Human Molecular Genetics Advance Access originally published online on March 24, 2005
Human Molecular Genetics 2005 14(9):1221-1229; doi:10.1093/hmg/ddi133
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Published by Oxford University Press 2005.
Sox9 is sufficient for functional testis development producing fertile male mice in the absence of Sry
1Department of Obstetrics and Gynecology and 2Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030, USA
* To whom correspondence should be addressed at: Department of Obstetrics and Gynecology, Baylor College of Medicine, 6550 Fannin Street (880), Houston, TX 77030, USA. Tel: +1 7137988221; Fax: +1 7137985074; Email: bishop{at}bcm.tmc.edu
Received January 6, 2005; Accepted March 13, 2005
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
In the dominant mouse mutant Odd Sex, XXOds/+ mice develop as phenotypic, sterile males due to male-pattern expression of Sox9 in XXOds/+ embryonic gonads. To test whether SOX9 was sufficient to generate a fully fertile male in the absence of Sry, we constructed an XY(Sry–)Ods/+ male mouse, in which the male phenotype is controlled autosomally by the Ods mutation. Mice were initially fertile, but progressively lost fertility until 5–6 months when they were sterile with very few germ cells in the testis. XY(Sry–)Ods/+ males also failed to establish the correct male-specific pattern of vascularization at the time of sex determination, which could be correlated to an inability of XY(Sry–),Ods/+ males to fully down-regulate Wnt4 expression in the embryonic gonad. Increasing the amount of SOX9 by producing homozygous XY(Sry–)Ods/Ods males was able to completely rescue the phenotype and restore correct vascular patterning and long-term fertility. These data indicate that activation of SOX9 in the gonad is sufficient to trigger all the downstream events needed for the development of a fully fertile male and provide evidence that Sox9 may down-regulate Wnt4 expression in the gonad.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
The determination, development and differentiation of the mammalian testis and ovary from an embryonic, bipotential gonad are controlled by a number of key genes interacting in an as yet poorly defined pathway (1
,2). In XY mice, Sry gene expression in the pre-Sertoli cell lineage between E10.5 and E12.0 initiates Sertoli cell differentiation, committing the gonad to develop as a testis rather than an ovary. This in turn triggers all the downstream events leading to the development of a fertile male. One of the first such events is the up-regulation and nuclear localization of SOX9 protein in the male gonad. It has been shown that Sox9 expression can functionally substitute for Sry in the Odd Sex (Ods) mutant (3) and in Wt1 : Sox9 transgenic mice (4). SOX9 is associated with sex reversal in humans (5,6), and conditional gene targeting has confirmed its essential role in male sex determination (7). Another critical event which occurs in the embryonic gonad at the time of sex determination is the down-regulation of Wnt4 in normal XY males and its continued expression in XX females (8). In addition to its role in Mullerian duct development (8), Wnt4 expression has been shown to inhibit the formation of the male-specific coelomic blood vessel and steroid production in XX females by repressing mesonephric endothelial and steroidogenic cell migration into the gonad (9,10). In transgenic mice, its misexpression in the male gonad leads to a disruption of the male-specific vascular patterning in embryonic and adult testes and infertility on some genetic backgrounds (10,11).
We have previously reported the dominant insertional mouse mutant Odd Sex (Ods) in which XXOds/+ mice, on the FVB genetic background, develop as phenotypic males (3,12). This is due to the specific male-pattern expression of Sox9 in the XXOds/+ embryonic gonad beginning at E11.5. Sox9 expression in other tissues, such as cartilage, is not affected. Although the exact mechanism of Sox9 activation in this model is unclear, we have proposed that it is due to the Dct promoter, used in the tyrosinase transgene, interacting with gonad-specific enhancer elements upstream of Sox9 (13). The postnatal testis of XXOds/+ males is small and devoid of germ cells, and the adults are sterile. This can be attributed to the lack of all Y chromosome encoded genes, such as Eif2s3y (14), and to the presence of two copies of the X chromosome in the germ line, which has been shown to inhibit the early postnatal mitotic divisions (15). Thus, using XXOds/+ males, it is not possible to test whether expression of Sox9 in embryonic XX gonads, in addition to reversing sex, can correctly trigger the downstream events necessary to generate a fully functional testis and adult male fertility. In order to address this problem, we took advantage of the XY(Sry–) female mouse mutant (XYTdym1; subsequently abbreviated to XY
