cell bodies were revealed by autofluorescence of the cytoplasmic GFP-S65T marker expressed with the dEAAT1-GAL4 driver. (C) Density of dEAAT1-expressing cells determined in multifocal confocal views of whole brains of 21-day-old adult flies expressing either no transgene (control) or polyQ-containing peptides Httex1p Q20, Httex1p Q93 or Q48-myc in glial cell subsets under control of the dEAAT1-GAL4 driver. Data are the mean±SEM of values obtained in three to six flies per condition. The differences between the cell numbers counted in control and polyQ-expressing flies were not statistically significant.

 
We observed Htt-containing aggregates all over the adult brain and optic lobes in glial cells expressing Httex1p Q93, but not Httex1p Q20 (Fig. 2A, panels 1 and 2). Aggregate formation also occurred in Q48-myc-expressing flies as assessed by c-Myc immunostaining (Fig. 2A, panels 3 and 4). These inclusions were found to be located in the nucleus and to grow with the age (Fig. 2B). At 2 days of adult age, Hoescht-stained nuclei showed one or several small aggregates (panels 1 and 3), whereas at 10 days they generally presented a single large inclusion (panels 2 and 4).



View larger version (70K):
[in this window]
[in a new window]
 
Figure 2. Expanded polyQ forms intranuclear inclusions in Drosophila glial cells. (A) Htt exon 1 (S830 antibody) (panels 1 and 2) or c-Myc (panels 3 and 4) immunostaining in whole-mount brains of 7 day-old adult flies showing the presence of numerous aggregates in glial cells expressing the expanded polyQ peptides only. Note that the background labeling in panel 3 does not correspond to aggregates but to non-specific staining of nerve cells by the c-Myc antibody. Magnification of photomicrographs: x60. (B) Co-staining with Hoescht 33258 marker and Htt exon 1 (panels 1 and 2) or c-Myc (panels 3 and 4) antibodies at 2 and 10 days of adult age, indicating the nuclear localization of the aggregates. Several small aggregates were found in the nucleus at 2 days of age, whereas they formed a single large aggregate at 10 days of age. Arrowheads point out characteristic inclusions. Magnification: 450x.

 
Expanded polyQ peptides decrease glutamate transporter level and expression
Protein levels of the glutamate transporter dEAAT1 were assessed in flies expressing GFP tagged-dEAAT1 (UAS-dEAAT1–GFP) (33Go) in the absence (control) or presence of polyQ peptides under control of the dEAAT1-GAL4 driver. Figure 3A shows representative views of adult brains at 2, 5 and 14 days of age. Note that the whole CNS appears fluorescent, because the transporter is ubiquitously addressed to the different neuropil regions and excluded from the glial cell bodies (33Go). Quantitative analysis of fluorescence in the optic lobes is presented in Figure 3C. No age-related change in dEAAT1–GFP level was detected in the presence of Httex1p Q20 or in control flies. In contrast, the presence of expanded polyQ tracts led to a progressive decrease in fluorescence intensity. The intensity decreased to 43 and 22% at 14 days for Httex1p Q93- and Q48-expressing flies, respectively. In wild-type flies, western blot experiments similarly demonstrated a significant decrease of endogenous dEAAT1 protein level in the presence of expanded polyQ peptides, which could be demonstrated as early as at 7 days of adult age (Fig. 3D).



View larger version (66K):
[in this window]
[in a new window]
 
Figure 3. Expression of the Drosophila glutamate transporter dEAAT1 is progressively decreased in the presence of polyQ peptides. (A) Photomicrographs showing autofluorescence levels in whole-mount brains from 2-, 5- and 14-day-old adult flies. The dEAAT1–GFP fusion protein was expressed in glial cell subsets with the dEAAT1-GAL4 driver either alone (control) or together with the polyQ-containing peptides Httex1p Q20, Httex1p Q93 or Q48-myc. A progressive decline in the expression of GFP-tagged dEAAT1 was observed in the presence of Httex1p Q93 and Q48-myc only. Magnification: 50x. (B) Similar experiments performed by replacing dEAAT1–GFP with the generic membrane marker mCD8-GFP. The autofluorescence of mCD8-GFP was also reduced at 14 days in the presence of expanded polyQ. (C) Quantitative analysis of fluorescence intensity in the optic lobes. Data are the mean±SEM of values obtained in six to nine flies per condition. Statistical significance: *P>0.05 and ***P>0.001. (D) Western blot analysis of dEAAT1 and Elav proteins in head extracts of 7-day-old flies expressing no transgene (control), Httex1p Q20, Httex1p Q93 or Q48-myc under control of dEAAT1-GAL4. The presence of expanded polyQ tracts in glial cells decreased endogenous dEAAT1 levels 1 week before start of the lethality effect. (E) RT-PCR analysis of dEAAT1 and Actin5C mRNA levels in Drosophila heads at 14 days of age. Same transgenic backgrounds as in (D). A marked and selective decrease in glutamate transporter mRNA levels was observed when peptides containing expanded polyQ tracts were expressed in dEAAT1-expressing glial cells.

 
This decrease in expression level could result from either a degradation of the dEAAT1 protein or an inactivation of the dEAAT1 promoter. We tested the efficiency of the dEAAT1 promoter by using UAS-mCD8-GFP, a non-specific membrane marker, instead of dEAAT1-GFP, as a reporter gene. Expression of expanded polyQ peptides induced a marked reduction (~70%) in mCD8-GFP signal at 14 days (Fig. 3B and C), indicating that dEAAT1 downregulation is at least in part caused by inhibition of gene expression. This was confirmed by direct analysis of mRNA levels by RT–PCR. The levels of dEAAT1 mRNA were markedly reduced in 7-day-old (data not shown) and 14-day-old (Fig. 3D) Httex1p Q93- and Q48-expressing flies compared with Httex1p Q20 and control flies, whereas actin mRNA levels remained unchanged. Therefore, the presence of expanded polyQ peptides in Drosophila glia potently inhibits glutamate transporter transcription.

dEAAT1 expression is regulated by the EGFR signaling and the Ras/ERK pathway
In vitro studies in mammalian cells have suggested that glial glutamate transporter expression can be independently upregulated by the activation of EGFR signaling and the p42/p44 MAP kinase/ERK or phosphatidylinositol 3-kinase (PI3K) pathway (35Go–38Go). We investigated the potential role of these regulators on Drosophila glutamate transporter expression in vivo by a transgenic approach. The dEAAT1–GFP fusion protein was co-expressed with constitutively active Drosophila Egfr ({lambda}torpedo), Ras (Ras85D.V12) or Erk (rolledSEM) under regulation of dEAAT1-GAL4. This generally led to increased GFP fluorescence intensity in both the optic lobes and brain of 7- and 14-day-old flies, compared with control flies (Fig. 4A and B). Active Ras seems to be more efficient at stimulating dEAAT1 expression in 7-day-old flies than in 14-day-old flies, but this is most certainly explained by the deleterious effects of active Ras on fly survival after 2 weeks when it is expressed in glial cells (data not shown). Overall, these results indicate that activation of both the EGFR and Ras/ERK pathway upregulates dEAAT1 expression in living flies.



