Human Molecular Genetics Advance Access originally published online on April 19, 2006
Human Molecular Genetics 2006 15(11):1808-1815; doi:10.1093/hmg/ddl103
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DM2 intronic expansions: evidence for CCUG accumulation without flanking sequence or effects on ZNF9 mRNA processing or protein expression
1Department of Genetics, Cell Biology and Development, 2Institute of Human Genetics and 3Department of Neurology, University of Minnesota, MMC 206, 420 Delaware Street, S.E. Minneapolis, MN 55455, USA, 4Department of Neurology and 5Friedrich-Baur Institute, Ludwig-Maximilians University, Munich, Germany
* To whom corresponding author should be addressed. Tel: +1 6126240901; Fax: +1 6126258488; Email: ranum001{at}umn.edu
Received February 28, 2006; Accepted April 7, 2006
| ABSTRACT |
|---|
|
|
|---|
Myotonic dystrophy type 2 (DM2) is caused by a CCTG expansion mutation in intron 1 of the zinc finger protein 9 (ZNF9) gene. The mean expansion size in patients is larger than for DM1 or any previously reported disorder (mean=5000 CCTGs; range=7511 000), and similar to DM1, repeats containing ribonuclear inclusions accumulate in affected DM2 tissue. Although an RNA gain-of-function mechanism involving DM1 CUG or DM2 CCUG expansion transcripts is now well established, still debated are the potential role that flanking sequences within the DMPK 3'-UTR may have on disease pathogenesis and whether or not decreased expression of DMPK, ZNF9 or neighboring genes at these loci contribute to disease. To address these questions in DM2, we have examined the nucleic acid content of the ribonuclear inclusions and the effects of these large expansions on ZNF9 expression. Using cell lines either haploid or homozygous for the expansion, as well as skeletal muscle biopsy tissue, we demonstrate that pre-mRNAs containing large CCUG expansions are normally spliced and exported from the nucleus, that the expansions do not decrease ZNF9 expression at the mRNA or protein level, and that the ribonuclear inclusions are enriched for the CCUG expansion, but not intronic flanking sequences. These data suggest that the downstream molecular effects of the DM2 mutation are triggered by the accumulation of CCUG repeat tract alone.
| INTRODUCTION |
|---|
|
|
|---|
Myotonic dystrophy (DM), the most common form of muscular dystrophy in adults, affects 1 in 8000 individuals (1
Although DM2 often has a milder disease course than DM1, the mean DM2 repeat expansion size (5000 CCTGs or 20 kb) is significantly longer than the largest expansions that have been reported for DM1 (4000 CTGs or 12 kb) (9
,15
). Although DM2 patients have a broad range of repeat sizes, 75 to >11 000 CCTGs, marked somatic instability of the expansion has made it difficult to define the pathogenic threshold (2
,15
). Although genetic and functional studies now make it clear that RNA gain-of-function effects of the CUG and CCUG transcripts play a major role in the disease, still debated is whether or not additional portions of the DM1 3'-UTR (16
,17
) or changes in expression of DMPK, ZNF9 or other genes at these loci might play a role in the clinical differences between these disorders (18
). ZNF9, a nucleic acid binding protein highly expressed in skeletal muscle, has been suggested to modulate the activity of the beta-myosin heavy chain making it tempting to speculate that dysregulation of ZNF9 might be involved in some aspect of the disease process (19
). To unambiguously address whether or not the DM2 expansion alters ZNF9 expression in tissue known to be affected by the disease, and to define the portion of the ZNF9 pre-mRNA contained in the ribonuclear inclusions, we have performed a series of fluorescent in situ hybridization (FISH) and expression studies using myoblasts homozygous for the expansion, haploid hybrid cell lines and skeletal muscle biopsy tissue.
