Human Molecular Genetics Advance Access originally published online on April 27, 2006
Human Molecular Genetics 2006 15(11):1884-1893; doi:10.1093/hmg/ddl111
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Obesity, hyperphagia and increased metabolic efficiency in Pc1 mutant mice

Genomics Institute of the Novartis Research Foundation, 10675 John Jay Hopkins Drive, La Jolla, CA 92121, USA
* To whom correspondence should be addressed. Tel: +1 8588121527; Fax: +1 8588121918; Email: ngekakis{at}gnf.org
Received December 1, 2005; Revised April 1, 2006; Accepted April 17, 2006
| ABSTRACT |
|---|
|
|
|---|
Prohormone convertase 1 (PC1) mutations lead to obesity in humans. However, Pc1 knockout mice do not become obese; in fact, they are runted due to a defect in growth-hormone releasing hormone processing, leading to the speculation that PC1 subserves different functions between mouse and human. Here, we report a novel allele of mouse Pc1 (N222D) that leads to obesity, abnormal proinsulin processing and multiple endocrinological defects. Increased energy intake and a more efficient metabolism contribute to the obesity in Pc1N222D/N222D mice. Defective proinsulin processing leads to glucose intolerance, but neither insulin resistance nor diabetes develop despite obesity. The obesity is associated with impaired autocatalytic activation of mature PC1 and reduced hypothalamic
-MSH. This is the first characterization of Pc1 mutation in a model organism that mimics human PC1 deficiency. | INTRODUCTION |
|---|
|
|
|---|
Obesity in humans and animals has been shown to result from hormonal and neuropeptide signaling defects (1
PC1 and PC2 act proximally to CPE in prohormone and neuropeptide processing. PC1 and PC2 are serine endoproteases with significant similarity to bacterial subtilisin and yeast kexin and selectively cleave substrates at dibasic residues (3
). CPE is responsible for both C-terminal exoprotease trimming of these dibasic extensions and directing substrates to the regulated secretory pathway (RSP) (8
,9
). Substrates upon which these enzymes concertedly operate include proinsulin (10
), proglucagon (11
) and proopiomelanocortin (POMC) (12
).
PC1 itself is also synthesized as an inactive precursor. Two major autocatalytic events occur (13
,14
). First, the N-terminal domain is cleaved at KR109110 within the endoplasmic reticulum, to yield an 85 kDa PC1 precursor. Within the secretory vesicles of the RSP, this larger PC1 isoform is further cleaved at RR617618, releasing the inhibitory C-terminal domain and generating a fully active 66 kDa form (15
17
). Although both the 85 and 66 kDa forms are capable of prohormone processing, the former represents a partially active form of PC1 (12
,16
). In addition, at least for provasopressin and prooxytocin, the 85 kDa isoform has a more restricted cleavage pattern than the 66 kDa PC1 (18
). Taken together, these observations suggest that the 85 kDa form may only partially process those substrates which are usually fully processed by the mature PC1. The 85
66 kDa conversion is thus required for complete prohormone processing. Cpefat mice were thought to become obese because of a lack of direct CPE dibasic trimming and RSP sorting of neuropeptides (8
,19
). However, it has more recently come to light that Cpefat mice are impaired in the autocatalytic generation of mature 66 kDa PC1 (20
).
To investigate the involvement of PC1 on prohormone and neuropeptide processing in vivo, Zhu et al. (21
) created a Pc1 knockout mouse. In contrast to human PC1 deficiency, Pc1/ mice do not develop obesity, but are instead runted. This was attributed to a defect in pro-GHRH processing. Consistent with the human phenotype, Pc1/ mice also have defect in synthesizing mature insulin, rather proinsulin and des-64,65 proinsulin are the major forms (21
,22
), both circulating and pancreatic.
The inconsistency between PC1 deficiency causing obesity in humans and growth retardation in mice might represent (i) a contribution of genetic background to the defects in prohormone processing, (ii) a difference in prohormone processing between the species and (iii) a small but significant level of PC1 activity in humans with PC1 mutation. Consistent with this last possibility is the finding that Pc1 hemizygotes are not runted and become mildly obese (21
).
We report the identification of obese, hyperproinsulinemic mice. These mice have a mutation in the Pc1 gene, which co-segregates with the phenotype. Affected animals develop maturity-onset obesity and have lower lean mass than wild-type littermates. We observed a reduction in the level of fully mature (66 kDa) PC1 in neuroendocrine tissues from affected mice and reduced activity of recombinant mutant PC1. An anorexic neuropeptide
-MSH was partially reduced in the obese Pc1 mutant mice and may partly contribute to the obesity in these mice. Pc1 mutant mice had increased energy intake and improved ability to store energy as fat tissue. This mouse develops obesity consistent with the impaired PC1 activity in humans, unlike the knockout mouse. Furthermore, the distinct phenotypes of this allele and the null allele suggest that PC1 can operate with different efficiencies on different prohormones. Reduced PC1 activity (as in Pc1N222D/N222D) leads to apparently normal processing of proGHRH, but deficient processing of proinsulin and POMC, whereas ablation of PC1 activity (as in Pc1/) leads to deficient processing of all three prohormones.
| RESULTS |
|---|
|
|
|---|
Pc1 mutation causes an imbalance of fat and lean mass accumulation
In a forward-genetic screen using N-ethyl-N-nitrosourea (ENU) as the mutagen, we identified a hyperproinsulinemic, obese family of mice. Using a candidate gene approach, we identified a point mutation in the coding sequence of the prohormone convertase 1 gene (Fig. 1A). An adenine-to-guanine transition results in an amino acid change from asparagine (AAT) to aspartic acid (GAT) at codon 222. Over 400 progenies have been produced from the founder mouse and all those homozygous for the mutation (Pc1N222D/N222D) inherited the obese, hyperproinsulinemic phenotype. PC1 consists of three major domains (3
|
Pc1N222D/N222D mice fed a breeder diet (21% calories from fat cf. chow, 11% calories from fat) from the age of 8 weeks displayed elevated body weight compared with wild-type littermates (Fig. 1C) and remained markedly more obese for the length of the study. At 6 months of age, Pc1N222D/N222D males were on average 32% heavier than their wild-type littermates, and in females, this difference was more pronounced (68%). Heterozygous littermates exhibited an intermediate phenotype for both sexes; thus this mutation results in a semi-dominant phenotype.
