Skip Navigation


Human Molecular Genetics Advance Access originally published online on May 12, 2006
Human Molecular Genetics 2006 15(13):2038-2044; doi:10.1093/hmg/ddl128
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
15/13/2038    most recent
ddl128v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Xinarianos, G.
Right arrow Articles by Liloglou, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xinarianos, G.
Right arrow Articles by Liloglou, T.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Frequent genetic and epigenetic abnormalities contribute to the deregulation of cytoglobin in non-small cell lung cancer

George Xinarianos1,{dagger}, Fiona E. McRonald2,{dagger}, Janet M. Risk2, Naomi L. Bowers1, Georgios Nikolaidis1, John K. Field1,2 and Triantafillos Liloglou1,*

1 University of Liverpool Cancer Research Centre, Roy Castle Lung Cancer Research Programme, 200 London Road, Liverpool L3 9TA, UK and 2 Molecular Genetics and Oncology Group, School of Dental Sciences, University of Liverpool, Liverpool L69 3BX, UK

* To whom correspondence should be addressed. Tel: +44 1517948920; fax: +44 1517948989; Email: liloglout{at}roycastle.liv.ac.uk

Received March 9, 2006; Revised May 3, 2006; Accepted May 10, 2006


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Lung cancer demonstrates the highest mortality in the UK. Previous studies have implicated allelic loss at chromosome 17q in the development of non-small cell lung carcinoma (NSCLC), and a number of known and putative tumour-suppressor genes reside within this region. One candidate tumour-suppressor gene is cytoglobin (CYGB), which is contained entirely within the 42.5 kb tylosis with oesophageal cancer (TOC) minimal region. CYGB abnormalities have been demonstrated only in sporadic head and neck cancers. In this study, we investigated the expression, promoter methylation and allelic imbalance status of this gene in 52 paired (normal/tumour) surgically excised lung tissue samples from patients with NSCLC. CYGB expression in tumour tissue was significantly reduced compared with corresponding adjacent normal in 54% of the examined cases (paired t-test, P<0.001). The CYGB promoter was shown by pyrosequencing to be significantly hypermethylated [2-fold increase of methylation index (MtI) in tumours] in 25/52 (48%) tumour samples compared with normal samples. MtI of the CYGB promoter was associated with CYGB mRNA expression (linear regression analysis, P=0.009), suggesting a primary role for the epigenetic events in CYGB silencing. In addition, frequent LOH was detected at the locus 17q25 in 32/48 (67%) tumours examined. It is of note that the loss of expression intensified when both LOH and hypermethylation coincided in samples (Mann–Whitney, P=0.049). These findings provide the first evidence to suggest the implication of CYGB in the pathogenesis of NSCLCs.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Lung cancer is the second most common malignant neoplasm in the UK following breast and presents the second worst 5-year survival figures following pancreas (1). Thus, although it accounts for 14% of all cancer diagnoses, lung cancer is responsible for 22% of cancer deaths, indicating the poor prognosis of this tumour type and the comparative lack of progress in treatment. Therapy is hampered by the tendency for lung cancer to be diagnosed at a late stage, hence the need to develop markers for early detection. Approximately 80% of lung cancer cases are of the non-small cell type (NSCLC), with squamous cell carcinoma and adenocarcinoma being the most frequent subtypes.

Chromosome 17q is among the chromosomal regions strongly implicated in the molecular pathogenesis of NSCLC and has been shown in several studies to demonstrate allelic imbalance (AI—LOH) in lung tumours (2–4). There are several tumour-suppressor genes on chromosome 17q, any of which could be affected by these imbalances, for example, BRCA1 (5), septin (6) and DMC1 (7).

A further candidate tumour-suppressor gene on chromosome 17q is cytoglobin (CYGB), which maps to the 42.5 kb tylosis with oesophageal cancer (TOC) minimal region and is the only gene that is completely contained within the TOC region. As yet, CYGB status in human sporadic tumours is not well known. It has been recently shown that CYGB lies within the minimal region of deletion identified for ovarian tumours and it is downregulated in ovarian cancer cell lines, although it is expressed in normal ovarian cell lines (8). A lack of coding mutations has been shown in affected TOC patients (9) and in sporadic squamous cell oesophageal carcinomas of Iranian origin (10). To date, the epigenetic status of this gene has not been studied in either familial or sporadic oesophageal cancer. However, a recent study has implicated CYGB promoter methylation in oral squamous cell carcinomas (11).