View larger version (65K):
[in this window]
[in a new window]
 
Figure 4. dEAAT1 expression is regulated by the EGFR and Ras/ERK but not PI3K pathway. (A and C) Levels of fluorescence in whole-mount brains of 7- and 14-day-old flies co-expressing dEAAT1–GFP and no other transgene (control), constitutively active Drosophila Egfr (Egfract), Ras (Rasact) or Erk (Erkact), dominant negative Ras (Rasdn), mammalian inactive MKP3-C/S (MKP3mut) or Drosophila PI3K under control of dEAAT1-GAL4. Magnification: 50x. (B and D). Quantitative analysis of fluorescence intensity in the optic lobes and brains. Data are the mean of values obtained in six to nine flies per condition. Statistical significance: *P<0.05, **P<0.01 and ***P<0.001. dEAAT1–GFP expression is significantly increased by activated EGFR, Ras and ERK and decreased by dominant negative Ras and mutant MKP3. In contrast, overexpression of PI3K is ineffective on dEAAT1 expression.

 
In normal conditions, ERK is activated by phosphorylation in the cytoplasm and then translocated into the nucleus. This nuclear translocation can be prevented by overexpression of a cytoplasmic ERK-docking molecule, the inactive MAP kinase phosphatase 3 (MKP3-C/S) (39Go,40Go). Expression of MKP3-C/S significantly decreased dEAAT1–GFP levels when compared with control (Fig. 4A and B). Expression of dominant negative Ras (Ras85D.N17) also significantly inhibited dEAAT1 at 14 days, but not as much as at 7 days, suggesting that its effect is progressive and becomes obvious only in older flies. These results suggest that the Ras/ERK pathway is required for normal level of dEAAT1 expression during the adult life. In contrast, overexpression of Drosophila PI3K (Dp110) under the control of dEAAT1-GAL4 did not alter the dEAAT1–GFP fluorescence level (Fig. 4C and D). This indicates that regulation of glutamate transporter expression by EGFR signaling does not involve the PI3K pathway in the Drosophila brain.

Expanded polyQ prevents EGFR- but not Ras/ERK-induced dEAAT1 upregulation
The previous results suggested to us that downregulation of dEAAT1 by the expanded polyQ peptides (Fig. 3) could result from an inhibition of EGFR signaling. As shown in Figure 5A and B, the presence of Httex1p Q93 or Q48-myc peptides in glial cells indeed abolished the upregulation of dEAAT1-GFP expression induced by constitutively active Drosophila Egfr in the brain and optic lobes of 10- and 15-day-old flies. In contrast, we observed that active Erk was still able to increase dEAAT1–GFP expression in the presence of Httex1p Q93 (Fig. 5C) and the same result was obtained with active Ras and Q48-myc (Fig. 5D). Although we did not test all the possible combinations, these results suggest that expanded polyQ inhibits EGFR signaling, and consequently dEAAT1 expression, at a step upstream of Ras/ERK activation. Alternatively, co-expression of active Erk or Ras could be more potent than that of active EGFR and strong enough to overcome polyQ-induced inhibition of the pathway.



View larger version (56K):
[in this window]
[in a new window]
 
Figure 5. Expanded polyQ blocks EGFR- but not Ras/ERK-mediated dEAAT1 upregulation. Photomicrographs showing the autofluorescence of GFP-tagged dEAAT1 co-expressed with either Httex1p Q93 (A and C) or Q48-myc (B and D) in the absence (left panels) or presence (right panels) of constitutively active Drosophila Egfr (A and B), Erk (C) or Ras (D), under the control of dEAAT1-GAL4. Whole brains where dissected from 10-day-old flies. Magnification: 60x. Quantitative analysis of fluorescence levels was performed at 10 and 15 (A–C) or 7 and 10 (D) days of age in the optic lobes and brains of six to nine flies per condition. In D, experiments were conducted at 7 and 10 days because the expression of active Ras induced lethality at older ages. Statistical significance: ***P<0.001. PolyQ peptides abolish EGFR-induced, but not Ras- or Erk-induced, increase in dEAAT1 expression.

 
Expanded polyQ peptides prevent EGFR-induced ERK activation
We, therefore, directly examined the effect of polyQ peptides on the activation state of ERK with a specific antibody against the phosphorylated form of this protein. Western blot experiments were performed on protein extracts from adult fly heads. First, ERK phosphorylation was found to be significantly increased by the expression of constitutively active Egfr in dEAAT1-expressing glial cells (Fig. 6). Secondly, we observed that co-expression of either Httex1p Q93 or Q48-myc strongly inhibited EGFR-mediated ERK phosphorylation. This result confirmed that the presence of expanded polyQ peptides in Drosophila glia disrupts the EGFR signaling pathway at a step upstream of ERK activation.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 6. Expanded polyQ blocks EGFR-mediated ERK activation. Western blot analysis of phosphorylated ERK and Elav proteins in head extracts of 10- and 15-day-old flies expressing no UAS transgene (control), activated Drosophila Egfr alone or activated Egfr plus Httex1p Q93 or Q48-myc under control of dEAAT1-GAL4. The presence of expanded polyQ peptides prevented EGFR-induced ERK activation. Experiments were repeated three times at each time point with similar results.

 
Expanded polyQ alters the EGFR pathway in the Drosophila eye
To attest further that expanded polyQ peptides antagonize EGFR signaling in vivo, we expressed the Q48-myc peptide in the eye with the GMR-GAL4 driver. The Drosophila eye depends on regulated EGFR pathway for its development (41Go,42Go). The eye structure of Q48-expressing flies was apparently normal but presented a characteristic depigmentation (Fig. 7A, panel 2), which increased with the age, as previously described (43Go). We observed that expression of constitutively active Egfr with GMR-GAL4 is pupal lethal (panel 3). However, when active Egfr was co-expressed with Q48-myc, a few adult escapers survived, which showed rough and severely collapsed eyes (panel 4). Thus, polyQ expression can in part rescue the deleterious effects of constitutively active Egfr. In contrast, the rough eye phenotype induced by expression of active Erk (panel 5) was not rescued by the polyQ peptide. When active Erk was combined with Q48-myc, fly eyes appeared similarly rough and also depigmented (panel 6). This indicates again that expanded polyQ peptides do not interact with components of the EGFR signaling pathway downstream of ERK activation.



View larger version (53K):
[in this window]
[in a new window]
 
Figure 7. Expanded polyQ antagonizes EGFR but not ERK signaling in the Drosophila eye. External appearance of eyes from 5-day-old flies raised at 25°C (A) or 18°C (B) expressing, as indicated, no transgene (control), the Q48-myc peptide, activated Drosophila Egfr, Q48-myc plus activated Egfr, activated Drosophila Erk or Q48-myc plus activated Erk, under control of the GMR-GAL4 driver. Note that no adults were recovered when Egfract was expressed alone at 25°C. Light and SEM views. Presence of the polyQ peptide antagonized the deleterious effects of Egfr overexpression on development and eye formation.