| RESULTS |
|---|
|
|
|---|
Large DM2 expansions do not prevent splicing of intron 1
DM2 CCTG repeat expansions are larger than DM1 CTG repeat tracts and dramatically larger than any reported polyglutamine expansion disorder (Fig. 1A). To determine if large DM2 CCTG expansions affect allele-specific splicing of ZNF9, we examined monoallelic mousehuman hybrid cell lines (20
|
To further examine the effects of the CCTG expansion on ZNF9 expression, heterozygous and homozygous human myoblast cell lines established from a previously reported DM2 pedigree were used (Fig. 1C) (21
4700 CCTGs. Consistent with previous reports showing that DM2 expansions are often difficult to detect by Southern analysis because of marked somatic heterogeneity (2
Alternative splicing of ZNF9 transcripts is not affected in DM2 skeletal muscle biopsies
Normally, the ZNF9 gene expresses two alternatively spliced mRNA isoforms (
and ß) with the longer transcript containing an additional 21 nucleotides at the 3' end of exon 2. To determine if the DM2 expansion alters the normally equal ratios of these alternatively spliced transcripts, RT-PCR between exons 2 and 3 was performed on RNA from skeletal muscle biopsies of five heterozygous DM2 patients with CCTG expansions of: (a) 2000 and 6000; (b) 5600; (c) 10 900; (d) 11 000 and (e) 11 000 repeats and three controls. RT-PCR shows that the DM2 expansions do not affect the ratio of alternatively spliced ZNF9 transcripts with alternative splice forms of ZNF9 expressed at approximately equal levels in both control and affected tissue (P-value=0.63) (Fig. 1F), with a representative example of the data shown in Figure 1G.
DM2 expansions do not prevent ZNF9 mRNA export into the cytoplasm
To determine if large expansions affect the export of ZNF9 mRNA from the nucleus to the cytoplasm, RNA FISH was performed using a cy3-labeled (CAGG)10 oligonucleotide probe to the CCUG repeat (Fig. 2A) and fluorescently labeled FITC probes to both exon 1 and 5 of the ZNF9 transcript (Fig. 2B and C). As with other DM1 and DM2 cell lines, many intense repeat containing foci were observed in both the heterozygous and homozygous DM2 myoblasts, but not in control cells (Fig. 2A). Transcripts containing exon 1 and 5 are primarily localized to the cytoplasm, with a distribution that is comparable to control myoblasts (Fig. 2C). Neither the exon 1 nor exon 5 sequences co-localize with the ribonuclear inclusions indicating that the inclusions contain the CCUG repeat tract, but not the exonic portions of the ZNF9 pre-mRNA, and that both DM2 expansion and control transcripts are spliced and exported to the cytoplasm.
|
CCUG ribonuclear inclusions do not contain other portions of intron 1
To determine if the ribonuclear inclusions contain other portions of intron 1, a cocktail of 15 fluorescently labeled oligonucleotide probes designed to recognize unique sequences in intron 1 were hybridized to muscle biopsies from a heterozygous DM2 patient (>11 000 CCTGs) and a control (Fig. 3A). In DM2 and control biopsies, the intronic probes primarily labeled two focal spots within the nucleus (Fig. 3B), consistent with relatively high levels of intron containing transcripts expected at the sites of transcription, but not the FITC-labeled CCUG ribonuclear inclusions (22
|
As a control, FISH analysis using the same set of intron probes on haploid hybrid DM2 expansion containing cell lines showed a single spot consistent with the expected single site of transcription (Fig. 3C). In addition, when the cells were treated with DNase after fixation, the FISH signal remained, whereas treatment with RNase prevented hybridization. These data indicate that the FISH signal generated from the intron probes results from the relatively high focal expression of RNA transcripts and not DNA. BLAST analysis of each individual intron probe indicated that each of these oligonucleotides should be specific to intron 1 of ZNF9. To experimentally control for the possibility that one of these probes unexpectedly recognizes a repetitive sequence in the genome and non-specific hybridization of one of these probes is primarily responsible for the signal, haploid cells were labeled with three different overlapping subsets of the intron probes, each containing 10 of the 15 oligonucleotides. In each of these control experiments, a single focal hybridization signal was detected indicating that this cocktail of probes is specific for transcripts containing intron 1 of ZNF9.