Body composition analysis showed that the excess weight in mutant animals was entirely due to increased fat mass [Fig. 1D, breeder fat diet (BFD)]. This increase in fat mass was seen for males and females on all diets tested (Fig. 1D). Consistent with the weight curves, Pc1N222D/+ displayed an intermediate phenotype on chow diet and breeder diet. Interestingly, the phenotype segregated in a dominant manner in male mice fed with high fat diet (HFD); this was also confirmed in the 6-month weight curves of the same mice (data not shown). Thus, the mode of inheritance of obesity in these mice is dictated by the caloric make-up of the diet. Histological examination of inguinal adipose tissue (Fig. 1E) revealed a massive adipocyte hypertrophy, with a 10- to 100-fold increase in adipocyte volume when compared with adipocytes from a wild-type littermate. In accordance with the increased adiposity, plasma leptin levels were also elevated in 26-week-old Pc1N222D/N222D mice (females 94±17 ng/ml) when compared with wild-type controls (13±4 ng/ml), but not in pre-obese 8-week-old Pc1N222D/N222D mice (6.48±1.3 versus 7.1±1.0 ng/ml). Unexpectedly, muscle mass was reduced in Pc1N222D/N222D mice (Fig. 1F), despite their increased adiposity and weight. However, this was only observed in mice fed chow; in fact, Pc1N222D/N222D mice fed with BFD show increased muscularity.
Pc1N222D/N222D mice display improper insulin processing, yet are insulin sensitive despite obesity
Circulating levels of immunoreactive insulin were analyzed in the same mice described in Figure 1C at 26 weeks (Fig. 2A). Pc1N222D/N222D mice have fasting insulin-like immunoreactivity (i.r.) 7-fold higher than wild-type littermates. Again, heterozygous animals displayed an intermediate phenotype, although their serum insulin-like levels were much closer to wild-type levels when compared with the obesity in Pc1N222D/+ mice. The enzyme linked immunosorbent assay (ELISA) used to measure circulating insulin-like i.r. does not distinguish among insulin, proinsulin and processing intermediates. To address this, we analyzed the lysates from purified islets of Pc1N222D/N222D and wild-type mice, radiolabeled with [35S]methionine and cysteine in 2 or 20 mM glucose (Fig. 2B). In islets from Pc1N222D/N222D mice, we observed two unique bands. Using liquid chromatography (LC)-mass spectroscopy (MS)/MS, these bands were found to contain insulin chains A, B and C, whereas the band common to both wild-type and Pc1N222D/N222D islets contained chains A and B but lacked chain C. These extra bands are likely to be proinsulin and a processing intermediate. It is important to note that we did observe mature insulin in the islets from Pc1N222D/N222D mice, which was also confirmed by LC-MS/MS. Radiolabeled proteins demonstrated that, in islets from both mice, proinsulin is increased in response to high glucose stimulation, whereas only wild-type islets, and not Pc1N222D/N222D islets, have a concomitant increase in mature insulin. Taken together, these results indicate that a defect exists in insulin maturation but not in proinsulin production.
|
Despite obesity and hyperproinsulinemia in Pc1N222D/N222D mice, diabetes does not develop. Homozygous and heterozygous mutant mice maintain euglycemia at 26 weeks and throughout their lives up to 18 months (Fig. 2C) (data not shown). This was surprising given the severe defect in insulin secretion and presumed stress on the ß-cell, as a result of compensatory proinsulin production and secretion. Histological examination of pancreatic sections from wild-type and Pc1N222D/N222D mice demonstrated a marked islet hypertrophy (Fig. 2D). Immunohistochemical staining of the same islets showed that the increase in islet size was wholly attributable to ß-cell expansion, as seen by insulin and glucagon staining for ß and
-cells, respectively. Thus, Pc1N222D/N222D mice avoid diabetes by the compensatory increase in secretion of a less active form of insulin and ß-cell expansion. Pc1N222D/N222D mice are glucose intolerant, as revealed by an intraperitoneal injection of glucose (Fig. 2E); presumably, a consequence of impaired response of the ß-cell to release mature, fully active insulin. Unexpectedly, Pc1N222D/N222D mice, despite their obesity, exhibit normal insulin sensitivity (Fig. 2F). This was consistently observed in different groups of mice at a range of ages.
Effects of Pc1N222D/N222D on the hypothalamic-pituitary-adrenal axis and reproductive axis
Both earlier described cases of human PC1 deficiency were hypocortisolinemic, with one subject having near normal adrenocorticotrophic hormone (ACTH) levels (5
,23
). In contrast, the knockout mouse had normal corticosterone but no detectable, fully processed ACTH (21
). We therefore investigated the hypothalamic-pituitary-adrenal (HPA) axis in Pc1N222D/N222D mice. Surprisingly, plasma ACTH i.r. was slightly elevated in mutant mice when compared with wild-type littermates (Fig. 3A). However, plasma corticosterone was not significantly different between wild-type and mutant animals (Fig. 3B). The presence of mature ACTH in Pc1N222D/N222D mice is consistent with the human subject who had near normal levels of fully processed ACTH despite negligible PC1 activity and supports the notion that ACTH production is not absolutely dependent on PC1 (5
).