 
Because GAL4 is less effective at lower temperature, flies were grown at 18°C instead of 25°C and the eyes were examined by both light and scanning electron microscopy (SEM). At 5 days of age, Q48-expressing flies exhibited a less pronounced eye depigmentation than at 25°C (compare Fig. 7B, panel 1 to Fig. 7A, panel 2). Active Egfr-expressing flies survived at this lower temperature, but their eyes were rough and reduced in size with fused ommatidia (middle panels). In these conditions, we observed that co-expression of Q48-myc significantly decreased the eye phenotype induced by active Egfr (right panels). Therefore, in the eye, as in the brain glial cells, expanded polyQ antagonizes EGFR signaling in Drosophila.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 NOTE ADDED IN PROOF
 REFERENCES
 
Possible role of glia in HD and other polyQ-mediated diseases
Despite the crucial role of glial cells in brain development and function, few data are currently available on their involvement in polyQ-mediated neurodegenerative diseases. Current hypotheses concerning HD pathogenesis were often focused on the putative neurotoxicity of neuronal nuclear aggregates. However, Htt is an ubiquitous protein, which is also expressed in astrocytes (44Go–46Go). Here, we expressed different polyQ peptides in a subset of Drosophila glial cells that produce the only fly glutamate transporter dEAAT1 and account for ~10% of total brain glia. The expression of only 48 CAG repeats (Q48-myc) or the first exon of Htt containing 93 CAG repeats (Httex1p Q93) resulted in early adult lethality without triggering a massive degeneration of these cells (Fig. 1). Therefore, lethality is likely mediated by glial dysfunction rather than cell death. This conclusion is supported by the striking progressive decrease in dEAAT1 expression observed in the whole brain and optic lobes in the presence of expanded polyQ (Fig. 3).

Expression of polyQ in Drosophila glia induced the appearance of numerous intranuclear inclusions (Fig. 2). Glial nuclear inclusions have been detected in mouse HD models, but their occurrence was found to be relatively rare when compared with neuronal inclusions (47Go). This could be related to the fact that nuclear localization of mutant Htt does not occur in dividing glial cells (48Go). Similarly, in the larval Drosophila brain, polyQ aggregates were found to be exclusively cytosolic in proliferating neuroblasts, whereas they were located in the nucleus in non-dividing neurons (49Go). Because nerve cell lineages are fixed and glial cells do not divide actively in the insect brain, mutant Htt is expected to accumulate in the nucleus in Drosophila glia. This could explain the higher occurrence of intranuclear polyQ-containing aggregates in fly glial cells.

However, the lack of intranuclear inclusions does not imply that the mammalian glial cells function normally in the presence of expanded polyQ proteins. In contrast, a selective downregulation of the glial glutamate transporter GLT1/EAAT2 has been described in a transgenic mouse model of HD (22Go,23Go). Similarly, in post-mortem brains from HD patients, levels of glutamate transporter were found to be significantly and selectively reduced in the striatum, although astrocytes proliferate in this cerebral region (50Go,51Go). This is also principally because of lower cellular expression of the glial transporter GLT1/EAAT2 (51Go). These data are fully in agreement with the progressive decrease in dEAAT1 levels we observed when expanded polyQ peptides were expressed in Drosophila glial cells. Therefore, downregulation of glial glutamate transport is a constant feature of HD in human patients, as well as in the mouse and fly models. Assuming that comparable molecular mechanisms occur in vertebrate and Drosophila glia, we could infer from these observations that the formation of intranuclear inclusions is not involved in glutamate transporter downregulation.

It has long been proposed that glutamate excitotoxicity could be involved in disease progression in HD (52Go–55Go). In mouse HD models, NMDA glutamate receptors were found to be hypersensitive to agonist action (56Go–59Go). The presence of mutant Htt was shown to confer to medium-sized spiny striatal neurons, a higher vulnerability to NMDA receptor activation, which may explain their selective degeneration (60Go). We recently reported that inactivation of the glutamate transporter dEAAT1 by RNA interference promotes neurite degeneration in the fly brain and shortens adult lifespan (33Go). Our present results suggest that the expression of expanded polyQ proteins in glial cells perturbates their normal function, leading to reduced glutamate buffering capacity in brain and higher challenge to specific neurons that are already predisposed to excitotoxic damage. The pathological phenotypes described here may result in part from dEAAT1 downregulation, but the lethality could result from decreased expression of other vital glial genes. Overall, this provides compelling evidence that the accumulation of expanded polyQ peptides in glial cells may directly contribute to disease progression in HD and other polyQ diseases.

Expanded polyQ inhibits EGFR signaling in vivo
Activation of EGFR signaling is started by receptor dimerization and tyrosine autophosphorylation and can induce activation of the Ras/ERK, phospholipase C or phosphatidylinositol 3-kinase (PI3K) pathway (61Go). In mammals, expression of GLT1/EAAT2 in cultured astrocytes is upregulated by the EGFR, Ras/ERK and PI3K pathways (35Go–38Go). Here, we present in vivo evidence that the fly glutamate transporter dEAAT1 is upregulated when EGFR signaling and Ras/ERK pathway are activated in adult brain glial cells (Fig. 4). EGFR activation plays a major role in glial cell survival during embryonic development in Drosophila (62Go). Therefore, dEAAT1 regulation could result from a direct effect on gene transcription or a better glial cell survival or both. In contrast, PI3K overexpression did not affect dEAAT1 expression, indicating that PI3K is not a regulator of glutamate transporter expression in Drosophila.

In vitro studies in PC12 cells have previously suggested that mutant Htt antagonizes EGFR activity (63Go,64Go). Here, we show that EGFR-mediated glutamate transporter upregulation is abolished in Drosophila glial cells in the presence of the polyQ peptides Httex1p Q93 or Q48-myc (Fig. 5). We further confirmed that expanded polyQ peptides antagonize EGFR action in vivo by co-expressing Q48-myc and Egfr in the Drosophila eye during development (Fig. 7). These results suggest that expanded polyQ peptides downregulate dEAAT1 expression by disrupting EGFR signaling in glia. In contrast, expression of the polyQ peptides did not hamper stimulation of dEAAT1 expression by active Ras or ERK (Fig. 5). Therefore, although the effect of EGFR on dEAAT1 expression is likely mediated by ERK activation, polyQ appears to act on EGFR signaling at a step upstream of Ras/ERK. This is supported by the potent inhibitory effect of polyQ peptides on EGFR-induced ERK activation (Fig. 6). If the polyQ peptides acted downstream of ERK, they would not be expected to alter the level of ERK phosphorylation.