in this paper) which has lost Sry due to a small deletion (16,17). We constructed an XYOds/+ male in which sex is determined autosomally by Sox9 (Ods), carries a single copy of the X and has all Y genes (except Sry). Such males were initially fully fertile for 2–3 months but fertility gradually declined until 5–6 months when they were sterile. This decline in fertility was due to a progressive disruption of spermatogenesis and eventual loss of germ cells including spermatogonia. XYOds/+ males failed to establish the correct pattern of gonadal vascularization at the time of sex determination, which could be correlated with an incomplete down-regulation of Wnt4. Increasing the dosage of SOX9 using a homozygous XYOds/Ods male restored the normal vasculature pattern, completely rescuing the spermatogenesis and eliminating the progressive decline in fertility. These data indicate that Sox9 can replace Sry in initiating all subsequent signal pathways leading to functional testis development. They also suggest that Sox9 controls, either directly or indirectly, the down-regulation of Wnt4 in the embryonic male gonad, essential for correct testis vasculature formation and male development.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Construction and fertility of XY(Sry–)Ods/+ males
We used the XY
mouse mutant which has lost Sry due to a 
9 kb Y chromosome deletion (16). As XY females are severely sub-fertile (17), the line is maintained as an XYTgSry male carrying an autosomally located, fully penetrant Sry transgene. As shown in Figure 1A, we crossed an XYTgSry male (MFI background, kindly provided by P. Burgoyne, NIMR, UK) with an (A/JxFVB)F1 XXOds/+ fertile female (12). Thirteen offspring were produced in the first litter: two XY females, one XX female, one XYOds/+ male, two XXTgSry males, five XXOds/+ males and two XYTgSry,Ods/+ males. The XYOds/+ male was then crossed with normal FVB XX females. A total of 35 offspring were produced in three litters: nine XX females, 11 XXOds/+ males, seven XY females and eight XYOds/+ males, clearly showing that XYOds/+ males are fully fertile.
|
Fertility and histology of XY
Ods/+ malesDuring the continued breeding of these mice, we noticed that adult XY
Ods/+ males had a visibly smaller testis size when compared with their XYTgSry and XYTgSry,Ods/+ littermates or wild-type FVB males. In addition, as judged by litter size and frequency, the fertility of XYOds/+ males began to drop after 2–3 months, until at 5–6 months when they were all completely sterile. In contrast, their XYTgSry and XYSry,Ods/+ littermates remained fertile well beyond 12 months of age. To eliminate any potentially confounding effects of the mixed genetic background (A/J, FVB and MFI) (12), we backcrossed XYTgSry,Ods/+ males with normal FVB females for 12 generations (Fig. 1A). Between backcross generations N5 and N11, testes from all male genotypes were weighed at the indicated ages and fixed in 4% formaldehyde for histology. As shown in Figure 1B, at 2–5 months, there was no significant difference in the testes weights of wild-type XY FVB (n=14) and XYTgSry males (n=21). In contrast, XYOds/+ testes (n=23) were 30% smaller (P<0.01). In XYTgSry,Ods/+ males, where the Sry transgene is present in addition to Ods, the testes were normal in weight (n=21). As expected, all XX sex-reversed males, XXTgSry, (n=12), XXOds/+ (n=14) and XXTgSry,Ods/+ (n=12), had small, similarly sized testes weighing 20% than that of normal.
As shown in Figure 2A, at 6 weeks and 10 months of age, histologically, the testes of XYTgSry (data not shown) and XYTgSry,Ods/+ males appeared normal, with all stages of spermatogenesis present and mature sperm in the epididymis. An examination of XYOds/+ testes at 6 weeks (Fig. 2B) showed that although normal spermatogenesis was occurring in the majority of tubules, 15% showed signs of vacuolation and spermatogenic arrest. This was much more pronounced at 10 months of age when >90% of XYOds/+ tubules were abnormal. Most tubules contained large vacuoles and/or groups of germ cells in the lumen, detached from the epithelium. A drastic reduction of mature sperm in the epididymis could be seen accompanied by round-nuclear cell penetration (Fig. 2B, inset). SOX9 immunohistochemistry showed that Sertoli cells were still present in XYOds/+ tubules, although when compared with XYTgSry,Ods/+ they were compacted together due to the loss of germ cells (Fig. 2C, left). Similarly, immunohistochemistry with p450scc antibody (Fig. 2C, right) showed that functional Leydig cells were present in 10 month XYOds/+ testes. Approximately equal numbers of GCNA1-positive germ cells were observed at 5dpp and 2 months (Fig. 2D). At 10 months, however, XYOds/+ testes were virtually devoid of germ cells whereas normal numbers could be seen in XYTgSry,Ods/+ males. TUNEL analysis conducted on XYOds/+ testes at several different ages showed no increase in specific apoptotic cells (data not shown).