|
A reported case of a human adult with PC1 deficiency had dramatic hypogonadotropic hypogonadism with persistent amenorrhea (23
Pc1N222D/N222D mice are hyperphagic and metabolically more efficient
In other mouse models of obesity, the increased adipose mass has been attributed to the increased food intake and/or reduced energy expenditure and feed efficiency. Energy homeostasis was investigated in Pc1N222D/N222D mice (Fig. 4). We observed hyperphagia in Pc1N222D/N222D mice (Fig. 4A) during the onset of obesity in these animals (12 weeks old). Over the course of a week, mutant mice ate 3 g (13%) more than wild-type controls. Additionally, we detected greater caloric storage efficiency in the same mice, as seen by fat mass gained standardized to amount of food eaten (Fig. 4B). Home-cage activity tended to be lower in these Pc1N222D/N222D mice (Fig. 4C); however, this was not statistically significant. Finally, we analyzed fuel source preference, as respiratory exchange ratio (RER), and energy expenditure. We saw no difference in RER between Pc1N222D/N222D and wild-type mice (Fig. 4D). However, we did observe a lower metabolic rate (10%) for the Pc1N222D/N222D mice as seen by O2 consumption (Fig. 4E), although this did not reach statistical significance.
|
Autocatalytic and neuropeptide processing is impaired in Pc1N222D/N222D mice
To investigate the effect of the N222D mutation on the PC1 protein, lysates were made from mouse tissues and analyzed by western blotting. Both isoforms of PC1 were detected: the 85 kDa longer form and 66 kDa shorter form. As shown in Figure 5A, the pancreas has only the 66 kDa isoform, whereas in the brain (without hypothalamus) and hypothalamus, both isoforms are present. In Pc1N222D/N222D mice, PC1 protein is present but reduced. Specifically, the 66 kDa isoform is diminished, accompanied with a slight increase in the 85 kDa isoform. The production of 66 kDa PC1 is a consequence of intramolecular autocatalytic cleavage of the 85 kDa isoform at the dibasic ArgArg617618. These data demonstrate that this autocatalytic step is severely impaired in Pc1N222D/N222D mice, but nonetheless does occur to some degree, as revealed by the presence of the 66 kDa PC1 in the pancreas from mutant mice. To directly assess the enzymatic activity of the N222D mutation on PC1, we expressed both wild-type and mutated forms in vitro. PC1N222D is synthesized and secreted (into the media of the Sf9 cells) at similar levels to the wild-type protein. Multiple infections demonstrated consistently comparable expression levels between wild-type and mutant (Fig. 5B). Interestingly, there was a reduction in the relative amount of the 66 versus 85 kDa form, for the mutant PC1N222D compared with wild-type protein, providing additional support for a defect in PC1 autocatalytic activity as a result of N222D mutation. The intermediate band observed in the media from both infections was not present from media of Sf9 cells infected with baculovirus lacking an inserted gene. This
75 kDa band likely represents a processing intermediate of PC1 also seen in mammalian cells (16
45% of wild-type protein (Fig. 5C), consistent with a lower intrinsic activity of the 85 kDa form.
|
Pc1 mutation disrupts POMC processing
How could Pc1 mutation account for the obesity phenotype? To address this, we turned to the processing of prohormones produced in the hypothalamus, making POMC a candidate (25
-MSH.
-MSH production also requires the action of PC2 (26
-MSH binds the melanocortin receptors MC4R and MC3R to reduce feeding and regulate energy partitioning (27
-MSH and ultimately reduce anorexigenic signals and dysregulated energy partitioning. First, we investigated Pomc gene expression in the hypothalamus (Fig. 5D). Pc1N222D/N222D mice have normal Pomc expression; in fact, some extremely obese Pc1N222D/N222D mice have higher Pomc gene expression than wild-type controls. This observation of normal Pomc expression is in contrast to ob/ob and db/db mice (29
-MSH (and does not cross-react with the precursor POMC) in hypothalamic extracts, we observed a 45% reduction in Pc1N222D/N222D mice (Fig. 5E). This result suggests that Pc1N222D/N222D mice become obese, at least in part, as a consequence of reduced
-MSH signaling. | DISCUSSION |
|---|
|
|
|---|
Unlike mice lacking Pc1 (21
The melanocortin system is crucial for the proper balance of energy intake, energy expenditure and caloric partitioning (27
). Central components are POMC, and its cleavage product,
-MSH, a potent modulator of satiety and energy regulation. These effects are brought about by
-MSH activating MC3R and MC4R neurons. Genetic deficiency of Pomc or Mc4r results in obesity that is accompanied by profound hyperphagia, and in the case of MC4R, it results in reduced energy expenditure (28
,30
,31
). MC3R null mice exhibit increased adiposity and reduced muscle mass, which are not associated with hyperphagia (32
,33
). Instead, these mice have an improved ability to store calories in adipose tissue. Pc1N222D/N222D mice have lower hypothalamic
-MSH and accordingly affect melanocortin signaling through both MC4R and MC3R. Similar to Pomc and Mc4r null mice, Pc1N222D/N222D mice eat 3 g more weekly than wild-type controls, a more subtle hyperphagia than observed in mice with comparable adiposity to Pc1N222D/N222D animals (Pomc/ eat 6 g more than controls per week). Although not statistically significant, Pc1N222D/N222D mice also had a trend toward reduced energy expenditure. Pc1N222D/N222D mice gain more fat mass per calorie consumed than wild-types, similar to the increased feed efficiency seen in Mc3r/ mice (33
). Indeed, Pc1N222D/N222D mice also have a reduction in muscle mass, a characteristic of the Mc3r/ mice.
PC1 has numerous substrates that regulate energy homeostasis in the hypothalamus, and the defective POMC processing observed in Pc1N222D/N222D mice, although a major player, is unlikely to be the sole contributor to the physiological abnormalities observed. Recently, it has been shown that similar obesity occurs in mice lacking the neuronal transcription factor NHLH2 (34
), which has been attributed to a lower expression of Pc1 and Pc2, and a 50% decrease in the number of
-MSH positive neurons in the rostral part of the hypothalamus (35
).