There are a number of possible mechanisms by which expanded polyQ repeat could lead to inhibition of EGFR signaling. Htt is associated to activated EGFR through SH3 domain-containing molecules such as Grb2 (growth factor receptor-binding protein 2) and RasGAP (65Go). It has been recently reported that the expression of full-length mutant Htt reduces the stability of the interaction between native Htt and Grb2 (63Go). As another possibility, mutant Htt could sequester Htt-associated protein-1 (HAP1) (66Go), which is required for EGFR signaling (64Go). Therefore, further work is required to understand precisely the effects of polyQ on EGFR action.

In conclusion, we provide in vivo evidence that polyQ expansion inhibits EGFR signaling in Drosophila by acting upstream of ERK activation. This effect can at least in part account for the progressive decrease in glutamate transporter expression observed when expanded polyQ peptides are present in glial cells. Such an inhibition of EGFR signaling could play a role in the disruption of essential glial and neuronal functions and later to the neurodegeneration in patients with HD or other polyQ-mediated diseases.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 NOTE ADDED IN PROOF
 REFERENCES
 
Drosophila strains, culture and transformation
Unless otherwise specified, flies were grown at 25°C on a standard cornmeal–agar medium. The following fly stocks were used: dEAAT1-GAL4 and UAS-dEAAT1-GFP (33Go); UAS-Httex1p-Q20, UAS-Httex1p-Q93 and UAS-Q48-myc/flag (13Go), gifts of Dr L.M. Thompson (Irvine, CA, USA); UAS-{lambda}torpedo (Egfract) (67Go), gift of Dr B. Charroux (Marseille, France); UAS-rolledSEM (Erkact) (68Go), gift of Dr D. Bohmann (New York, USA) and UAS-Dp110 (PI3K) (69Go), gift of Dr S.J. Leevers (London, UK). UAS-MKP3-C/S was constructed by insertion of the 1.7 kb EcoRI–XbaI DNA fragment from the recombinant PSG5 vector containing the inactive C/S mutant of the human MAP kinase phosphatase 3 (MKP3) gene (39Go) (gift of Dr S.M. Keyse, Dundee, UK) into the pUAST plasmid (34Go). Germ-line transformants were generated by standard procedure (70Go). All other strains (GMR-GAL4, UAS-GFP-S65T, UAS-mCD8-GFP, UAS-Ras85D.N17 and UAS-Ras85D.V12) were obtained from the Bloomington Drosophila Stock Center.

Lifespan analysis
Newly eclosed flies were placed in vials (20–25 flies per vial) and incubated at 25°C. They were transferred into fresh vials every 4 days, and the number of surviving flies was recorded daily. Data correspond to the percentage of surviving flies as a function of time.

Reverse transcription–PCR
Total RNA was extracted from 15 adult fly heads, using the Nucleospin RNA II kit (Macherey Nagel). Reverse transcription was done with Superscript II reverse transcriptase (Invitrogen), and PCR was performed with the PCR Master Mix (MBI Fermentas). The dEAAT1 and Actin 5C primers were added together in the same PCR tube. Cycling conditions were 35 cycles for 1 min at 94°C, 1 min at 65°C and 30 s at 72°C. The dEAAT1 primers (5'-TCGACGGCTATGATGAGG and 5'-CACAGCCTCATAGAGAGCC) and Actin 5C primers (5'CGACAACGGCTCTGGCATGT and 5'-TCCATTGTGCACCGCAAGTG) amplify a 212 and 1094 bp cDNA fragment, respectively. Control experiments were carried out in the absence of reverse transcriptase. PCR products were separated on 1% agarose gels and visualized by ethidium bromide staining. Each experiment was repeated three times with similar results.

In situ fluorescence
Whole Drosophila brains expressing GFP were dissected in 1xphosphate-buffered saline (PBS), fixed with 4% paraformaldehyde, rinsed in PBS and mounted in Vectashield (Vector). Microscopic examination was performed using a Zeiss Axioplan 2 fluorescent microscope equipped with a Nikon digital camera (DXM 1200). Quantification of the signal was done with the ImageJ software. Fluorescent intensities were expressed as percent of the mean of control flies. Data from six to nine flies per condition were averaged and are presented as mean±SEM. Statistical analysis was performed using a Student's t-test. A significance of P<0.05 was required for rejection of the null hypothesis. Confocal micrographs were produced using a Zeiss confocal LSM 510 microscope and Zeiss LSM 5 image browser software. Density of dEAAT1-expressing cells was determined on multifocal confocal views of whole brains expressing GFP-S65T with the dEAAT1-GAL4 driver to visualize glial cell bodies (33Go). Cells were counted in two 0.4 mm2 areas in the brain and optic lobes of three to six flies. Data were averaged and are presented as mean ±SEM.

Immunocytochemistry
Whole fly brains were dissected, fixed in paraformaldehyde and incubated in primary and secondary antibodies as described (71Go). Detection of aggregates in UAS-Httex1p-Q93 expressing flies was performed using the polyclonal sheep S830 antibody (1/1000 dilution), which was raised against a Htt GST exon 1 fusion protein containing 51 glutamines (72Go,73Go). Detection of aggregates in UAS-Q48-myc/flag expressing Drosophila was done using a polyclonal rabbit anti-cMyc A14 antibody (Santa Cruz Biotechnology; 1/1000 dilution). TRITC-labeled anti-sheep or anti-rabbit antibodies (Jackson immunoResearch) were used as secondary antibodies at 1/200 dilution. The nuclear stain Hoescht 33258 (Sigma) was used at 1:200 dilution. Mounting was performed in Vectashield (Vector).

Western blot analysis
Twenty Drosophila heads were thawed and then homogenized in 20 mM NaPi (15.5 mM Na2HPO4, 4.5 mM NaH2PO4, pH 7.4) containing 1 mM phenylmethylsulfonyl fluoride and a protease inhibitor cocktail (Boehringer Mannheim, Germany). After 30 s sonication and 2 min centrifugation at 4°C (15 000g), 1/5 (v/v) sample Laemmli buffer was added to the supernatant. Total protein was electrophoresed through a 10% polyacrylamide resolving gel and electroblotted onto Hybond-P membrane (Amersham Pharmacia Biotech). Before immunodetection, blots were stained with Ponceau-S to visualize transfer efficiency. Blots were blocked in PBST (1xPBS, 0.1% Tween-20) containing 5% dry milk for 1 h and incubated with purified rabbit polyclonal anti-dEAAT1 antibodies (1/300 dilution) or monoclonal anti-phosphorylated ERK antibodies (1 µg/ml, clone MAPK-YT, Sigma) overnight at 4°C. Blots were washed in PBST, incubated with peroxidase-labeled anti-rabbit or mouse secondary antibodies (1/5000; Jackson ImmunoResearch) for 2 h and rinsed in PBST. The signal was visualized on Kodak MR films with enhanced chemiluminescence (ECL, Pierce). The blots were then washed in stripping buffer (62.5 mM Tris–HCl pH 6.8, 2% SDS, 100 mM ß-mercaptoethanol) for 15 min at room temperature and reprobed using rat anti-Elav antibodies (1/1000; Hybridoma Bank) and anti-rat secondary antibodies (1/5000; Jackson ImmunoResearch). Each experiment was repeated twice or three times.