It is now well established that one mechanism contributing to tumour-suppressor gene inactivation involves the abnormal methylation of their promoters (12,13). Although a global hypomethylation characterizes the greater length of the DNA stretch (14), the majority of CpG islands become hypermethylated, causing transcriptional repression of their associated genes (15), and this has particular interest in tumour diagnostics and therapy (16,17).

In this study, we examined the expression and methylation status of the CYGB gene in NSCLCs in view of previous data implicating chromosome 17q in the development of both lung and oesophageal cancers as well as the suggested common upper aerodigestive tract carcinogenesis model (18).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Expression analysis of CYGB
CYGB expression was investigated in 48 N/T pairs (23 Adeno, 25 SqCCL), as RNA was not successfully recovered in adequate quantities from four samples. CYGB mRNA levels were expressed as the ratio CYGB/TBP (Fig. 1). Overall, CYGB mRNA expression was lower in the tumour tissue (CYGB/TBP=0.76±0.1) in comparison with the adjacent normal tissue (1.85±0.22, paired t-test, P<0.001) (Fig. 2). Reduced (≥50% reduction to the corresponding normal tissue) expression was observed in 26/48 (54.2%) of NSCLC (Table 1). It should be noted that despite the overall CYGB downregulation in tumours, eight tumour tissues (four adenocarcinomas and four SqCCL) overexpressed (≥50% compared with normal) CYGB mRNA (Table 1). Expression did not correlate with nodal metastasis; however, it did associate with differentiation. Thus, downregulation was more frequent in tumours with poor differentiation (15/21) than moderate and good (11/27) (Fisher's exact, P=0.033). As normal lung is a mosaic of different cell types and in order to examine whether normal bronchial epithelial (NHBE) cells express CYGB, we have assayed the NHBE cell line which proved to express the gene strongly (Fig. 3).


Figure 1281
View larger version (17K):
[in this window]
[in a new window]
  		Figure 1. Genotyper analysis of CYGB mRNA expression. The expression is calculated (by the software) as CYGB/TBP peak areas. The drop of CYGB expression in this case is profound.

 


Figure 1282
View larger version (23K):
[in this window]
[in a new window]
  		Figure 2. Histogram demonstrating the average loss of CYGB expression and corresponding average increase of DNA methylation in NSCLCs. Black bars represent CYGB expression, whereas striped bars represent amount of methylation as described by MtI. Error bars represent the standard error of the mean.

 


Figure 1283
View larger version (50K):
[in this window]
[in a new window]
  		Figure 3. CYGB mRNA expression of NHBE cells and a lung adenocarcinoma (CRL5935) cell line in the presence and absence of 5'-azacytidine. RT–PCR products were analysed by chip capillary electrophoresis.

 


View this table:
[in this window]
[in a new window]
  		Table 1. Histopathological, expression, methylation and FAL data for the examined NSCLCs

 
CYGB promoter methylation analysis
We designed a pyrosequencing assay to assess the methylation status of the CYGB promoter. The four sequential CpGs to be assayed were located at –504, –507, –510 and –514 relative to the transcription start site of the gene. The control non-CpG cytosine (–492) included in the assay confirmed complete bisulphite conversion of the DNA (Fig. 4). DNA from 52 normal (adjacent)/tumour pairs was assayed following sodium bisulphite conversion. We also assayed DNA from blood samples of six healthy individuals and found zero methylation levels for this region. In order to have an overall methylation figure per sample, we calculated the methylation index (MtI) as the average of the mC/C ratio observed in the four CpGs of each specimen. A very low baseline methylation (any intensity in at least one of four CpGs examined) was observed in 46/52 normal tissues. However, tumours were profoundly more highly methylated. The mean MtI was significantly higher in tumours (0.159±0.03) than in normal adjacent tissues (0.056±0.004, paired t-test, P<0.001) (Fig. 2). Overall, 25/52 (48%) tumours were significantly (>2-fold) hypermethylated in comparison with normal tissues (Table 1).


Figure 1284
View larger version (42K):
[in this window]
[in a new window]
  		Figure 4. CYGB promoter pyrograms of a lung tumour and corresponding normal adjacent tissue. The four examined CpGs and the control cytosine are indicated by boxes. The letters below each graph represent the dispensation order. E, enzyme mix; S, substrate; A, G, C, T, nucleotides. The methylation of each CpG is calculated as percentage of G incorporation (antisense primer used).