|
Rescue of long-term fertility in XY
Ods/Ods homozygous miceHomozygous XY
Ods/Ods mice were produced by crossing an N9 XYTgSry,Ods/+ male with an XX (A/JxFVB)F1 Ods/+ female. In marked contrast to their heterozygous XYOds/+ littermates, the testis of 6 week and 7 month XYOds/Ods homozygous males appeared normal (Fig. 3A). Spermatogenesis occurred in all tubules with no signs of vacuolation and with good numbers of mature spermatozoa in the epididymis. In addition, normal numbers of GCNA1-positive germ cells were present at both time points (data not shown). Consistent with the histological findings, XYOds/Ods males did not show the progressive decline in fertility as seen in XYOds/+. They remained fully fertile with normal litter sizes and frequency beyond 10 months of age, which is the longest we have so far maintained them.
|
Sox9 dosage assays
To investigate the hypothesis that the progressive loss of fertility seen in XY
Ods/+ males was due to low levels of SOX9 expression, rather than a direct effect of Sry loss, and that its restoration in XYOds/Ods males was due to increased SOX9 levels, we measured SOX9 levels in 21-day-old testes by western blot. At this age, the histology of the XYSry,Ods, XYOds and XYOds/Ods testes is virtually indistinguishable with equal numbers of germ cells and somatic cells present making a comparison of SOX9 levels possible. As shown in Fig. 3B, the level of SOX9 in XYOds/+ male testes is 25% of that seen in their XYSry,Ods/+ littermates. Increasing the dosage of Ods in XYOds/Ods males leads to an increase in levels of SOX9 protein when compared with that seen in the XYSry,Ods/+ males.
Pattern of vascularization in XYOds/+ mice
The establishment of a sexually dimorphic pattern of vasculature in the developing gonad is one of the earliest manifestations of sex differentiation and accompanies the organization of testicular cords (10,18). It was apparent that in adult XYOds/+ testes this patterning had been disrupted (Fig. 4A). The coelomic artery (black arrows) was not fully resolved, was less distinct, did not run the full length of the testes and the collateral vessels (white arrows) formed a more diffuse, disorganized branching pattern when compared with XY wild-type mice. There were also indications of testicular atrophy in XYOds/+ testes, suggested by their brownish appearance, beginning at 4 months but most apparent at 10 months (data not shown). In contrast, the vasculature pattern seen in XYOds/Ods males was indistinguishable from that of normal XY males with a distinct coelomic artery running the entire length of the testis and a clear branching pattern of the minor vessels.
|
An examination of XY
Ods/+ gonads at E13.5 (Fig. 4B) showed that vasculature disruption was also apparent at this stage. A clear distinct coelomic blood vessel could be seen under the surface of the gonad in XY and XYTgSry,Ods/+ males, whereas in XYOds/+ males it was not correctly resolved. Again this phenotype was rescued in XYOds/Ods homozygotes which showed a single clear distinct blood vessel running the length of the gonad. Further examination of the vasculature using PECAM antibody staining, which labels the endothelial and germ cells, confirmed these observations (Fig. 4C). In E13.5 wild-type XY and XYTgSry,Ods/+ testes, the male-specific coelomic artery (black arrows) was present and ran the length of the gonad from the head to the caudal position, with distinct branching collateral vessels (Fig. 4C, panels 2 and 3). This vasculature pattern was absent in wild-type XX female (data not shown) and XY female ovaries (Fig. 4C, panel 1), where only the germ cells stain prominently. In the XYOds/+ testis (Fig. 4C, panel 4), the main coelomic blood vessel was not fully resolved and showed a range of abnormalities such as being barely visible or not running the full length of the gonad. Invariably the collateral branches were less distinct, not well organized and reduced in number. The typical, distinct male pattern of vascularization was again restored in XYOds/Ods homozygote testes (Fig. 4C, panel 5).
Expression of Wnt4 in embryonic gonads
The expression of Wnt4, which is known to be a key signaling molecule in the establishment of the correct gonadal pattern of vascularization, was investigated using RNA in situ hybridization to sections of E11.5–12.0 gonads. As shown in Figure 5, Wnt4 was well expressed in XY female gonads (upper panel), but could not be detected in wild-type XY male gonads (middle panel). In both cases, Wnt4 was also expressed in the mesonephros. Unlike in wild-type XY males, Wnt4 was expressed in XYOds/+ male gonads. Although in situ analysis is not quantitative, it appeared to be expressed at a level lower than that seen in normal females, by comparison to the levels seen in the mesonephros. Finally, in XYOds/Ods homozygous males, although Wnt4 was well expressed in the mesonephros, it was not detectable in the gonad.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
The data reported here show that in the XY
Ods/+ mouse, expression of Sox9, in the absence of Sry, is sufficient to fully activate not only the testis-determining pathway but also the downstream differentiation pathway, leading to the formation of a fertile male mouse. Unexpectedly, the fertility of the XYOds/+ males declined over time. Two main hypotheses can be examined to explain this loss. First, as XYTgSry and XYTgSry,Ods/+ males are fully fertile for at least 1 year, Sry expression could be directly needed in the adult testes for the maintenance of spermatogenesis. However, this seems unlikely as Sry transcripts are expressed in a circular form in the adult male germ line, predominantly in the spermatids and are not thought to be functionally translated (19,20).