Scanning electron microscopy
Flies were washed in 1xPBS, fixed in 2.5% glutaraldehyde for 4 h, rinsed in 1xPBS and post-fixed in 1% osmium tetroxide for 1–2 h. They were dehydrated once in 30, 50, 70, 95 and 100% ethanol for 30–60 min, twice in hexamethyldisilidane for 1 h and finally once overnight. Fly heads were then mounted on pin mounts and covered with gold on S150B Edwards. Observation was performed on MEB Leica 440.


    ACKNOWLEDGEMENTS
 
We thank Drs Stephen Kerridge and Bernard Charroux for their comments on the manuscript, Dr Claude Desplan and Hélène Coulom for helpful discussions and Olivier Monaco for data processing support. We thank Drs Gillian P. Bates for the S830 antibodies, Dirk Bohmann for the UAS-rolledSEM flies, Sally J. Leevers for the UAS-Dp110 flies, Andrea Brand for the pUAST plasmid, Bernard Charroux for the UAS-{lambda}torpedo flies, Stephen M. Keyse for the MKP3 C/S cDNA and Leslie Thompson for the polyQ-expressing flies. Scanning electron microscopy was performed with the helpful advice and assistance of Jean-Paul Chauvin. This work was supported by grants from the Association pour la Recherche sur le Cancer, Fondation de France and Fédération pour la Rercherche sur le Cerveau to S.B. J.C.L. is a fellow from the Fondation pour la Recherche Médicale.


    NOTE ADDED IN PROOF
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 NOTE ADDED IN PROOF
 REFERENCES
 
In agreement with the results we show in Figures 1 and 2, it has been lately reported that expression of a polyQ-containing fragment of the SCA3 protein in Drosophila glia induces formation of nuclear aggregates and leads to early adult lethality (74Go).


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 NOTE ADDED IN PROOF
 REFERENCES
 

  1. Bates, G. and Lehrach, H. (1994) Trinucleotide repeat expansions and human genetic disease. Bioessays, 16, 277–284.[CrossRef][Web of Science][Medline]

  2. Zoghbi, H.Y. and Orr, H.T. (2000) Glutamine repeats and neurodegeneration. Annu. Rev. Neurosci., 23, 217–247.[CrossRef][Web of Science][Medline]

  3. The Huntington's Disease Collaborative Research Group (1993) A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. Cell, 72, 971–983.[CrossRef][Web of Science][Medline]

  4. Stine, O.C., Pleasant, N., Franz, M.L., Abbott, M.H., Folstein, S.E. and Ross, C.A. (1993) Correlation between the onset age of Huntington's disease and length of the trinucleotide repeat in IT-15. Hum. Mol. Genet., 2, 1547–1549.[Abstract/Free Full Text]

  5. Penney, J.B., Jr., Vonsattel, J.P., MacDonald, M.E., Gusella, J.F. and Myers, R.H. (1997) CAG repeat number governs the development rate of pathology in Huntington's disease. Ann. Neurol., 41, 689–692.[CrossRef][Web of Science][Medline]

  6. Rubinsztein, D.C. (2002) Lessons from animal models of Huntington's disease. Trends Genet., 18, 202–209.[CrossRef][Web of Science][Medline]

  7. Michalik, A. and van Broeckhoven, C. (2003) Pathogenesis of polyglutamine disorders: aggregation revisited. Hum. Mol. Genet., 12, R173–R186.[Abstract/Free Full Text]

  8. Ding, Q., Lewis, J.J., Strum, K.M., Dimayuga, E., Bruce-Keller, A.J., Dunn, J.C. and Keller, J.N. (2002) Polyglutamine expansion, protein aggregation, proteasome activity, and neural survival. J. Biol. Chem., 277, 13935–13942.[Abstract/Free Full Text]

  9. Huang, C.C., Faber, P.W., Persichetti, F., Mittal, V., Vonsattel, J.P., MacDonald, M.E. and Gusella, J.F. (1998) Amyloid formation by mutant huntingtin: threshold, progressivity and recruitment of normal polyglutamine proteins. Somat. Cell Mol. Genet., 24, 217–233.[CrossRef][Web of Science][Medline]

  10. Boutell, J.M., Thomas, P., Neal, J.W., Weston, V.J., Duce, J., Harper, P.S. and Jones, A.L. (1999) Aberrant interactions of transcriptional repressor proteins with the Huntington's disease gene product, huntingtin. Hum. Mol. Genet., 8, 1647–1655.[Abstract/Free Full Text]

  11. Kazantsev, A., Preisinger, E., Dranovsky, A., Goldgaber, D. and Housman, D. (1999) Insoluble detergent-resistant aggregates form between pathological and nonpathological lengths of polyglutamine in mammalian cells. Proc. Natl Acad. Sci. USA, 96, 11404–11409.[Abstract/Free Full Text]

  12. Nucifora, F.C., Jr., Sasaki, M., Peters, M.F., Huang, H., Cooper, J.K., Yamada, M., Takahashi, H., Tsuji, S., Troncoso, J., Dawson, V.L. et al. (2001) Interference by huntingtin and atrophin-1 with cbp-mediated transcription leading to cellular toxicity. Science, 291, 2423–2438.[Abstract/Free Full Text]

  13. Steffan, J.S., Bodai, L., Pallos, J., Poelman, M., McCampbell, A., Apostol, B.L., Kazantsev, A., Schmidt, E., Zhu, Y.Z., Greenwald, M. et al. (2001) Histone deacetylase inhibitors arrest polyglutamine-dependent neurodegeneration in Drosophila. Nature, 413, 739–743.[CrossRef][Medline]

  14. Taylor, J.P., Taye, A.A., Campbell, C., Kazemi-Esfarjani, P., Fischbeck, K.H. and Min, K.T. (2003) Aberrant histone acetylation, altered transcription, and retinal degeneration in a Drosophila model of polyglutamine disease are rescued by CREB-binding protein. Genes Dev., 17, 1463–1468.[Abstract/Free Full Text]

  15. Cha, J.H., Kosinski, C.M., Kerner, J.A., Alsdorf, S.A., Mangiarini, L., Davies, S.W., Penney, J.B., Bates, G.P. and Young, A.B. (1998) Altered brain neurotransmitter receptors in transgenic mice expressing a portion of an abnormal human huntington's disease gene. Proc. Natl Acad. Sci. USA, 95, 6480–6485.[Abstract/Free Full Text]