 
Interestingly, CYGB promoter hypermethylation correlated with CYGB mRNA downregulation. Linear regression analysis demonstrated that the T/N CYGB ratio was inversely correlated to the MtI difference between the tumour and the corresponding normal specimen (P=0.009, Fig. 5). Also, when dichotomizing expression and methylation values, a significant association occurred, as 33/48 samples fulfilled the methylation–expression relationship. In particular, among tumours with 2-fold loss of expression comparative to normal, 17/26 (65.4%) were methylated, whereas among tumours with expression similar to normal (<2-fold loss), only 6/22 (27%) presented with increased methylation levels (Pearson's {chi}2, P=0.008). In order to biologically verify this very strong mathematical association, we treated the CRL5935 lung adenocarcinoma cell line, which was found not to express CYGB, with 5' azacytidine, a known demethylating agent. Treatment restored CYGB expression (Fig. 3), proving the direct CYGB expression–methylation relationship.


Figure 1285
View larger version (9K):
[in this window]
[in a new window]
  		Figure 5. Linear regression analysis between tumour/normal CYGB expression ratio and tumour/normal methylation difference.

 
Although no association was observed between hypermethylation and nodal metastasis or differentiation, a marginally significant correlation was observed with histology, demonstrating higher frequency of hypermethylation in adenocarcinomas (15/25) than in squamous carcinomas (9/27, Fisher's exact test, P=0.049). A correlation demonstrating higher hypermethylation in tumours from females (16/24) than from males (8/28) has to be carefully considered, as it probably reflects the correlation between gender and histology in our sample set. Our samples were randomly picked from the tissue bank with the only criterion—an approximately even number of adenocarcinomas and squamous cell carcinomas of T stage ≥2. During data analysis, it became clear that adenocarcinomas come mostly from females (18/25), whereas SqCCLs were mostly from males (21/27).

Allelic imbalance analysis
Allelic imbalance at the 17q25 locus was assessed using seven microsatellite markers which cover the region (9). Allelic imbalance (or loss of heterozygosity-LOH) was frequent: D17S801=50%, D17S785=36%, D17S2192=64%, D17S2239=29%, D17S2246=37%, D17S2244=16% and D17S2238=19%. The fractional allele loss (FAL) for the 17q25 locus was calculated for each sample (FAL=number of markers demonstrating AI/number of informative markers) (Table 1). There was no direct correlation of the CYGB expression levels with the presence of LOH at 17q25 represented as FAL or as LOH at individual loci. However, an interesting relationship was revealed when combined expression, methylation and LOH data were analysed. Thus, the mean expression of tumours without LOH and no significant methylation (<2-fold) was higher than the mean of those with either LOH or methylation which in turn was higher than those with both LOH and methylation (Fig. 6). It is of note that the difference observed between the last two groups is significant (Mann–Whitney, P=0.049).


Figure 1286
View larger version (22K):
[in this window]
[in a new window]
  		Figure 6. Average CYGB mRNA expression of tumours with different genetic and epigenetic status of the gene.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
The CYGB gene is a candidate tumour-suppressor gene, as it maps within the TOC minimal region on chromosome 17q25, a region commonly lost in tumours from several tissues. The exact function of CYGB is unknown, although it has been proposed to play a role in collagen synthesis (19,20), O2 sensing and transport (21) or detoxification of reactive oxygen species (21,22). It was also shown that recombinant CYGB showed myeloperoxidase activity (23). CYGB is known to be upregulated under conditions of hypoxia or tissue injury (19,24) and to increase the expression of collagen (20). CYGB was recently shown to be downregulated in ovarian cancer cell lines (8) and methylated in a series of oral tumours (11). However, the status of the gene in sporadic human tumours is still largely unknown.

In this study, CYGB was shown to be expressed in NHBE cells and primary normal lung tissue. It was shown to be underexpressed (≥2-fold drop of the level in the matched normal tissue) in 54.2% of NSCLCs, suggesting that this is a frequent abnormality in advanced lung tumours and thus it may have a significant role in lung cancer development. Supporting evidence for this comes from the correlation of low CYGB expression with poor tumour differentiation. The interesting trend indicating higher frequency of this abnormality in adenocarcinomas requires further confirmation. As the function of CYGB is still largely unknown, it is difficult to speculate on how its repression might contribute to tumourigenesis. However, overexpression of Cygb in NIH 3T3 cells reduced the migratory activity of the cells (20), indicating a putative tumour suppressor activity, which has yet to be confirmed in human cells.