Another possibility is that male development driven by Ods leads to some inadequacy during the testis determination and/or differentiation phase, manifesting itself in the progressive reproductive failure seen in adult XYOds/+ males. In this respect, western blot analysis showed that at 21 days the level of SOX9 expression in the testes of XYOds/+ males was only 25% that of their XYTgSry,Ods/+ littermates, whereas in XYOds/Ods homozygotes SOX9 levels were increased to almost normal levels. These data suggest the possibility that insufficient Sox9 in XYOds/+ male gonads underlie the observed reproductive failure. This is consistent with the fact that increasing the levels of SOX9 (in the absence of Sry), by using XYOds/Ods males, led to a rescue the spermatogenesis defects and the progressive loss of fertility and restored the histology of the testis to normal. This phenotypic rescue suggests that it is the low level of SOX9, rather than a direct effect of the absence of SRY, which is responsible for the abnormal histology and decline in fertility seen in XYOds/+ heterozygous males. The fact that XYTgSry,Ods/+ males show long-term fertility indicates that the role of Sry with respect to fertility is to establish, either directly or indirectly, the correct level of SOX9 expression at the time of testis determination, which is critical to form a fully functional tesis. In the case of XYOds/+ males, insufficient expression of SOX9 may lead to a small defect in testis development, which manifests as a progressive loss of fertility over time.
One such abnormality which was clearly evident was a malformation of the vascularization within the gonad (Fig. 4). Wild-type XY male gonads establish a characteristic pattern of blood flow at E11.5–12.0 when a large male-specific artery becomes visible under the coelomic surface (18). Examination of the vasculature pattern in adult XYOds/+ testes showed that there were clear defects when compared with that of wild-type XY or XYTgSry,Ods/+ males. The main coelomic artery, present just below the surface of the gonad, although present, was not fully resolved. It did not run the full length of the testis and there was a reduction in the number and branching of the collateral vessels. This defect could also be detected in E13.5 XYOds/+ embryonic gonads by direct visualization and by wholemount PECAM immunostaining. Again the main coelomic artery was only partially formed, did not run the entire length of the gonad (or was virtually absent) and had collateral branches which were highly disorganized. The adult and embryonic vasculature defects were both fully rescued in homozygous E13.5 XYOds/Ods gonads suggesting that, like the fertility defect, they are a consequence of insufficient Sox9. This effect is consistent with our previous results in which we showed that the genetic background could influence whether XXOds/+ mice developed as males, females or intersexes (12). In contrast, homozygous XXOds/Ods mice, which have higher levels of SOX9 protein in the E11.5 gonad, were invariably male whatever the genetic background (12).
Wnt4 is a member of a large family of WNT signaling glycoprotein molecules which act locally as secreted growth factors (21). In the mouse, Wnt4 is expressed in embryonic gonads of both sexes prior to E11.5, at which time it is down-regulated in wild-type XY male gonads but continues to be well expressed in XX female gonads during sexual differentiation (8). Wnt4 expression inhibits steroid production in XX females by repressing mesonephric, endothelial and steroidogenic cell migration into the gonad (9,10). Wnt4 misexpression in XY males has been shown to inhibit the correct coalescence of the male-specific coelomic blood vessel. In transgenic mice, its misexpression in the male gonad leads to a disruption of embryonic and adult vascular patterning and even sterility on some genetic backgrounds (10,11). An examination of the expression of Wnt4 in fetal gonads at E11.5–E12 showed that, unlike in wild-type males, it was not fully down-regulated in XYOds/+ gonads. In addition, the vasculature abnormalities observed in XYOds/+ testes were similar to those seen in transgenic XY male mice misexpressing the human WNT4 transgene or a mouse Sf1:Wnt4 construct (10,11). In contrast, XYOds/Ods males fully down-regulated Wnt4 and the gonadal vasculature appeared normal. This is consistent with the expression of Wnt4 underlying the vasculature abnormalities. These data suggest that Sox9 signaling is responsible (either directly or indirectly) for down-regulating Wnt4 expression in wild-type XY male gonads, allowing normal male sex determination and correct testis vascularization to occur. In heterozygous XYOds/+ mice, the level of SOX9 may be insufficient to completely down-regulate Wnt4, leading to the observed vasculature defects. When SOX9 levels are increased as in XYOds/Ods males, Wnt4 is correctly down-regulated and the vasculature pattern develops normally.