The hyperproinsulinemia in these mice is consistent with a defect in Pc1. The additional proinsulin bands observed in islet lysates strongly suggest a defect in insulin maturation, although proinsulin synthesis is normal. The extra protein bands in islets from Pc1N222D/N222D mice, which contain all proinsulin chains A, B and C, may represent unprocessed proinsulin and/or partially processed des-64,65 proinsulin, which is observed in Pc1 null mice and humans with mutation in PC1. A somewhat unexpected finding in Pc1N222D/N222D mice is that they do not develop overt diabetes (although they are glucose intolerant). The ß-cell hyperplasia seen in these mice is apparently sufficient to protect the animals from the deleterious effects of continual proinsulin/insulin production necessary to maintain euglycemia. More surprisingly, Pc1N222D/N222D mice remain sensitive to exogenous insulin, despite profound obesity, a phenomenon also seen in Cpefat mice (36
,37
), yet not in other murine models of obesity (Mc4r/, ob/ob, db/db or Ay) (31
,36
,38
). Along these lines, humans with mutations in either PC1 (23
) or MC3R (39
) also display this unusual combination of obesity without insulin resistance. The finding of insulin sensitivity and changes in ß-cell mass are likely to prevent diabetes in Pc1N222D/N222D mice.
In addition to the overt phenotypes mentioned earlier, we also detected other endocrinological effects as a result of Pc1 dysfunction. As with human PC1 deficiency, the Pc1N222D/N222D mice also demonstrate that this convertase has a role in the physiological control of reproduction in both sexes, as seen by the hypogonadism. Furthermore, from these studies, it is evident that the hypothalamic-adrenal circuitry is intact in the presence of diminished Pc1 activity in mice. Indeed, even Pc1 knockout mice are able to maintain normal levels of circulating corticosterone (21
). These findings contrast to human PC1 deficiency, where it is clear that PC1 is necessary to preserve normal cortisol levels, despite normal ACTH production. Together, it appears that PC1 has different effects on the HPA axis between these two species.
The defect in autocatalytic cleavage of PC1, which causes a reduction in the 66 kDa form but not in the 85 kDa form, may provide a clue to explain the difference in prohormone processing. This processing defect may simply reflect the fact that reduced PC1 activity impairs all cleavage targets, including PC1 itself. Alternatively, the mutation may primarily disrupt the intramolecular processing, reducing the 66 kDa species, which, in turn, leads to the defective prohormone processing. Indeed, the reduced activity of recombinant PC1N222D correlates with a lower 66:85 kDa ratio shown by western blot (Fig. 4B and C). In support of this hypothesis, Berman et al. (20
) found that PC1 activity is impaired in Cpefat/fat mice. The authors show that in obese mice, the autocatalytic cleavage of PC1 is retarded and this could contribute to the phenotype in these animals. The 85 kDa form is less active than the fully processed 66 kDa isoform (16
,17
), and this overall reduction in activity is sufficient to cause obesity. It has also been demonstrated that these two isoforms have slight differences in substrate specificity, as shown in vitro with provasopressin (18
). It is thus tempting to speculate that the 85 kDa isoform is capable of GHRH processing, yet the 66 kDa form is required for the proper processing of proinsulin and POMC.
In summary, Pc1N222D/N222D mice are obese and mimic humans with mutations in PC1. The defect in autocatalytic activation may account for the phenotypes observed in these mice and possibly contribute to the phenotype of Cpefat mice. The obesity, in part, is a result of defective POMC processing and perturbation to the melanocortin pathway through a disruption to both MC4R and MC3R signaling. This mutation will be a valuable resource in understanding the role of prohormone processing in energy homeostasis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Generation, housing and diet of mice
ENU-mutagenized C57BL/6 mice were generated as described (40
Phenotyping of mice
Plasma was obtained from retro-orbitally bled mice (46 h fasted). An aliquot was used for glucose analysis on a clinical blood chemistry analyzer (AU400e, Olympus). A duplicate sample was used for insulin and leptin determination using ELISAs (Crystalchem). Plasma was also used to measure the circulating levels of ACTH (ALPCO Diagnostics, catalog no. 21-SDX018), corticosterone (MP Biomedicals, catalog no. 07-120102) and testosterone (IBL, reference no. RE52151). Glucose tolerance tests were performed in fasted mice by i.p. injection of glucose (1.5 g/kg body weight). Blood glucose was monitored using a OneTouch Ultra glucometer (LifeScan), with blood samples from a tail nick. Insulin tolerance tests were performed similarly using 1 U/kg insulin (Novolin). Body composition analysis to determine fat and muscle contents was performed on conscious mice, using the EchoMRI-100 whole body composition analyzer (EchoMRI). Testes weights were measured following dissection. Appetite was measured in singly housed mice in their home cages by daily weighing of food consumed over 7 days. RER and VO2 were measured in singly housed mice using the Comprehensive Lab Animal Monitoring System (Columbus Instruments). Mice were placed in the chambers for 8 h; data acquired from the last 6 h were used for the analysis. Average volume of oxygen consumed (VO2; ml/kg/h) and carbon dioxide exhaled (VCO2; ml/kg/h) were calculated over the 6 h period. RER was calculated by averaging the ratio VCO2:VO2. Activity was assessed by the total number of beam breaks per hour, over 3 whole days, with 1 day acclimation to the environment.
Genotyping
All exons of Pc1 were amplified by polymerase chain reaction (PCR) and sequenced for mutation detection (primer sequences available upon request). Specifically, exon 6 was amplified using the primers 5'-TCCATTGGAAGAACACACAGA-3' and 5'-TCTTCTAAAGCAGAGCACAGAGAA-3' and the resulting product digested with BclI. DNA from wild-type mice yielded a PCR product of 481 bp, this is cleaved into two bands of 327 and 154 bp from DNA of mutant mice.