Although the expression of intron containing ZNF9 pre-mRNA transcripts are easily detected at two focal spots within diploid skeletal muscle nuclei, CCUG transcripts were only detected by the FITC-CAGG probe in the ribonuclear inclusions, but not as expected, at the additional site of transcription corresponding to the expanded allele (Fig. 3B). An additional double labeling experiment using cy3-CAGG and FITC-CAGG probes shows that the FITC-CAGG probe is not as sensitive as the cy3-CAGG probe and that this lack of sensitivity is likely to explain why the FITC-CAGG probe labels only the larger inclusion, but does not co-localize to the signal from the intron probes transcribed from the expanded allele (Fig. 3D). In contrast, the more sensitive cy3-CAGG probes co-localize with both the large FITC labeled inclusion and another smaller spot within the skeletal muscle nuclei (Fig. 3D).
In summary, the detection of ZNF9 intron transcripts at the sites of transcription, but not within the inclusions strongly suggests that the ribonuclear inclusions, which are highly enriched for the CCUG repeat sequence, contain little or no flanking intron RNA.
Expression of ZNF9 is not affected by the presence of large expansions
Homozygous myoblast cell lines allowed us to assess the effects of the expansion on ZNF9 expression without the expression, or possible compensatory up-regulation of the normal allele. Northern analysis showed that myoblasts heterozygous or homozygous for the DM2 expansion have steady-state mRNA levels that are comparable with controls (Fig. 4A and B); these experiments were performed in quadruplicate with no significant differences between the three cell lines (P-value=0.32). Similarly, western analysis, performed in quadruplicate, showed no differences in ZNF9 protein between heterozygous and homozygous myoblasts compared with controls (P-value=0.61) (Fig. 4C and D).
|
To determine if ZNF9 expression is affected in a clinically relevant patient tissue, western analysis was performed using skeletal muscle biopsy tissue from four heterozygous DM2 patients (pt1: 2000 and 6000; pt2: 2875; pt3: 5625; and pt4: >11 000 CCTG repeats) and four controls with no differences found (P-value=0.65, experiments were performed in triplicate) (Fig. 4E), a representative blot is shown in Figure 4F.
| DISCUSSION |
|---|
|
|
|---|
How the DM1 CTG expansion mutation in the 3'-UTR of DMPK could cause the multisystemic features of DM without changing the sequence of a protein was the subject of debate for nearly a decade. Models proposed included haploinsufficiency of DMPK, haploinsufficiency of neighboring genes including SIX5 and DMWD, and pathogenic effects of the RNAs containing the CUG expansion. The identification of the DM2 mutation suggested a simpler, and now largely accepted model of DM pathogenesis in which the clinical features common to both diseases are caused by the pathogenic effects of RNA containing the CUG and CCUG expansions (23
Although the DM1 and DM2 phenotypes are strikingly similar, they are not identical. DM2 does not show a congenital form of the disease or the severe central nervous system involvement seen in some DM1 patients (2
). In addition, DM2 is characterized by more clinically significant proximal weakness (2
,25
), and the prominent type 1 fiber atrophy seen in DM1 is not seen in DM2 (26
). These clinical distinctions could be caused by differences in the temporal or spatial levels of transcripts containing the expanded repeats or downstream differences in CUG and CCUG RNA-binding proteins. Alternatively, differences between DM2 and DM1 could reflect changes in ZNF9, DMPK, or other locus-specific genes such as KIAA1160, glycoprotein IX, SIX5 or DMWD.
As various hypotheses for the downstream molecular pathogenesis of these differences are tested, comparisons in the pathology, the context of the mutations and the downstream molecular changes found in DM1 and DM2 will be critically important for evaluating the validity of these models and to prioritize efforts to focus on the most likely mechanisms. Although such hypothesis are often tested in cell culture or model systems, caution should be used in interpreting whether or not changes seen are consistent with what is found the human disease.
The normal function of ZNF9 as a nucleic acid binding protein, whose alternatively spliced isoforms have been suggested to modulate the expression of the beta-myosin heavy chain gene (19
), make it tempting to speculate that dysregulation of ZNF9 could be involved in some aspect of DM2. However, for this to be a viable hypothesis, the DM2 CCTG expansion would be expected to affect ZNF9 expression.