  16. Cha, J.H., Frey, A.S., Alsdorf, S.A., Kerner, J.A., Kosinski, C.M., Mangiarini, L., Penney, J.B., Jr., Davies, S.W., Bates, G.P. and Young, A.B. (1999) Altered neurotransmitter receptor expression in transgenic mouse models of Huntington's disease. Philos. Trans. R. Soc. Lond. B Biol. Sci., 354, 981–989.[CrossRef][Web of Science][Medline]

  17. Bibb, J.A., Yan, Z., Svenningsson, P., Snyder, G.L., Pieribone, V.A., Horiuchi, A., Nairn, A.C., Messer, A. and Greengard, P. (2000) Severe deficiencies in dopamine signaling in presymptomatic Huntington's disease mice. Proc. Natl Acad. Sci. USA, 97, 6809–6814.[Abstract/Free Full Text]

  18. Luthi-Carter, R., Strand, A., Peters, N.L., Solano, S.M., Hollingsworth, Z.R., Menon, A.S., Frey, A.S., Spektor, B.S., Penney, E.B., Schilling, G. et al. (2000) Decreased expression of striatal signaling genes in a mouse model of Huntington's disease. Hum. Mol. Genet., 9, 1259–1271.[Abstract/Free Full Text]

  19. Zuccato, C., Ciammola, A., Rigamonti, D., Leavitt, B.R., Goffredo, D., Conti, L., MacDonald, M.E., Friedlander, R.M., Silani, V., Hayden, M.R. et al. (2001) Loss of huntingtin-mediated BDNF gene transcription in Huntington's disease. Science, 293, 493–498.[Abstract/Free Full Text]

  20. Gunawardena, S., Her, L.S., Brusch, R.G., Laymon, R.A., Niesman, I.R., Gordesky-Gold, B., Sintasath, L., Bonini, N.M. and Goldstein, L.S. (2003) Disruption of axonal transport by loss of huntingtin or expression of pathogenic polyQ proteins in Drosophila. Neuron, 40, 25–40.[CrossRef][Web of Science][Medline]

  21. Szebenyi, G., Morfini, G.A., Babcock, A., Gould, M., Selkoe, K., Stenoien, D.L., Young, M., Faber, P.W., MacDonald, M.E., McPhaul, M.J. et al. (2003) Neuropathogenic forms of huntingtin and androgen receptor inhibit fast axonal transport. Neuron, 40, 41–52.[CrossRef][Web of Science][Medline]

  22. Liévens, J.C., Woodman, B., Mahal, A., Spasic-Boscovic, O., Samuel, D., Kerkerian-Le Goff, L. and Bates, G.P. (2001) Impaired glutamate uptake in the R6 Huntington's disease transgenic mice. Neurobiol. Dis., 8, 807–821.[CrossRef][Web of Science][Medline]

  23. Behrens, P.F., Franz, P., Woodman, B., Lindenberg, K.S. and Landwehrmeyer, G.B. (2002) Impaired glutamate transport and glutamate–glutamine cycling: downstream effects of the Huntington mutation. Brain, 125, 1908–1922.[Abstract/Free Full Text]

  24. Bates, G.P. and Hockly, E. (2003) Experimental therapeutics in Huntington's disease: are models useful for therapeutic trials? Curr. Opin. Neurol., 16, 465–470.[CrossRef][Web of Science][Medline]

  25. Bonini, N.M. and Fortini, M.E. (2003) Human neurodegenerative disease modeling using Drosophila. Annu. Rev. Neurosci., 26, 627–656.[CrossRef][Web of Science][Medline]

  26. Liévens, J.C. and Birman, S. (2003) Huntington chorea in Drosophila and mice: towards new therapeutic steps. Med. Sci. (Paris), 19, 593–599.[Medline]

  27. Marsh, J.L., Pallos, J. and Thompson, L.M. (2003) Fly models of Huntington's disease. Hum. Mol. Genet., 12, R187–R193.[Abstract/Free Full Text]

  28. Shulman, J.M., Shulman, L.M., Weiner, W.J. and Feany, M.B. (2003) From fruit fly to bedside: translating lessons from Drosophila models of neurodegenerative disease. Curr. Opin. Neurol., 16, 443–449.[CrossRef][Web of Science][Medline]

  29. Seal, R.P., Daniels, G.M., Wolfgang, W.J., Forte, M.A. and Amara, S.G. (1998) Identification and characterization of a cDNA encoding a neuronal glutamate transporter from Drosophila melanogaster. Receptors Channels, 6, 51–64.[Web of Science][Medline]

  30. Besson, M.T., Soustelle, L. and Birman, S. (1999) Identification and structural characterization of two genes encoding glutamate transporter homologues differently expressed in the nervous system of Drosophila melanogaster. FEBS Lett., 443, 97–104.[CrossRef][Web of Science][Medline]

  31. Besson, M.T., Soustelle, L. and Birman, S. (2000) Selective high-affinity transport of aspartate by a Drosophila homologue of the excitatory amino-acid transporters. Curr. Biol., 10, 207–210.[CrossRef][Web of Science][Medline]

  32. Soustelle, L., Besson, M.T., Rival, T. and Birman, S. (2002) Terminal glial differentiation involves regulated expression of the excitatory amino acid transporters in the Drosophila embryonic CNS. Dev. Biol., 248, 294–306.[CrossRef][Web of Science][Medline]

  33. Rival, T., Soustelle, L., Strambi, C., Besson, M.T., Iche, M. and Birman, S. (2004) Decreasing glutamate buffering capacity triggers oxidative stress and neuropil degeneration in the Drosophila brain. Curr. Biol., 14, 599–605.[CrossRef][Web of Science][Medline]

  34. Brand, A.H. and Perrimon, N. (1993) Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development, 118, 401–415.[Abstract]

  35. Gegelashvili, G., Dehnes, Y., Danbolt, N.C. and Schousboe, A. (2000) The high-affinity glutamate transporters GLT1, GLAST, and EAAT4 are regulated via different signalling mechanisms. Neurochem. Int., 37, 163–170.[CrossRef][Web of Science][Medline]

  36. Zelenaia, O., Schlag, B.D., Gochenauer, G.E., Ganel, R., Song, W., Beesley, J.S., Grinspan, J.B., Rothstein, J.D. and Robinson, M.B. (2000) Epidermal growth factor receptor agonists increase expression of glutamate transporter GLT-1 in astrocytes through pathways dependent on phosphatidylinositol 3-kinase and transcription factor NF-kappaB. Mol. Pharmacol., 57, 667–678.[Abstract/Free Full Text]

  37. Figiel, M., Maucher, T., Rozyczka, J., Bayatti, N. and Engele, J. (2003) Regulation of glial glutamate transporter expression by growth factors. Exp. Neurol., 183, 124–135.[CrossRef][Web of Science][Medline]

  38. Rodriguez-Kern, A., Gegelashvili, M., Schousboe, A., Zhang, J., Sung, L. and Gegelashvili, G. (2003) Beta-amyloid and brain-derived neurotrophic factor, BDNF, up-regulate the expression of glutamate transporterGLT-1/EAAT2 via different signaling pathways utilizing transcription factor NF-kappaB. Neurochem. Int., 43, 363–370.[CrossRef][Web of Science][Medline]