Histology and immunohistochemistry
Fat tissue and pancreas were dissected from mice and fixed in 10% phosphate-buffered formalin for 24 h. Tissues were embedded in paraffin and 5 µm sections were prepared and stained with hematoxylin and eosin (H&E). Pancreatic sections were further used for immunostaining. Following antigen retrieval using 10 mM sodium citrate pH 8 for 10 min at 98°C, sections were probed for either insulin or glucagon. To detect insulin, sections were blocked in 5% chicken serum, incubated with a rabbit anti-insulin antibody (1:100; sc-9168; Santa Cruz Biotech.). Following phosphate-buffered saline (PBS) washes, the primary antibody was detected with an AlexaFluor 594-conjugated chicken anti-rabbit antibody (1:200; Molecular Probes Inc.). Adjacent sections were used for the detection of glucagon and were incubated in 5% donkey serum and then in goat anti-glucagon antibody (1:100; sc-97780; Santa Cruz Biotech.). Slides were washed with PBS and incubated with AlexaFluor 488-conjugated donkey anti-goat antibody (1:200; Molecular Probes). The sections were stained with 4',6-diamidino-2-phenylindole (DAPI) and mounted in Vectashield (Vector Labs).
Immunoblotting
Tissues were dissected and homogenized in extraction buffer (20 mM TrisHCl pH 7.4, 10 mM KCl, 10 mM NaCl, 3 mM MgCl2 and 0.5% NP-40) containing protease inhibitors (P8340, Sigma-Aldrich). The supernatant was clarified several times and the protein concentration was determined by the Bradford assay. Protein lysates (60 µg) were resolved on a 420% sodium dodecyl sulfatepolyacrylamide gel and transferred to a nitrocellulose membrane. Membranes were blocked in 5% non-fat milk in Tris-buffered saline, 0.05% Tween-20 (TBST), followed by an overnight incubation (at 4°C) with PC1 polyclonal antibody (PA1-057; Affinity BioReagents). Membranes were washed in TBST, then incubated with horseradish peroxidase-conjugated goat anti-rabbit antibody. Membranes were washed further in TBST and bands were visualized using enhanced chemiluminescence reagent (Amersham Biosciences).
Pancreatic islet purification and metabolic labeling
Pancreatic islets were isolated from 26-week-old mice using a method described by Salvalaggio et al. (42
). After clamping the common bile duct as it joins the intestine, the pancreas was inflated with 2.5 ml of liberase (0.33 mg/ml; Roche) diluted in Hanks balanced salt solution (HBSS; Sigma-Aldrich). The distended pancreas was removed and incubated at 37°C for 30 min. Enzymatic digestion was stopped by the addition of 40 ml of cold HBSS containing 10% FBS and by vigorously hand-shaking the suspension. Three rounds of centrifugation (180g for 2 min) and washes with fresh HBSS/FBS were carried out. The resulting slurry was poured through a 400 µm wire mesh and onto a 100 µm cell strainer (BD Biosciences). After washing the cell strainer with 50 ml of HBSS/FBS, the strainer was inverted and the pancreatic material was rinsed into a Petri dish with fresh HBSS/FBS. Islets were viewed under a dissecting microscope and hand-picked away from any exocrine tissue. Islets were cultured overnight in RPMI-1640 media (Sigma-Aldrich) supplemented with 10% FBS (Sigma-Aldrich), 100 U/ml of penicillin and 100 µg/ml of streptomycin at 37°C in 5% CO2. Islets were subsequently picked into groups of 50 and pre-incubated in 500 µl KrebsRinger bicarbonate (KRB) buffer containing 2 mM glucose for 1 h at 37°C, which was replaced with 200 µl of KRB with either 2 or 20 mM glucose and 50 µCi of [35S]methionine/cysteine (AGQ0080, GE Healthcare) and incubated for further 1 h. Finally, islets were washed three times in PBS and lysed in 25 µl of RIPA buffer on ice for 15 min, and following clarification, the lysates were heated in 25 µl of non-reducing sample buffer. Samples were separated on a 1020% tricine gel, dried and bands viewed by autoradiography.
LC-MS/MS analyses
Automated nanoscale LC-MS/MS was performed on the extracts of in-gel tryptically digested bands using a ThermoFinnigan Surveyor HPLC and LCQ XP+ ion trap mass spectrometer along with a variation of the vented column approach described by Licklider et al. (43
).
Quantitative PCR
Quantitative PCR reactions were performed using SuperScriptTM III Platinum® One-Step qRTPCR Kit (Invitrogen) and ABI PRISM® 7900HT Sequence Detection System (Applied Biosystem), according to manufacturers' protocol. The qPCR reagents for expression analysis of mouse Pomc, Pcsk1 and Pcsk2 were obtained as commericially available Taqman® Gene Expression Assays, Mm00435874_m1, Mm00479023_m1 and Mm00500981_m1, respectively. Expression values were normalized to a housekeeping gene 36B4, which was analyzed using the oligonucleotides 5'-AGATGCAGCAGATCCGCAT-3' and 5'-GTTCTTGCCCATCAGCACC-3' and the probe 5'-CGCTCCGAGGGAAGGCCG-3'.
Peptide extracts and RIA
Hypothalamii were dissected from mice, homogenized and heated (95°C for 10 min) in 0.1 M acetic acid. Following two clarifications of the supernatant (15 min each), the peptide extract was lyophilized and resuspended in PBS. An aliquot was used to determine the protein concentration using the Bradford assay. The remaining sample was used to detect
-MSH by RIA (ALPCO).