Although a single study reported no effect of the DM2 expansion on ZNF9 in transformed LCLs, there is no known pathological involvement of blood in DM (27
). To examine this question in more detail, we used a variety of approaches to determine if the large intronic DM2 expansions affect ZNF9 expression, including the use of homozygous myoblast and haploid cell lines to ensure that we could clearly assess the allele-specific effects of the CCTG expansion without the interference or possible up-regulation of the other gene. These data show that large DM2 expansions do not prevent allele-specific pre-mRNA splicing, nuclear export or steady-state mRNA or protein levels. These trends were validated by western analysis of skeletal muscle biopsy tissue, which showed nearly identical levels of ZNF9 protein in patient and control groups. These data indicate that large DM2 expansions do not alter ZNF9 expression, making any role for ZNF9 protein in the pathogenesis of DM2 or phenotypic differences between DM1 and DM2 unlikely.
Several DM1 studies (16
,17
,28
) suggest that sequences flanking the CTG expansion increase the pathogenicity of the expansion. Whereas in DM1, the CUG expansion is expressed as part of the mature DMPK mRNA, and flanking sequences have been shown to co-localize to the inclusions (29
), the intronic location of the DM2 expansion raises the question of what portion of the ZNF9 pre-mRNA, if any, accumulates along with the CCUG sequences in the ribonuclear inclusions. We examined this question by performing a series of FISH experiments. Consistent with the expression studies, exon sequences were shown to be primarily localized to the cytoplasm. In addition, FISH analysis using a panel of intron probes and a CAGG probe to detect the expansion, show that the ribonuclear inclusions are enriched for the CCUG expansion, but not the flanking intronic sequences. These data suggest that the downstream molecular effects of the DM2 mutation may be triggered by the accumulation of CCUG repeat tract alone.
In summary, using patient-derived myoblast cell lines and DM2 skeletal muscle biopsy tissue we show that even very large DM2 CCTG expansions (up to 11 000 CCTGs): (1) do not prevent allele-specific ZNF9 pre-mRNA splicing; (2) do not affect the expression ratios of alternatively spliced transcripts; (3) do not alter steady-state levels of transcripts or protein; (4) result in accumulation of CCUG ribonuclear inclusions with no detectable portions of intronic flanking sequence. These data support a gain-of-function RNA model in which CCUG expansion themselves are sufficient to cause the multisystemic features of DM2.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Haploid, myoblast cell lines and muscle biopsy tissue
Haploid cell lines were established by GMP Genetics (Waltham, MA, USA) (20
All studies were done with the approval of the Institutional Review Board at the University of Minnesota and the Ethics Committee at the Ludwig-Maximilians University in Munich, Germany.
Southern analysis
Southern analyses were performed as previously described (2
,15
), using high concentrate (50 U/µl) EcoRI (Invitrogen).
RT-PCR
Total RNA was isolated from haploid cell lines, human myoblast cell lines and muscle tissue using an RNeasy mini kit (Qiagen, Valencia, CA, USA). Reverse transcription of RNA was done using the SuperScriptTM First-Strand Synthesis System for RT-PCR (Invitrogen) using the following first strand gene-specific primers for amplification between exons 1 and 2: ZNF9 RT E2R1 5'-CGAGCTAAAACCACCTCTGC-3'; and between exons 2 and 3: R1 5'-CCAGACTCACCACAGCGATA-3'. Subsequent PCR assays were performed under the following conditions: 3 min at 94°C, followed by 35 cycles of 94°C for 45 s, 55°C for 45 s and 72°C for 1 min, and a final extension of 72°C for 6 min. Primers used for the exons 1 and 2 assay were: exon 1 [ZNF9 E1F (5'-CTACCTTGCGAGCCGTCTT-3')]; and exon 2 [ZNF9 E2R2 (5'-GCCTCCACCAGTAGGACATT-3')]. Primers used for the exons 2 and 3 assay were: exon 2 [exon2/3 F (5'-TTCAAGTGTGGACGATCTGG-3')]; and exon 3 [exon2/3 R2 (5'-TCTGGAAGAGACGAGGAAAC-3')].
Exons 2 and 3 RT-PCR products were transferred to a nitrocellulose membrane (Amersham Biosciences, Piscataway, NJ, USA), cross-linked by UV radiation and hybridized in Rapid-Hyb buffer (Amersham Biosciences) at 60°C using a 33P-ATP end-labeled internal oligonucleotide (5'-GGAGGCCGTGGTCGTGGAAT-3') probe. Densitometry readings were performed using a Bio-Rad GS-700 imaging densitometer.