The primary cause of spermatogenesis failure in the XYOds/+ mouse is not known. It is possible that a continued low level of SOX9 expression in adult Sertoli cells simply compromizes their ability to functionally interact with germ cells leading to a breakdown in spermatogenesis over time. Another explanation, which we favor, is that it is due to the inability of XYOds/+ males to correctly form the intricate male-specific vasculature during a critical stage in embryogenesis. Normally, the coelomic vessel and the interstitial vasculature surround the developing testis cords and cooperate with the Sertoli cells in the deposition of the basement membrane components of testis cords and the formation of the blood–testis barrier essential for maintenance of the unique microenvironment within the testicular tubules required for spermatogenesis. Thus, any early defects in testis vasculature may well impact this microenvironment over time, leading to a cessation of spermatogenesis.
Low levels of testosterone are also known to impact fertility. Although circulating testosterone levels were not measured in our mice, seminal vesicle weights and morphology of all genotypes were normal, implying that testosterone levels in XYOds/+ males were unaffected. Leydig cell histology and function (as judged by p450scc immunostaining) appeared normal except for some hyperplasia seen in 10 month XYOds/+ adults (Fig. 2C). In addition, XXOds/+ males are indistinguishable from wild-type XY males in a variety of behavioral aggression testes known to be dependent on gonadal steroids (Dr S. Maxton, University of Connecticut, personal communication). These data suggest that the primary cause of the breakdown in spermatogenesis seen in XYOds/+ heterozygous males is not due to a repression of steroidogenesis. This is in accordance with the findings of Jeays-Ward et al. who reported a similar failure of coelomic vessel coalescence and disorganized branching in the gonad vasculature of XY males expressing an Sf1:Wnt4 transgene. They concluded that ectopic Wnt4 did not inhibit Leydig cell differentiation and steroidogenesis, but rather acts to represses the migration of steroidogenic adrenal precursors into the XX gonad. In contrast, Jordan et al. found that testosterone levels were significantly reduced in their XY WNT4 transgenic mice leading to significantly smaller seminal vesicles with abnormal morphology. These differences may well be due to the different spatio-temporal expression pattern and actual levels ectopically expressed by the different transgenes.
In addition to influencing blood vessel formation in the gonad, Wnt4 has also been shown to play a critical role in the sex determination cascade with Wnt4-null XX female mice appearing masculinized due to the absence of Müllerian ducts and persistence of the Wolffian ducts (8). In human, duplication of chromosome 1p31–p35, a region which contains the WNT4 gene, has also been associated with an intersex phenotype in a 46, XY patient (22). Although XYOds/+ mice do not show any evidence of ovarian development in the embryonic or adult gonad, it cannot be ruled out that the compromised fertility seen in XYOds/+ males is due to the misexpression of Wnt4, activating downstream pathways, antagonistic to spermatogenesis.
In summary, these data demonstrate that in the absence of Sry, activation of the sex-determining pathway at the level of Sox9 can lead to the formation of a fully fertile male. They suggest that Sry is indirectly needed in spermatogenesis to establish the correct level of SOX9 expression in the gonad at the time of sex determination. This level appears critical to the establishment of a fully functional testis with normal long-term fertility. They also indicate that SOX9 may either directly or indirectly control the repression of Wnt4 in the developing male gonad, critical to the establishment of the correct testicular pattern of vascularization. They underline the importance of gene dosage in the steps needed for functional testis formation.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Breeding strategies
An XY
TgSry transgenic male on the random bred MFI background (kindly provided Dr P. Burgoyne, NIMR, UK) was crossed with an (A/JxFVB)F1Ods/+ fertile female. Offspring carrying Ods were identified visually by the characteristic eye phenotype of micropthalmia with cataracts and confirmed by PCR analysis using transgene specific tyrosinase primers as previously described (3). Mice carrying the Sry transgene were identified using Sry specific primers SRYF/R (catttatggtgtggtcccgt and atctctgtgcctcctggaaa) and the Y chromosome was identified using Y specific primers 207F/R (3). Breeding was continued by backcrossing XYTgSry,Ods/+ males with wild-type FVB females for 12 generations. To produce homozygous Ods/Ods mice, an N9 XYTgSry,Ods/+ male was crossed with an XX (A/JxFVB)F1 Ods/+ female. Homozygous Ods/Ods mice were visually distinguished from heterozygotes by intensity of coat color and severity of the eye phenotype. This was then confirmed by PCR as previously reported (13).