Construction, expression and activity of recombinant PC1
Human PC1 cDNA (amino acids 28753) was amplified from clone FB2803_H12 (Origene 20 k TrueClone collection, Origene) and His-tagged using the oligonucleotides 5'-AGTCACGCGTCGCCTGAACCGCATCACCATCACCATCACAAAAGGCAATT TGTCAATGAATGGG-3' and 5'-AGTCGCGGCCGCTTAATTTTCCTCATTCAGAATGTCC-3' and cloned into the MluI and NotI sites of a modified pFASTBAC1 expression vector. The N222D mutation was introduced by site-directed mutagenesis (Stratagene), using the sense oligonucleotide 5'-GCCATGCAAGCAAATGATCACAAATGCGGGG T-3' and antisense oligonucleotide 5'-ACCCCGCATTTGTGATCATTTGCTTGCATG GC-3'. Using these constructs, baculovirus was generated and used to transfect Sf9 cells. Media were collected from infected cells for western blot and also enzymatic assay using a fluorogenic substrate. Assays were performed using 10 µl of media, in 100 µl of 100 mM sodium acetate buffer, pH 6, with 10 mM CaCl2, in the presence of PyrArgThrLysArgMCA substrate (MPR-3159-v, Peptides International). Reactions were incubated at 37°C, and the amount of aminomethylcoumaride was monitored by excitation at 380 nm and emission at 460 nm.
| ACKNOWLEDGEMENTS |
|---|
We thank Deborah Jensen for all genotyping, Lacey Kischassey for breeding and care of mice, Karina Ayala and Gus Welzel for phenotyping the study mice, Dr Tim Wiltshire for analysis of testes, Joe Quinto for qPCR, Dr Eric Peters for LC-MS/MS analyses and James Watson for sectioning tissue. Finally, we thank Dr Enrique Saez for helpful discussions.
Conflict of Interest statement. None declared.
| FOOTNOTES |
|---|
Present address: Amgen, One Amgen Center Dr, Thousand Oaks, CA 91320, USA. | REFERENCES |
|---|
|
|
|---|
- Barsh, G.S., Farooqi, I.S. and O'Rahilly, S. (2000) Genetics of body-weight regulation. Nature, 404, 644651.[Medline]
- Beinfeld, M.C. (1998) Prohormone and proneuropeptide processing. Recent progress and future challenges. Endocrine, 8, 15.[CrossRef][Web of Science][Medline]
- Steiner, D.F. (1998) The proprotein convertases. Curr. Opin. Chem. Biol., 2, 3139.[CrossRef][Web of Science][Medline]
- Jackson, R.S., Creemers, J.W., Ohagi, S., Raffin-Sanson, M.L., Sanders, L., Montague, C.T., Hutton, J.C. and O'Rahilly, S. (1997) Obesity and impaired prohormone processing associated with mutations in the human prohormone convertase 1 gene. Nat. Genet., 16, 303306.[CrossRef][Web of Science][Medline]
- Jackson, R.S., Creemers, J.W., Farooqi, I.S., Raffin-Sanson, M.L., Varro, A., Dockray, G.J., Holst, J.J., Brubaker, P.L., Corvol, P., Polonsky, K.S. et al. (2003) Small-intestinal dysfunction accompanies the complex endocrinopathy of human proprotein convertase 1 deficiency. J. Clin. Invest., 112, 15501560.[CrossRef][Web of Science][Medline]
- Naggert, J.K., Fricker, L.D., Varlamov, O., Nishina, P.M., Rouille, Y., Steiner, D.F., Carroll, R.J., Paigen, B.J. and Leiter, E.H. (1995) Hyperproinsulinaemia in obese fat/fat mice associated with a carboxypeptidase E mutation which reduces enzyme activity. Nat. Genet., 10, 135142.[Web of Science][Medline]
-
Cawley, N.X., Zhou, J., Hill, J.M., Abebe, D., Romboz, S., Yanik, T., Rodriguiz, R.M., Wetsel, W.C. and Loh, Y.P. (2004) The carboxypeptidase E knockout mouse exhibits endocrinological and behavioral deficits. Endocrinology, 145, 58075819.
[Abstract/Free Full Text] - Cool, D.R., Normant, E., Shen, F., Chen, H.C., Pannell, L., Zhang, Y. and Loh, Y.P. (1997) Carboxypeptidase E is a regulated secretory pathway sorting receptor: genetic obliteration leads to endocrine disorders in Cpe(fat) mice. Cell, 88, 7383.[CrossRef][Web of Science][Medline]
- Fricker, L.D. (1988) Carboxypeptidase E. Annu. Rev. Physiol., 50, 309321.[CrossRef][Web of Science][Medline]
- Bailyes, E.M., Bennett, D.L. and Hutton, J.C. (1991) Proprotein-processing endopeptidases of the insulin secretory granule. Enzyme, 45, 301313.[Web of Science][Medline]
-
Dhanvantari, S., Seidah, N.G. and Brubaker, P.L. (1996) Role of prohormone convertases in the tissue-specific processing of proglucagon. Mol. Endocrinol., 10, 342355.
[Abstract/Free Full Text] -
Zhou, A. and Mains, R.E. (1994) Endoproteolytic processing of proopiomelanocortin and prohormone convertases 1 and 2 in neuroendocrine cells overexpressing prohormone convertases 1 or 2. J. Biol. Chem., 269, 1744017447.
[Abstract/Free Full Text] -
Jutras, I., Seidah, N.G., Reudelhuber, T.L. and Brechler, V. (1997) Two activation states of the prohormone convertase PC1 in the secretory pathway. J. Biol. Chem., 272, 1518415188.
[Abstract/Free Full Text] - Benjannet, S., Rondeau, N., Paquet, L., Boudreault, A., Lazure, C., Chretien, M. and Seidah, N.G. (1993) Comparative biosynthesis, covalent post-translational modifications and efficiency of prosegment cleavage of the prohormone convertases PC1 and PC2: glycosylation, sulphation and identification of the intracellular site of prosegment cleavage of PC1 and PC2. Biochem. J., 294, 735743.
- Coates, L.C. and Birch, N.P. (1997) Posttranslational maturation of the prohormone convertase SPC3 in vitro. J. Neurochem., 68, 828836.[Web of Science][Medline]
-
Zhou, Y. and Lindberg, I. (1994) Enzymatic properties of carboxyl-terminally truncated prohormone convertase 1 (PC1/SPC3) and evidence for autocatalytic conversion. J. Biol. Chem., 269, 1840818413.
[Abstract/Free Full Text] -
Zhou, Y., Rovere, C., Kitabgi, P. and Lindberg, I. (1995) Mutational analysis of PC1 (SPC3) in PC12 cells. 66-kDa PC1 is fully functional. J. Biol. Chem., 270, 2470224706.