RNA fluorescent in situ hybridization
Human myoblasts were grown overnight on coverslips coated with poly-L-lysine (Sigma Diagnostics, St Louis, MO, USA) and RNA FISH was performed as described (15
). For the exon in situ hybridization studies, PCR products specific to either exon 1 or exon 5 were generated using the following primers: ZNF9 exon 1F (5'-TTGCGAGCCGTCTTCCCCAG-3'), ZNF9 exon 1R (5'-AATTAACCCTCACTAAAGGGAGAGCAGCGGCGGAGAC TCGGAC-3'); ZNF9 exon 5F (5'-GTAGCCATCAACTGCAGCAA-3') and ZNF9 exon 5R (5'- TTATACGACTCACTATAGGAGGACGGGCTTACTGGTCTGA CTC-3'). In vitro transcription and digoxigenin labeling of the PCR products was carried out with a DIG RNA Labeling Kit (Roche, Indianapolis, IN, USA). The resulting RNA probes were purified using a Chromaspin-100TM column (Clontech, Palo Alto, CA, USA) and used to probe myoblasts plated on poly-L-lysine cover slips. A FITC-labeled anti-digoxigenin antibody was used to localize transcripts in the myoblasts. The slides were co-labeled with a cy3 (CAGG)10 probe and DAPI.
For the intron localization studies, either 10 µM frozen muscle biopsy sections or haploid cells grown overnight on coverslips, were fixed with 3% paraformaldehyde in PBS for 1 h. RNA FISH was performed as above using a FITC-labeled (CAGG)10 to detect the repeat and a cocktail of the following cy3-labeled oligonucleotide probes to different portions of ZNF9 intron 1 [A (5'-AACTATCAAGGATAGGGAGT-3'), B (5'-GTTAACTCTTGGAATGTGAG-3'), C (5'-AATCAACACCTAAACCCAAATG-3'), D (5'-TTATACTGCTTGAACAAACAA-3'), E (5'-CTTCACTAGTTAACACCTCAT-3'), F (5'-TTCTTGCTCCATTTTAATGAC-3'), G (5'-ATCCTGGTTCCTGAACTTAC-3'), H (5'-CTTGTTTCCCACCTTACAGTCT-3'), I (5'-ACCCAGTTTAACTACTTGCT-3'), J (5'-TAATATAAGGCACCACTTACT-3'), K (5'-CTATTAAGTCCCAAGACACTT-3'), L (5'-CTTGTGATAGACTTGTCT-3'), M (5'-TGGCTATGAGTTACTGGTGCT-3'), N (5'-ATCTTATCTCTAGATGGTACAAG-3'), O (5'-ACACAACTACATGATTGGGTATT-3')]. Double-labeling to test the sensitivity of the CAGG probes was done by simultaneously probing a 10 µM DM2 muscle biopsy with both a FITC-CAGG and cy3-CAGG probe.
For the control studies on the DM2 haploid cells, three sets of 10 different oligonucleotides (AJ; AE; KO; FO) were used to determine intron localization. For the DNase and RNase controls, the haploid cells were treated with either 10 U/ml DNase for 2.5 min or 0.5 mg/ml RNase for 30 min at room temperature after fixation. After treatment, the protocol continued as above with the full intron probe set (AO). All RNA FISH images were captured on a Zeiss Atto Arc HBO 110W upright microscope.
Northern analysis
For northern analysis, 5 µg of total RNA isolated from control, heterozygous and homozygous myoblasts was separated on a NorthernMax-GlyTM glyoxal gel (Ambion, Austin, TX, USA), transferred to a nitrocellulose membrane, cross-linked by UV radiation and hybridized at 60°C in UltraHyb buffer (Ambion) using a 401 bp 32P-UTP labeled riboprobe generated by in vitro transcription of an exon 5 PCR product generated using primers 5F and 5R (described earlier). A commercially available riboprobe (Ambion, cat#7430) of 387 nucleotides was used to determine GAPDH mRNA levels as a loading control.