Histology, immunohistochemistry and in situ hybridization
After sacrifice, embryonic or adult gonads were removed, fixed in 4% formaldehyde (Polyscience, Inc.) overnight and processed for standard histological staining with hemotoxylin and eosin. SOX9 antibody was a generous gift of Dr F. Poulat (INSERM, Montpellier) and GCNA1 (23) was supplied by Dr G.C. Enders. Cytochrome P450 side chain cleavage antibody (rabbit anti-rat) was purchased from Chemicon. GCNA1 and P450scc were visualized using appropriate fluorescently labeled secondary antibodies (Molecular Probes Inc.) The Wnt4 in situ probe was amplified by RT–PCR from 11.5 FVB mixed XX and XY gonads according to Stark et al. (24), using primers Wnt4F and Wnt4R (aggagtgccaataccagttcc and tgtgagaaggctacgccata) and cloned into the PCR4TOPO vector (Invitrogen). The paraffin-embedded embryos were transversely sectioned at 5 µM. RNA in situ hybridization was performed as previously described (25). The pictures were created by directly merging the dark and bright field images captured using an Olympus DP70 digital camera.
Western blots
For western analysis, proteins were extracted from single 21-day-old testes by homogenization in lysis buffer (20 mM Tris–HCl pH 8.0, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100) containing a cocktail of protease inhibitors (Roche). After denaturation, proteins (10 µg/lane) were separated on 7.5–10% SDS–PAGE gels (Biorad), electrotransferred onto PVDF membranes (Millipore) and probed with SOX9 antibody diluted 1 : 1000 (kindly provided by Dr F. Poulat, INSERM, Montpellier, France). After washing, antibody binding was visualized using a Western Lightning kit used according to the manufacturer's instructions (Perkin–Elmer Inc.). Blots were also probed with an actin antibody as an internal loading control. After exposure, blots were scanned and the net image intensity measured using Kodak 1D image analysis software package (Eastman-Kodak Inc.). The data were expressed as relative net intensity of SOX9/actin with the XYSry,Ods/+ male value normalized to 100%.
Whole-mount immunohistochemistry
Embryos were collected at E13.5 and the fetal gonads were dissected and fixed in 4% formaldehyde overnight. Monoclonal PECAM-1 antibody (CD-31, PharminGen) was used according to established protocols.
|
ACKNOWLEDGEMENTS |
|---|
We thank Ms C. Troung for excellent technical assistance, Dr P. Burgoyne for supplying the XY
TgSry males, Dr F. Poulat for the SOX9 antibody and Dr G. Enders for antibody to GCNA1. This work was supported by grants from the NIH and March of Dimes Birth Defects Foundation (to C.E.B.).
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
- Brennan, J. and Capel, B. (2004) One tissue, two fates: molecular genetic events that underlie testis versus ovary development. Nat. Rev. Genet., 5, 509–521.[Web of Science][Medline]
-
Swain, A. and Lovell-Badge, R. (1999) Mammalian sex determination: a molecular drama. Genes Dev., 13, 755–767.
[Free Full Text] - Bishop, C.E., Whitworth, D.J., Qin, Y., Agoulnik, A.I., Agoulnik, I.U., Harrison, W.R., Behringer, R.R. and Overbeek, P.A. (2000) A transgenic insertion upstream of sox9 is associated with dominant XX sex reversal in the mouse. Nat. Genet., 26, 490–494.[CrossRef][Web of Science][Medline]
- Vidal, V.P., Chaboissier, M.C., de Rooij, D.G. and Schedl, A. (2001) Sox9 induces testis development in XX transgenic mice. Nat. Genet., 28, 216–217.[CrossRef][Web of Science][Medline]
-
Wunderle, V.M., Critcher, R., Hastie, N., Goodfellow, P.N. and Schedl, A. (1998) Deletion of long-range regulatory elements upstream of SOX9 causes campomelic dysplasia. Proc. Natl Acad. Sci. USA, 95, 10649–10654.
[Abstract/Free Full Text] - Huang, B., Wang, S., Ning, Y., Lamb, A. and Bartley, J. (1999) Autosomal XX sex reversal caused by duplication of SOX9. Am. J. Med. Genet., 87, 349–353.[CrossRef][Web of Science][Medline]
-
Chaboissier, M.C., Kobayashi, A., Vidal, V.I., Lutzkendorf, S., Van De Kant, H.J., Wegner, M., De Rooij, D.G., Behringer, R.R. and Schedl, A. (2004) Functional analysis of Sox8 and Sox9 during sex determination in the mouse. Development, 131, 1891–1901.