[Abstract/Free Full Text] - Coates, L.C. and Birch, N.P. (1998) Differential cleavage of provasopressin by the major molecular forms of SPC3. J. Neurochem., 70, 16701678.[Web of Science][Medline]
-
Fricker, L.D., Berman, Y.L., Leiter, E.H. and Devi, L.A. (1996) Carboxypeptidase E activity is deficient in mice with the fat mutation. Effect on peptide processing. J. Biol. Chem., 271, 3061930624.
[Abstract/Free Full Text] -
Berman, Y., Mzhavia, N., Polonskaia, A. and Devi, L.A. (2001) Impaired prohormone convertases in Cpe(fat)/Cpe(fat) mice. J. Biol. Chem., 276, 14661473.
[Abstract/Free Full Text] -
Zhu, X., Zhou, A., Dey, A., Norrbom, C., Carroll, R., Zhang, C., Laurent, V., Lindberg, I., Ugleholdt, R., Holst, J.J. et al. (2002) Disruption of PC1/3 expression in mice causes dwarfism and multiple neuroendocrine peptide processing defects. Proc. Natl Acad. Sci. USA, 99, 1029310298.
[Abstract/Free Full Text] -
Zhu, X., Orci, L., Carroll, R., Norrbom, C., Ravazzola, M. and Steiner, D.F. (2002) Severe block in processing of proinsulin to insulin accompanied by elevation of des-64,65 proinsulin intermediates in islets of mice lacking prohormone convertase 1/3. Proc. Natl Acad. Sci. USA, 99, 1029910304.
[Abstract/Free Full Text] -
O'Rahilly, S., Gray, H., Humphreys, P.J., Krook, A., Polonsky, K.S., White, A., Gibson, S., Taylor, K. and Carr, C. (1995) Brief report: impaired processing of prohormones associated with abnormalities of glucose homeostasis and adrenal function. N. Engl. J. Med., 333, 13861390.
[Free Full Text] - Hill, R.M., Ledgerwood, E.C., Brennan, S.O., Pu, L.P., Loh, Y.P., Christie, D.L. and Birch, N.P. (1995) Comparison of the molecular forms of the Kex2/subtilisin-like serine proteases SPC2, SPC3, and furin in neuroendocrine secretory vesicles reveals differences in carboxyl-terminus truncation and membrane association. J. Neurochem., 65, 23182326.[Web of Science][Medline]
- Pritchard, L.E., Turnbull, A.V. and White, A. (2002) Pro-opiomelanocortin processing in the hypothalamus: impact on melanocortin signalling and obesity. J. Endocrinol., 172, 411421.[Abstract]
-
Zhou, A., Bloomquist, B.T. and Mains, R.E. (1993) The prohormone convertases PC1 and PC2 mediate distinct endoproteolytic cleavages in a strict temporal order during proopiomelanocortin biosynthetic processing. J. Biol. Chem., 268, 17631769.
[Abstract/Free Full Text] -
Ellacott, K.L. and Cone, R.D. (2004) The central melanocortin system and the integration of short- and long-term regulators of energy homeostasis. Recent Prog. Horm. Res., 59, 395408.
[Abstract/Free Full Text] - Yaswen, L., Diehl, N., Brennan, M.B. and Hochgeschwender, U. (1999) Obesity in the mouse model of pro-opiomelanocortin deficiency responds to peripheral melanocortin. Nat. Med., 5, 10661070.[CrossRef][Web of Science][Medline]
- Bates, S.H., Stearns, W.H., Dundon, T.A., Schubert, M., Tso, A.W., Wang, Y., Banks, A.S., Lavery, H.J., Haq, A.K., Maratos-Flier, E. et al. (2003) STAT3 signalling is required for leptin regulation of energy balance but not reproduction. Nature, 421, 856859.[CrossRef][Medline]
- Balthasar, N., Dalgaard, L.T., Lee, C.E., Yu, J., Funahashi, H., Williams, T., Ferreira, M., Tang, V., McGovern, R.A., Kenny, C.D. et al. (2005) Divergence of melanocortin pathways in the control of food intake and energy expenditure. Cell, 123, 493505.[CrossRef][Web of Science][Medline]
- Huszar, D., Lynch, C.A., Fairchild-Huntress, V., Dunmore, J.H., Fang, Q., Berkemeier, L.R., Gu, W., Kesterson, R.A., Boston, B.A., Cone, R.D. et al. (1997) Targeted disruption of the melanocortin-4 receptor results in obesity in mice. Cell, 88, 131141.[CrossRef][Web of Science][Medline]
-
Butler, A.A., Kesterson, R.A., Khong, K., Cullen, M.J., Pelleymounter, M.A., Dekoning, J., Baetscher, M. and Cone, R.D. (2000) A unique metabolic syndrome causes obesity in the melanocortin-3 receptor-deficient mouse. Endocrinology, 141, 35183521.
[Abstract/Free Full Text] - Chen, A.S., Marsh, D.J., Trumbauer, M.E., Frazier, E.G., Guan, X.M., Yu, H., Rosenblum, C.I., Vongs, A., Feng, Y., Cao, L. et al. (2000) Inactivation of the mouse melanocortin-3 receptor results in increased fat mass and reduced lean body mass. Nat. Genet., 26, 97102.[CrossRef][Web of Science][Medline]
- Good, D.J., Porter, F.D., Mahon, K.A., Parlow, A.F., Westphal, H. and Kirsch, I.R. (1997) Hypogonadism and obesity in mice with a targeted deletion of the Nhlh2 gene. Nat. Genet., 15, 397401.[CrossRef][Web of Science][Medline]
-
Jing, E., Nillni, E.A., Sanchez, V.C., Stuart, R.C. and Good, D.J. (2004) Deletion of the Nhlh2 transcription factor decreases the levels of the anorexigenic peptides alpha melanocyte-stimulating hormone and thyrotropin-releasing hormone and implicates prohormone convertases I and II in obesity. Endocrinology, 145, 15031513.