  39. Groom, L.A., Sneddon, A.A., Alessi, D.R., Dowd, S. and Keyse, S.M. (1996) Differential regulation of the MAP, SAP and RK/p38 kinases by Pyst1, a novel cytosolic dual-specificity phosphatase. EMBO J., 15, 3621–3632.[Web of Science][Medline]

  40. Brunet, A., Roux, D., Lenormand, P., Dowd, S., Keyse, S. and Pouyssegur, J. (1999) Nuclear translocation of p42/p44 mitogen-activated protein kinase is required for growth factor-induced gene expression and cell cycle entry. EMBO J, 18, 664–674.[CrossRef][Web of Science][Medline]

  41. Dominguez, M., Wasserman, J.D. and Freeman, M. (1998) Multiple functions of the EGF receptor in Drosophila eye development. Curr. Biol., 8, 1039–1048.[CrossRef][Web of Science][Medline]

  42. Wolff, T. (2003) EGF receptor signaling: putting a new spin on eye development. Curr. Biol., 13, R813–R814.[CrossRef][Web of Science][Medline]

  43. Marsh, J.L., Walker, H., Theisen, H., Zhu, Y.Z., Fielder, T., Purcell, J. and Thompson, L.M. (2000) Expanded polyglutamine peptides alone are intrinsically cytotoxic and cause neurodegeneration in Drosophila. Hum. Mol. Genet., 9, 13–25.[Abstract/Free Full Text]

  44. Li, S.H., Schilling, G., Young, W.S., 3rd, Li, X.J., Margolis, R.L., Stine, O.C., Wagster, M.V., Abbott, M.H., Franz, M.L., Ranen, N.G. et al. (1993) Huntington's disease gene (IT15) is widely expressed in human and rat tissues. Neuron, 11, 985–993.[CrossRef][Web of Science][Medline]

  45. Sharp, A.H., Loev, S.J., Schilling, G., Li, S.H., Li, X.J., Bao, J., Wagster, M.V., Kotzuk, J.A., Steiner, J.P., Lo, A. et al. (1995) Widespread expression of Huntington's disease gene (IT15) protein product. Neuron, 14, 1065–1074.[CrossRef][Web of Science][Medline]

  46. Hebb, M.O., Denovan-Wright, E.M. and Robertson, H.A. (1999) Expression of the Huntington's disease gene is regulated in astrocytes in the arcuate nucleus of the hypothalamus of postpartum rats. FASEB J., 13, 1099–1106.[Abstract/Free Full Text]

  47. Davies, S.W., Turmaine, M., Cozens, B.A., Raza, A.S., Mahal, A., Mangiarini, L. and Bates, G.P. (1999) From neuronal inclusions to neurodegeneration: neuropathological investigation of a transgenic mouse model of Huntington's disease. Philos. Trans. R. Soc. Lond. B. Biol. Sci., 354, 981–989.[CrossRef][Web of Science][Medline]

  48. Martin-Aparicio, E., Avila, J. and Lucas, J.J. (2002) Nuclear localization of N-terminal mutant huntingtin is cell cycle dependent. Eur. J. Neurosci., 16, 355–359.[CrossRef][Web of Science][Medline]

  49. Kazantsev, A., Walker, H.A., Slepko, N., Bear, J.E., Preisinger, E., Steffan, J.S., Zhu, Y.Z., Gertler, F.B., Housman, D.E., Marsh, J.L. et al. (2002) A bivalent Huntingtin binding peptide suppresses polyglutamine aggregation and pathogenesis in Drosophila. Nat. Genet., 30, 367–376.[CrossRef][Web of Science][Medline]

  50. Cross, A.J., Slater, P. and Reynolds, G.P. (1986) Reduced high-affinity glutamate uptake sites in the brains of patients with Huntington's disease. Neurosci. Lett., 67, 198–202.[CrossRef][Web of Science][Medline]

  51. Arzberger, T., Krampfl, K., Leimgruber, S. and Weindl, A. (1997) Changes of NMDA receptor subunit (NR1, NR2B) and glutamate transporter (GLT1) mRNA expression in Huntington's disease—an in situ hybridization study. J. Neuropathol. Exp. Neurol., 56, 440–454.[Web of Science][Medline]

  52. Beal, M.F. (1992) Mechanisms of excitotoxicity in neurologic diseases. FASEB J., 6, 3338–3344.[Abstract]

  53. Beal, M.F. (1995) Aging, energy, and oxidative stress in neurodegenerative diseases. Ann. Neurol., 38, 357–366.[CrossRef][Web of Science][Medline]

  54. Doble, A. (1999) The role of excitotoxicity in neurodegenerative disease: implications for therapy. Pharmacol. Ther., 81, 163–221.[CrossRef][Web of Science][Medline]

  55. Tabrizi, S.J., Cleeter, M.W., Xuereb, J., Taanman, J.W., Cooper, J.M. and Schapira, A.H. (1999) Biochemical abnormalities and excitotoxicity in Huntington's disease brain. Ann. Neurol., 45, 25–32.[CrossRef][Web of Science][Medline]

  56. Levine, M.S., Klapstein, G.J., Koppel, A., Gruen, E., Cepeda, C., Vargas, M.E., Jokel, E.S., Carpenter, E.M., Zanjani, H., Hurst, R.S. et al. (1999) Enhanced sensitivity to N-methyl-D-aspartate receptor activation in transgenic and knockin mouse models of Huntington's disease. J. Neurosci. Res., 58, 515–532.[CrossRef][Web of Science][Medline]

  57. Cepeda, C., Ariano, M.A., Calvert, C.R., Flores-Hernandez, J., Chandler, S.H., Leavitt, B.R., Hayden, M.R. and Levine, M.S. (2001) NMDA receptor function in mouse models of Huntington disease. J. Neurosci. Res., 66, 525–539.[CrossRef][Web of Science][Medline]

  58. Klapstein, G.J., Fisher, R.S., Zanjani, H., Cepeda, C., Jokel, E.S., Chesselet, M.F. and Levine, M.S. (2001) Electrophysiological and morphological changes in striatal spiny neurons in R6/2 Huntington's disease transgenic mice. J. Neurophysiol., 86, 2667–2677.[Abstract/Free Full Text]

  59. Laforet, G.A., Sapp, E., Chase, K., McIntyre, C., Boyce, F.M., Campbell, M., Cadigan, B.A., Warzecki, L., Tagle, D.A., Reddy, P.H. et al. (2001) Changes in cortical and striatal neurons predict behavioral and electrophysiological abnormalities in a transgenic murine model of Huntington's disease. J. Neurosci., 21, 9112–9123.[Abstract/Free Full Text]