There are no previously published studies that indicate the expression of CYGB in human lung. Our results demonstrate that it is expressed in the NHBE cells and primary normal lung and this is in agreement with data available in Unigene EST profiler viewer (Hs95120), indicating that human lung expresses CYGB. However, analysis of expression using immunohistochemistry to provide topographical information concerning the lung cell types that express CYGB is still required to complete the picture.

In search for the mechanism(s) underlying CYGB downregulation, we performed bioinformatic inspection (http://cpgislands.usc.edu/) of the gene sequence. This demonstrated a lengthy CpG island starting within the promoter (nt –1009 relative to the transcription start site) over-running exon 1 and ending in intron 1, 355 bp after the splice junction. We thus undertook methylation analysis in this set of NSCLCs, and for this purpose, we designed a pyrosequencing assay. Pyrosequencing has been previously shown to provide semiquantitative methylation information (11,25,26). We designed an assay that covers CpGs in the region –504 to –514 encompassing a NotI site which originally provided us with the first indication from Southern blot analysis that CYGB may be hypermethylated in human aerodigestive tract tumours (data not shown).

Although all the normal blood DNAs we have examined showed lack of CYGB methylation, a very low level of CpG methylation was observed in the majority of the histologically normal adjacent lung tissues. This probably reflects precancerous epigenetic alterations due to chronic carcinogen exposure, as it is the case for other genes such as p16, RASSF1, RARB and CDH13 (27), although the hypothesis that certain normal lung cell types may have methylated CYGB cannot be excluded at this point. Thus, in order to distinguish cancer-specific hypermethylation from ‘tobacco-induced noise’, we set a 2-fold threshold between normal and tumour to be classified as significant hypermethylation.

It is of note that downregulation of CYGB significantly correlated with hypermethylation of the gene's promoter; linear regression analysis demonstrated an almost direct effect with few outliers and very high significance (P=0.009). This suggests a direct epigenetic regulation of CYGB expression during NSCLC development. Interestingly, adenocarcinomas demonstrated a trend for higher degree of hypermethylation than squamous cell carcinomas. In addition, the treatment of CRL5935 cells with 5'-azacytidine restored CYGB expression, thus clearly demonstrating the epigenetic silencing of CYGB in this lung adenocarcinoma cell line. However, this expression restoration was partial, suggesting that additional epigenetic events such as histone acetylation may contribute, along with DNA methylation, to downregulation of CYGB transcription levels. This could be further investigated by checking whether Trichostatin A treatment might, in addition to 5'-azacytidine, lead to a more complete restoration of CYGB expression.

The allelic imbalance analysis demonstrated an expected high frequency of LOH in the region. This was not directly correlated to the loss of expression, most probably due to the dramatic effect that methylation has. The combined LOH-methylation effect on silencing is apparent (Fig. 6), suggesting that both genetic and epigenetic abnormalities may lead to the deregulation of CYGB in lung cancer. However, this preliminary observation has to be further investigated and validated in oncogenic functional and/or mechanistic studies in cell lines. Nevertheless, these findings are in agreement with our recent findings in oesophageal cancer which also demonstrates loss of CYGB expression (28).

In conclusion, our studies demonstrated that LOH at 17q25, promoter hypermethylation and expression downregulation of CYGB are frequent events in NSCLC, suggesting that CYGB should be studied further in order to elucidate its role in lung tumurigenesis. Further functional work will be required in order to investigate any direct relationship between CYGB expression and epithelial growth. In addition, early lung hyperplastic and dysplastic lesions must be studied in order to understand fully the chronological map of CYGB involvement in the molecular pathogenesis of NSCLC.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Patients and tissues
Frozen tumour surgical specimens from 52 NSCLC patients, 24 females and 28 males, were used for this study. All specimens were of advanced stage (47 T2, 4 T3 and 1 T4) and paired to normal adjacent tissue. The patients were recruited at the Cardiothoracic Centre of Broadgreen, Liverpool, UK. The age of the patients ranged between 45 and 82 years (mean=65). Concerning histological diagnosis, 25 were adenocarcinomas and 27 were squamous cell carcinomas.