[Abstract/Free Full Text] - Leiter, E.H., Chapman, H.D. and Falany, C.N. (1991) Synergism of obesity genes with hepatic steroid sulfotransferases to mediate diabetes in mice. Diabetes, 40, 13601363.[Abstract]
-
Coleman, D.L. and Eicher, E.M. (1990) Fat (fat) and tubby (tub): two autosomal recessive mutations causing obesity syndromes in the mouse. J. Hered., 81, 424427.
[Abstract/Free Full Text] -
Michaud, E.J., Bultman, S.J., Klebig, M.L., van Vugt, M.J., Stubbs, L.J., Russell, L.B. and Woychik, R.P. (1994) A molecular model for the genetic and phenotypic characteristics of the mouse lethal yellow (Ay) mutation. Proc. Natl Acad. Sci. USA, 91, 25622566.
[Abstract/Free Full Text] -
Lee, Y.S., Poh, L.K. and Loke, K.Y. (2002) A novel melanocortin 3 receptor gene (MC3R) mutation associated with severe obesity. J. Clin. Endocrinol. Metab., 87, 14231426.
[Abstract/Free Full Text] - Lloyd, D.J., Hall, F.W., Tarantino, L.M. and Gekakis, N. (2005) Diabetes insipidus in mice with a mutation in aquaporin-2. PLoS Genet., 1, e20.
-
Wen, B.G., Pletcher, M.T., Warashina, M., Choe, S.H., Ziaee, N., Wiltshire, T., Sauer, K. and Cooke, M.P. (2004) Inositol (1,4,5) trisphosphate 3 kinase B controls positive selection of T cells and modulates Erk activity. Proc. Natl Acad. Sci. USA, 101, 56045609.
[Abstract/Free Full Text] - Salvalaggio, P.R., Deng, S., Ariyan, C.E., Millet, I., Zawalich, W.S., Basadonna, G.P. and Rothstein, D.M. (2002) Islet filtration: a simple and rapid new purification procedure that avoids ficoll and improves islet mass and function. Transplantation, 74, 877879.[CrossRef][Web of Science][Medline]
-
Licklider, L.J., Thoreen, C.C., Peng, J. and Gygi, S.P. (2002) Automation of nanoscale microcapillary liquid chromatography-tandem mass spectrometry with a vented column. Anal. Chem., 74, 30763083.[Medline]
This article has been cited by other articles:
![]() |
T. O. Kilpelainen, S. A. Bingham, K.-T. Khaw, N. J. Wareham, and R. J.F. Loos Association of variants in the PCSK1 gene with obesity in the EPIC-Norfolk study Hum. Mol. Genet., September 15, 2009; 18(18): 3496 - 3501. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Wilkes, D. J. Lloyd, and N. Gekakis Loss-of-Function Mutation in Myostatin Reduces Tumor Necrosis Factor {alpha} Production and Protects Liver Against Obesity-Induced Insulin Resistance Diabetes, May 1, 2009; 58(5): 1133 - 1143. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. M. Creemers, Y. S. Lee, R. L. Oliver, M. Bahceci, A. Tuzcu, D. Gokalp, J. Keogh, S. Herber, A. White, S. O'Rahilly, et al. Mutations in the Amino-Terminal Region of Proopiomelanocortin (POMC) in Patients with Early-Onset Obesity Impair POMC Sorting to the Regulated Secretory Pathway J. Clin. Endocrinol. Metab., November 1, 2008; 93(11): 4494 - 4499. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Fox and D. J. Good Nescient Helix-Loop-Helix 2 Interacts with Signal Transducer and Activator of Transcription 3 to Regulate Transcription of Prohormone Convertase 1/3 Mol. Endocrinol., June 1, 2008; 22(6): 1438 - 1448. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Aigner, B. Rathkolb, N. Herbach, M. H. de Angelis, R. Wanke, and E. Wolf Diabetes models by screen for hyperglycemia in phenotype-driven ENU mouse mutagenesis projects Am J Physiol Endocrinol Metab, February 1, 2008; 294(2): E232 - E240. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chiu, K. Kim, K. A. Haus, G. M. Espinal, L. V. Millon, and C. H. Warden Identification of positional candidate genes for body weight and adiposity in subcongenic mice Physiol Genomics, September 11, 2007; 31(1): 75 - 85. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. S. Farooqi, K. Volders, R. Stanhope, R. Heuschkel, A. White, E. Lank, J. Keogh, S. O'Rahilly, and J. W. M. Creemers Hyperphagia and Early-Onset Obesity due to a Novel Homozygous Missense Mutation in Prohormone Convertase 1/3 J. Clin. Endocrinol. Metab., September 1, 2007; 92(9): 3369 - 3373. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. E. Pritchard and A. White Neuropeptide Processing and Its Impact on Melanocortin Pathways Endocrinology, September 1, 2007; 148(9): 4201 - 4207. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Nillni Regulation of Prohormone Convertases in Hypothalamic Neurons: Implications for ProThyrotropin-Releasing Hormone and Proopiomelanocortin Endocrinology, September 1, 2007; 148(9): 4191 - 4200. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. S. Farooqi and S. O'Rahilly Genetics of Obesity in Humans Endocr. Rev., December 1, 2006; 27(7): 710 - 718. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Foster-Schubert and D. E. Cummings Emerging Therapeutic Strategies for Obesity Endocr. Rev., December 1, 2006; 27(7): 779 - 793. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. C. L. Tung, S. J. Piper, D. Yeung, S. O'Rahilly, and A. P. Coll A Comparative Study of the Central Effects of Specific Proopiomelancortin (POMC)-Derived Melanocortin Peptides on Food Intake and Body Weight in Pomc Null Mice Endocrinology, December 1, 2006; 147(12): 5940 - 5947. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