Western analysis
An affinity purified rabbit polyclonal antibody was generated by New England Peptide (Gardner, MA, USA) to the middle portion of the ZNF9 protein (N-FTSDRGFQFVSSSLPDIC-C). Myoblast cells and patient muscle biopsy tissues were lysed in radioimmunoprecipitation (RIPA) buffer containing protease inhibitors. After collection of the supernatants, the protein concentration was determined with a Bio-Rad protein assay. Protein of 1020 µg were separated by electrophoresis on NuPAGE 412% BisTris gels (Invitrogen) and transferred to nitrocellulose (Schleicher and Schuell, Keene, NH, USA). Non-specific binding was blocked with 5% non-fat milk in PBS-T (PBS with 0.1% Triton X-100) for 2 h at room temperature and incubated with ZNF9 antibody (1:1000) in 5% non-fat milk in PBS-T overnight at 4°C. After three washes in PBS-T, the membrane was incubated for 1 h at room temperature with 1:2000 anti-rabbit-HSP in 5% non-fat milk in PBS-T and visualized with ECL western blotting detection reagents (Amersham Biosciences). To assess the specificity of the polyclonal peptide antibody used in the protein quantification experiments, peptide competition assays were performed. In addition, two additional polyclonal peptide antibodies generated to the N- and C-terminal portions of ZNF9 gave similar results by Western, detecting a band of the predicted size (19 kDa).
| ACKNOWLEDGEMENTS |
|---|
We thank Joline Dalton, Anne Mosemiller and Danielle Jin for helpful discussions and the Muscular Dystrophy Association, the Nash Avery Fund and the National Institutes of Health (NS035870) for financial support. Funding to pay the Open Access publication charges for this article was provided by the Nash Avery Fund.
Conflict of Interest statement. None declared.
| REFERENCES |
|---|
|
|
|---|
- Harper, P. (1989) Myotonic Dystrophy, 2nd edn. W.B. Saunders, London.
-
Day, J.W., Ricker, K., Jacobsen, J.F., Rasmussen, L.J., Dick, K.A., Kress, W., Schneider, C., Koch, M.C., Beilman, G.J., Harrison, A.R. et al. (2003) Myotonic dystrophy type 2: molecular, diagnostic and clinical spectrum. Neurology, 60, 657664.
[Abstract/Free Full Text] - Moxley, R.T., Griggs, R.C. and Goldblatt, D. (1980) Muscle insulin resistance in myotonic dystrophy: effect of supraphysiologic insulinization. Neurology, 30, 10771083.[Web of Science][Medline]
-
Ricker, K., Koch, M., Lehmann-Horn, F., Pongratz, D., Speich, N., Reiners, K., Schneider, C. and Moxley, R.T., III (1995) Proximal myotonic myopathy: clinical features of a multisystem disorder similar to myotonic dystrophy. Arch Neurol, 52, 2531.
[Abstract/Free Full Text] - Savkur, R.S., Philips, A.V. and Cooper, T.A. (2001) Aberrant regulation of insulin receptor alternative splicing is associated with insulin resistance in myotonic dystrophy. Nat. Genet., 29, 4047.[CrossRef][Web of Science][Medline]
- Harper, P.S. (2001) Myotonic Dystrophy, W.B. Saunders, London.
- Savkur, R.S., Philips, A.V., Cooper, T.A., Dalton, J.C., Moseley, M.L., Ranum, L.P. and Day, J.W. (2004) Insulin receptor splicing alteration in myotonic dystrophy type 2. Am. J. Hum. Genet., 74, 13091313.[CrossRef][Web of Science][Medline]
- Machuca-Tzili, L., Brook, D. and Hilton-Jones, D. (2005) Clinical and molecular aspects of the myotonic dystrophies: a review. Muscle Nerve, 32, 118.[CrossRef][Web of Science][Medline]
- Brook, J.D., McCurrah, M.E., Harley, H.G., Buckler, A.J., Church, D., Aburatani, H., Hunter, K., Stanton, V.P., Thirion, J.-P., Hudson, T. et al. (1992) Molecular basis of myotonic dystrophy: expansion of a trinucleotide (CTG) repeat at the 3' end of a transcript encoding a protein kinase family member. Cell, 68, 799808.[CrossRef][Web of Science][Medline]
- Buxton, J., Shelbourne, P., Davies, J., Jones, C., Van Tongeren, T., Aslanidis, C., de Jong, P., Jansen, G., Anvret, M., Riley, B. et al. (1992) Detection of an unstable fragment of DNA specific to individuals with myotonic dystrophy. Nature, 355, 547548.[CrossRef][Medline]
-
Fu, Y.H., Pizzuti, A., Fenwick, R.G., Jr., King, J., Rajnarayan, S., Dunne, P.W., Dubel, J., Nasser, G.A., Ashizawa, T., de Jong, P. et al. (1992) An unstable triplet repeat in a gene related to myotonic muscular dystrophy. Science, 255, 12561258.