  60. Zeron, M.M., Hansson, O., Chen, N., Wellington, C.L., Leavitt, B.R., Brundin, P., Hayden, M.R. and Raymond, L.A. (2002) Increased sensitivity to N-methyl-D-aspartate receptor-mediated excitotoxicity in a mouse model of Huntington's disease. Neuron, 33, 849–860.[CrossRef][Web of Science][Medline]

  61. Yamada, M., Ikeuchi, T. and Hatanaka, H. (1997) The neurotrophic action and signalling of epidermal growth factor. Prog. Neurobiol., 51, 19–37.[CrossRef][Web of Science][Medline]

  62. Hidalgo, A. (2002) Interactive nervous system development: control of cell survival in Drosophila. Trends Neurosci., 25, 365–370.[CrossRef][Web of Science][Medline]

  63. Song, C., Perides, G. and Liu, Y.F. (2002) Expression of full-length polyglutamine-expanded Huntingtin disrupts growth factor receptor signaling in rat pheochromocytoma (PC12) cells. J. Biol. Chem., 277, 6703–6707.[Abstract/Free Full Text]

  64. Li, S.H., Yu, Z.X., Li, C.L., Nguyen, H.P., Zhou, Y.X., Deng, C. and Li, X.J. (2003) Lack of huntingtin-associated protein-1 causes neuronal death resembling hypothalamic degeneration in Huntington's disease. J. Neurosci., 23, 6956–6964.[Abstract/Free Full Text]

  65. Liu, Y.F., Deth, R.C. and Devys, D. (1997) SH3 domain-dependent association of huntingtin with epidermal growth factor receptor signaling complexes. J. Biol. Chem., 272, 8121–8124.[Abstract/Free Full Text]

  66. Li, X.J., Li, S.H., Sharp, A.H., Nucifora, F.C., Jr., Schilling, G., Lanahan, A., Worley, P., Snyder, S.H. and Ross, C.A. (1995) A huntingtin-associated protein enriched in brain with implications for pathology. Nature, 378, 398–402.[CrossRef][Medline]

  67. Queenan, A.M., Ghabrial, A. and Schupbach, T. (1997) Ectopic activation of torpedo/Egfr, a Drosophila receptor tyrosine kinase, dorsalizes both the eggshell and the embryo. Development, 124, 3871–3880.[Abstract]

  68. Brunner, D., Oellers, N., Szabad, J., Biggs, W.H., 3rd, Zipursky, S.L. and Hafen, E. (1994) A gain-of-function mutation in Drosophila MAP kinase activates multiple receptor tyrosine kinase signaling pathways. Cell, 76, 875–888.[CrossRef][Web of Science][Medline]

  69. Leevers, S.J., Weinkove, D., MacDougall, L.K., Hafen, E. and Waterfield, M.D. (1996) The Drosophila phosphoinositide 3-kinase Dp110 promotes cell growth. EMBO J., 15, 6584–6594.[Web of Science][Medline]

  70. Rubin, G.M. and Spradling, A.C. (1982) Genetic transformation of Drosophila with transposable element vectors. Science, 218, 348–353.[Abstract/Free Full Text]

  71. Beall, C. and Hirsh, J. (1987) Regulation of the Drosophila dopa decarboxylase gene in neuronal and glial cells. Genes Dev., 1, 510–520.[Abstract/Free Full Text]

  72. Scherzinger, E., Lurz, R., Turmaine, M., Mangiarini, L., Hollenbach, B., Hasenbank, R., Bates, G.P., Davies, S.W., Lehrach, H. and Wanker, E.E. (1997) Huntingtin-encoded polyglutamine expansions form amyloid-like protein aggregates in vitro and in vivo. Cell, 90, 549–558.[CrossRef][Web of Science][Medline]

  73. Sathasivam, K., Woodman, B., Mahal, A., Bertaux, F., Wanker, E.E., Shima, D.T. and Bates, G.P. (2001) Centrosome disorganization in fibroblast cultures derived from R6/2 Huntington's disease (HD) transgenic mice and HD patients. Hum. Mol. Genet., 10, 2425–2435.[Abstract/Free Full Text]

  74. Kretzschmar, D., Tschape, J., Bettencourt Da Cruz, A., Asan, E., Poeck, B., Strauss, R. and Pflugfelder, G.O. (2005) Glial and neuronal expression of polyglutamine proteins induce behavioral changes and aggregate formation in Drosophila. Glia, 49, 59–72.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Bradford, J.-Y. Shin, M. Roberts, C.-E. Wang, X.-J. Li, and S. Li
Expression of mutant huntingtin in mouse brain astrocytes causes age-dependent neurological symptoms
PNAS, December 29, 2009; 106(52): 22480 - 22485.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D. S. Verbeek, J. Goedhart, L. Bruinsma, R. J. Sinke, and E. A. Reits
PKC{gamma} mutations in spinocerebellar ataxia type 14 affect C1 domain accessibility and kinase activity leading to aberrant MAPK signaling
J. Cell Sci., July 15, 2008; 121(14): 2339 - 2349.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S.-Y. Chou, J.-Y. Weng, H.-L. Lai, F. Liao, S. H. Sun, P.-H. Tu, D. W. Dickson, and Y. Chern
Expanded-Polyglutamine Huntingtin Protein Suppresses the Secretion and Production of a Chemokine (CCL5/RANTES) by Astrocytes
J. Neurosci., March 26, 2008; 28(13): 3277 - 3290.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J.-C. Lievens, M. Iche, M. Laval, C. Faivre-Sarrailh, and S. Birman
AKT-sensitive or insensitive pathways of toxicity in glial cells and neurons in Drosophila models of Huntington's disease
Hum. Mol. Genet., March 15, 2008; 17(6): 882 - 894.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. Li, Z. Xie, Y. Dong, K. M. McKay, M. L. McKee, and R. E. Tanzi
Isolation and characterization of the Drosophila ubiquilin ortholog dUbqln: in vivo interaction with early-onset Alzheimer disease genes
Hum. Mol. Genet., November 1, 2007; 16(21): 2626 - 2639.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Varma, R. Cheng, C. Voisine, A. C. Hart, and B. R. Stockwell
Inhibitors of metabolism rescue cell death in Huntington's disease models
PNAS, September 4, 2007; 104(36): 14525 - 14530.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
E. Scappini, T.-W. Koh, N. P. Martin, and J. P. O'Bryan
Intersectin enhances huntingtin aggregation and neurodegeneration through activation of c-Jun-NH2-terminal kinase
Hum. Mol. Genet., August 1, 2007; 16(15): 1862 - 1871.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
J.-Y. Shin, Z.-H. Fang, Z.-X. Yu, C.-E. Wang, S.-H. Li, and X.-J. Li
Expression of mutant huntingtin in glial cells contributes to neuronal excitotoxicity
J. Cell Biol., December 19, 2005; 171(6): 1001 - 1012.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
14/5/713    most recent
ddi067v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (20)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Liévens, J.-C.
Right arrow Articles by Birman, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liévens, J.-C.
Right arrow Articles by Birman, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?