[Abstract/Free Full Text] - Vainio, S., Heikkila, M., Kispert, A., Chin, N. and McMahon, A.P. (1999) Female development in mammals is regulated by Wnt-4 signalling. Nature, 397, 405–409.[CrossRef][Medline]
- Yao, H.H., Matzuk, M.M., Jorgez, C.J., Menke, D.B., Page, D.C., Swain, A. and Capel, B. (2004) Follistatin operates downstream of Wnt4 in mammalian ovary organogenesis. Dev. Dyn., 230, 210–215.[CrossRef][Web of Science][Medline]
-
Jeays-Ward, K., Hoyle, C., Brennan, J., Dandonneau, M., Alldus, G., Capel, B. and Swain, A. (2003) Endothelial and steroidogenic cell migration are regulated by WNT4 in the developing mammalian gonad. Development, 130, 3663–3670.
[Abstract/Free Full Text] -
Jordan, B.K., Shen, J.H., Olaso, R., Ingraham, H.A. and Vilain, E. (2003) Wnt4 overexpression disrupts normal testicular vasculature and inhibits testosterone synthesis by repressing steroidogenic factor 1/beta-catenin synergy. Proc. Natl Acad. Sci. USA, 100, 10866–10871.
[Abstract/Free Full Text] -
Qin, Y., Poirier, C., Truong, C., Schumacher, A., Agoulnik, A.I. and Bishop, C.E. (2003) A major locus on mouse chromosome 18 controls XX sex reversal in Odd Sex (Ods) mice. Hum. Mol. Genet., 12, 509–515.
[Abstract/Free Full Text] -
Qin, Y., Kong, L.K., Poirier, C., Truong, C., Overbeek, P.A. and Bishop, C.E. (2004) Long-range activation of Sox9 in Odd Sex (Ods) mice. Hum. Mol. Genet., 13, 1213–1218
[Abstract/Free Full Text] - Mazeyrat, S., Saut, N., Grigoriev, V., Mahadevaiah, S.K., Ojarikre, O.A., Rattigan, A., Bishop, C.E., Eicher, E.M., Mitchell, M.J. and Burgoyne, P.S. (2001) A Y-encoded subunit of translation initiation factor EIF2 is essential for mouse spermatogenesis. Nat. Genet., 29, 49–53.[CrossRef][Web of Science][Medline]
- Sutcliffe, M.J. and Burgoyne, P.S. (1989) Analysis of the testes of H-Y negative XOSxrb mice suggests that the spermatogenesis gene (Spy) acts during the differentiation of the A spermatogonia. Development, 107, 373–380.[Abstract]
- Gubbay, J., Koopman, P., Collignon, J., Burgoyne, P. and Lovell-Badge, R. (1990) Normal structure and expression of Zfy genes in XY female mice mutant in Tdy. Development, 109, 647–653.[Abstract]
-
Mahadevaiah, S.K., Lovell-Badge, R. and Burgoyne, P.S. (1993) Tdy-negative XY, XXY and XYY female mice: breeding data and synaptonemal complex analysis. J. Reprod. Fertil., 97, 151–160.
[Abstract/Free Full Text] - Brennan, J., Karl, J. and Capel, B. (2002) Divergent vascular mechanisms downstream of Sry establish the arterial system in the XY gonad. Dev. Biol., 244, 418–428.[CrossRef][Web of Science][Medline]
- Capel, B., Swain, A., Nicolis, S., Hacker, A., Walter, M., Koopman, P., Goodfellow, P. and Lovell-Badge, R. (1993) Circular transcripts of the testis-determining gene Sry in adult mouse testis. Cell, 73, 1019–1030.[CrossRef][Web of Science][Medline]
- Zwingman, T., Fujimoto, H., Lai, L.W., Boyer, T., Ao, A., Stalvey, J.R., Blecher, S.R. and Erickson, R.P. (1994) Transcription of circular and noncircular forms of Sry in mouse testes. Mol. Reprod. Dev., 37, 370–381.[CrossRef][Web of Science][Medline]
-
Cadigan, K.M. and Nusse, R. (1997) Wnt signaling: a common theme in animal development. Genes Dev., 11, 3286–3305.