[Abstract/Free Full Text] - Harley, H.G., Brook, J.D., Rundle, S.A., Crow, S., Reardon, W., Buckler, A.J., Harper, P.S., Housman, D.E. and Shaw, D.J. (1992) Expansion of an unstable DNA region and phenotypic variation in myotonic dystrophy. Nature, 355, 545546.[CrossRef][Medline]
-
Mahadevan, M., Tsilfidis, C., Sabourin, L., Shutler, G., Amemiya, C., Jansen, G., Neville, C., Narang, M., Barcelo, J., O'Hoy, K. et al. (1992) Myotonic dystrophy mutation: an unstable CTG repeat in the 3' untranslated region of the gene. Science, 255, 12531255.
[Abstract/Free Full Text] -
Boucher, C.A., King, S.K., Carey, N., Krahe, R., Winchester, C.L., Rahman, S., Creavin, T., Meghji, P., Bailey, M.E.S., Chartier, F.L. et al. (1995) A novel homeodomain-encoding gene is associated with a large CpG island interrupted by the myotonic dystrophy unstable (CTG)n repeat. Hum. Mol. Genet., 4, 19191925.
[Abstract/Free Full Text] -
Liquori, C., Ricker, K., Moseley, M.L., Jacobsen, J.F., Kress, W., Naylor, S., Day, J.W. and Ranum, L.P.W. (2001) Myotonic dystrophy type 2 caused by a CCTG expansion in intron 1 of ZNF9. Science, 293, 864867.
[Abstract/Free Full Text] -
Amack, J.D. and Mahadevan, M.S. (2001) The myotonic dystrophy expanded CUG repeat tract is necessary but not sufficient to disrupt C2C12 myoblast differentiation. Hum. Mol. Genet., 10, 18791887.
[Abstract/Free Full Text] -
Amack, J.D., Reagan, S.R. and Mahadevan, M.S. (2002) Mutant DMPK 3'-UTR transcripts disrupt C2C12 myogenic differentiation by compromising MyoD. J. Cell Biol., 159, 419429.
[Abstract/Free Full Text] -
Tapscott, S.J. (2000) Deconstructing myotonic dystrophy. Science, 289, 17011702.
[Free Full Text] -
Flink, I.L. and Morkin, E. (1995) Alternatively processed isoforms of cellular nucleic acid-binding protein interact with a suppressor region of the human beta-myosin heavy chain gene. J. Biol. Chem., 270, 69596965.
[Abstract/Free Full Text] - Yan, H., Papadopoulos, N., Marra, G., Perrera, C., Jiricny, J., Boland, C.R., Lynch, H.T., Chadwick, R.B., de la Chapelle, A., Berg, K. et al. (2000) Conversion of diploidy to haploidy. Nature, 403, 723724.[CrossRef][Medline]
-
Schoser, B.G., Kress, W., Walter, M.C., Halliger-Keller, B., Lochmuller, H. and Ricker, K. (2004) Homozygosity for CCTG mutation in myotonic dystrophy type 2. Brain, 127, 18681877.
[Abstract/Free Full Text] -
Johnson, C., Primorac, D., McKinstry, M., McNeil, J., Rowe, D. and Lawrence, J.B. (2000) Tracking COL1A1 RNA in osteogenesis imperfecta splice-defective transcripts initiate transport from the gene but are retained within the SC35 domain. J. Cell Biol., 150, 417432.
[Abstract/Free Full Text] -
Tapscott, S.J. and Thornton, C.A. (2001) Reconstructing myotonic dystrophy. Science, 293, 816817.
[Free Full Text] - Ranum, L.P. and Day, J.W. (2004) Myotonic dystrophy: RNA pathogenesis comes into focus. Am. J. Hum. Genet., 74, 793804.[CrossRef][Web of Science][Medline]
-
Ricker, K., Koch, M.C., Lehmann-Horn, F., Pongratz, D., Otto, M., Heine, R. and Moxley, R.T., III (1994) Proximal myotonic myopathy: a new dominant disorder with myotonia, muscle weakness, and cataracts. Neurology, 44, 14481452.
[Abstract/Free Full Text] -
Vihola, A., Bassez, G., Meola, G., Zhang, S., Haapasalo, H., Paetau, A., Mancinelli, E., Rouche, A., Hogrel, J.Y., Laforet, P. et al. (2003) Histopathological differences of myotonic dystrophy type 1 (DM1) and PROMM/DM2. Neurology, 60, 18541857.
[Abstract/Free Full Text] - Botta, A., Caldarola, S., Vallo, L., Bonifazi, E., Fruci, D., Gullotta, F., Massa, R., Novelli, G. and Loreni, F. (2006) Effect of the [CCTG]n repeat expansion on ZNF9 expression in myotonic dystrophy type II (DM2). Biochim. Biophys. Acta, 1762, 329334.[Medline]
-
Storbeck, C.J., Drmanic, S., Daniel, K., Waring, J.D., Jirik, F.R., Parry, D.J., Ahmed, N., Sabourin, L.A., Ikeda, J.E. and Korneluk, R.G. (2004) Inhibition of myogenesis in transgenic mice expressing the human DMPK 3'-UTR. Hum. Mol. Genet., 13, 589600 (Published online 20 January 2004).
[Abstract/Free Full Text] -
Taneja, K.L., McCurrach, M., Schalling, M., Housman, D. and Singer, R.H. (1995) Foci of trinucleotide repeat transcripts in nuclei of myotonic dystrophy cells and tissues. J. Cell Biol., 128, 9951002.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
E. Salisbury, B. Schoser, C. Schneider-Gold, G.-L. Wang, C. Huichalaf, B. Jin, M. Sirito, P. Sarkar, R. Krahe, N. A. Timchenko, et al. Expression of RNA CCUG Repeats Dysregulates Translation and Degradation of Proteins in Myotonic Dystrophy 2 Patients Am. J. Pathol., August 1, 2009; 175(2): 748 - 762. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Huichalaf, B. Schoser, C. Schneider-Gold, B. Jin, P. Sarkar, and L. Timchenko Reduction of the Rate of Protein Translation in Patients with Myotonic Dystrophy 2 J. Neurosci., July 15, 2009; 29(28): 9042 - 9049. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. O'Rourke and M. S. Swanson Mechanisms of RNA-mediated Disease J. Biol. Chem., March 20, 2009; 284(12): 7419 - 7423. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Holt, V. Jacquemin, M. Fardaei, C. A. Sewry, G. S. Butler-Browne, D. Furling, J. D. Brook, and G. E. Morris Muscleblind-Like Proteins: Similarities and Differences in Normal and Myotonic Dystrophy Muscle Am. J. Pathol., January 1, 2009; 174(1): 216 - 227. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. P. Smith, M. Byron, C. Johnson, Y. Xing, and J. B. Lawrence Defining early steps in mRNA transport: mutant mRNA in myotonic dystrophy type I is blocked at entry into SC-35 domains J. Cell Biol., September 7, 2007; 178(6): 951 - 964. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Holt, S. Mittal, D. Furling, G. S Butler-Browne, J. D. Brook, and G. E. Morris Defective mRNA in myotonic dystrophy accumulates at the periphery of nuclear splicing speckles Genes Cells, September 1, 2007; 12(9): 1035 - 1048. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Osborne and C. A. Thornton RNA-dominant diseases Hum. Mol. Genet., October 15, 2006; 15(suppl_2): R162 - R169. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