[Free Full Text] - Jordan, B.K., Mohammed, M., Ching, S.T., Delot, E., Chen, X.N., Dewing, P., Swain, A., Rao, P.N., Elejalde, B.R. and Vilain, E. (2001) Up-regulation of WNT-4 signaling and dosage-sensitive sex reversal in humans. Am. J. Hum. Genet., 68, 1102–1109.[CrossRef][Web of Science][Medline]
- Enders, G.C. and May, J.J., II (1994) Developmentally regulated expression of a mouse germ cell nuclear antigen examined from embryonic day 11 to adult in male and female mice. Dev. Biol., 163, 331–340.[CrossRef][Web of Science][Medline]
- Stark, K., Vainio, S., Vassileva, G. and McMahon, A.P. (1994) Epithelial transformation of metanephric mesenchyme in the developing kidney regulated by Wnt-4. Nature, 372, 679–683.[CrossRef][Medline]
-
Zhao, S., Hung, F.C., Colvin, J.S., White, A., Dai, W., Lovicu, F.J., Ornitz, D.M. and Overbeek, P.A. (2001) Patterning the optic neuroepithelium by FGF signaling and Ras activation. Development, 128, 5051–5060.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  D. M. Maatouk, L. DiNapoli, A. Alvers, K. L. Parker, M. M. Taketo, and B. Capel Stabilization of {beta}-catenin in XY gonads causes male-to-female sex-reversal Hum. Mol. Genet., October 1, 2008; 17(19): 2949 - 2955. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. T. Maciel-Guerra, M. P. de Mello, F. B. Coeli, M. L. Ribeiro, M. L. Miranda, A. P. Marques-de-Faria, M. T. M. Baptista, S. G. Moraes, and G. Guerra-Junior XX Maleness and XX True Hermaphroditism in SRY-Negative Monozygotic Twins: Additional Evidence for a Common Origin J. Clin. Endocrinol. Metab., February 1, 2008; 93(2): 339 - 343. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. DiNapoli and B. Capel SRY and the Standoff in Sex Determination Mol. Endocrinol., January 1, 2008; 22(1): 1 - 9. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. O'Shaughnessy, P. J. Baker, A. Monteiro, S. Cassie, S. Bhattacharya, and P. A. Fowler Developmental Changes in Human Fetal Testicular Cell Numbers and Messenger Ribonucleic Acid Levels during the Second Trimester J. Clin. Endocrinol. Metab., December 1, 2007; 92(12): 4792 - 4801. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Feng, N. V Bogatcheva, A. Truong, B. Korchin, C. E Bishop, T. Klonisch, I. U Agoulnik, and A. I Agoulnik Developmental Expression and Gene Regulation of Insulin-like 3 Receptor RXFP2 in Mouse Male Reproductive Organs Biol Reprod, October 1, 2007; 77(4): 671 - 680. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. J. Bouma, L. L. Washburn, K. H. Albrecht, and E. M. Eicher Correct dosage of Fog2 and Gata4 transcription factors is critical for fetal testis development in mice PNAS, September 18, 2007; 104(38): 14994 - 14999. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S Pujar, K. Kothapalli, H. Goring, and V. Meyers-Wallen Linkage to CFA29 Detected in a Genome-Wide Linkage Screen of a Canine Pedigree Segregating Sry-Negative XX Sex Reversal J. Hered., August 3, 2007; (2007) esm028v2. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Wilhelm, S. Palmer, and P. Koopman Sex Determination and Gonadal Development in Mammals Physiol Rev, January 1, 2007; 87(1): 1 - 28. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Rajender, K. Thangaraj, N. J. Gupta, N. Leelavathy, D. S. Rani, R. G. Nambiar, V. Kalavathy, S. T. Santhiya, S. Rajangam, P. M. Gopinath, et al. A Novel Human Sex-Determining Gene Linked to Xp11.21-11.23 J. Clin. Endocrinol. Metab., October 1, 2006; 91(10): 4028 - 4036. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Barrionuevo, S. Bagheri-Fam, J. Klattig, R. Kist, M. M. Taketo, C. Englert, and G. Scherer Homozygous Inactivation of Sox9 Causes Complete XY Sex Reversal in Mice Biol Reprod, January 1, 2006; 74(1): 195 - 201. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Nowacka, W. Nizanski, M. Klimowicz, S. Dzimira, and M. Switonski Lack of the SOX9 Gene Polymorphism in Sex Reversal Dogs (78,XX; SRY negative) J. Hered., November 1, 2005; 96(7): 797 - 802. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Kanai, R. Hiramatsu, S. Matoba, and T. Kidokoro From SRY to SOX9: Mammalian Testis Differentiation J. Biochem., July 1, 2005; 138(1): 13 - 19. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||