Tissue culture and azacytidine treatment
The NHBE cell line (Clonetics, UK, cat no. CC2540) was used to assess CYGB expression in NHBE cells. The line was grown using BEBM medium with supplements provided by the supplier (Clonetics). The CRL-5935 lung adenocarcinoma cell line was grown with Ham's F12, 10% FCS (Invitrogen, UK). CRL-5935 did not express CYGB and was subsequently used for the azacytidine experiment. For this, cells were grown in the presence of 5 µM 5'-azacytidine (Sigma, UK) for 10 days (three replications) and RNA extracts were assayed comparatively to those of untreated cells.

DNA and RNA extraction
Twenty 10 µm sections of each tumour sample were dissected to ensure the presence of >80% tumour cells (confirmed by H&E staining). Ten of these sections were then lysed using TRIZOL (Invitrogen), and RNA was extracted using the protocol supplied by the manufacturer. Genomic DNA was extracted from the remaining 10 sections using the DNeasy kit (Qiagen, UK) and following the supplier's protocol.

Reverse transcription and comparative multiplex reverse transcription–PCR
For subsequent cDNA synthesis in 20 µl reactions using the Promega Reverse Transcription System (Promega, UK) and oligo-dT primers, 1 µg RNA was used. cDNAs were stored at –20°C prior to use in multiplex comparative reverse transcription (RT)–PCR assays. Primers for cytoglobin, which were designed so that the product spans exons 2–4: forward 5'CTTCGGGGAAGTTGAGTCAG3' and reverse 5'CAAGGTGGAACCGGTGTACT3'. Primers for the housekeeping gene, TATA box-binding protein (TBP), have been previously described (29). The PCR amplicon sizes were 226 bp for TBP and 351 bp for CYGB. The forward primer of each pair was labelled with FAM at its 5' end. PCR was performed using the Multiplex PCR Kit (Qiagen) with 0.05 pmol/µl of each TBP primer and 0.4 pmol/µl of each CYGB primer. Different amounts of primers were used to bring the signal of both genes within the detection window, as TBP is much more strongly expressed than CYGB. PCR cycles were 95°C (15 min), 23x [95°C (30 s), 60°C (1 min 30 s), 72°C (1 min 30 s)], 72°C (10 min). Fluorescently labelled PCR products were analysed on an ABI 377 (Applied Biosystems, UK) using the GenescanerTM and GenotyperTM modules.

Promoter methylation analysis
Sodium bisulphite treatment of DNA was performed using the EZ DNA Methylation Kit (Zymo Research), as per the manufacturer's protocol. Hot-start PCR was carried out using Amplitaq Gold (Applied Biosystems), and the PCR primers 5'-biotin-GGGAATTGATTTAAAGTTTA-3' and 5'-AAAAACCCAACTAAATCC-3', to produce a 117bp CYGB PCR product. PCR cycles were 95°C (11 min), 40x[94°C (30 s), 49°C (45 s), 72°C (20 s)], 72°C (10 min). PCR products were checked for purity on a 1.8% agarose/ethidium bromide gel before sequencing. Pyrosequencing was performed using the standard equipment and protocol (Biotage, UK), with addition of 3 µl single-strand-binding SSB protein to the DNA, following the heat-denaturation step. The sequencing primer used was 5'-ACCCAACTAAATCCAC-3'.

Allelic imbalance analysis
Paired tumour–normal DNA samples provided successful allelic imbalance results for 48 individuals. These were examined with seven microsatellite markers (D17S785, D17S801, D17S2192, D17S2238, D17S2239, D17S2244 and D17S2246) located at 17q25. Primers for PCR amplification of these microsatellite repeat regions and thermal profiles have been previously described (9). PCR products were initially analysed on 8–12% non-denaturing polyacrylamide gels for 2000–6000 VH, depending on marker size, and visualized after staining with silver. Informative (heterozygous) samples were analysed further on an Agilent 2100 Bioanalyser and the allele ratios were calculated. LOH was scored when T/N ratio was outside the calculated 99% reference range of normal repetition experiments (≤0.75 or ≥1.25).

Statistical analysis
Fisher's exact test, t-test, Mann–Whitney test and linear regression analysis were used to analyse the molecular and clinicopathological data. Analysis was performed using the SPSS 12.0 package.


   ACKNOWLEDGEMENTS
 
This research was supported by the Roy Castle Lung Cancer Foundation, UK, the North West Cancer Research Fund, UK and the Isle of Man Anticancer Association, UK.

Conflict of Interest statement. The authors declare that they have no conflict of interests.


   FOOTNOTES
 
{dagger} The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors. Back


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. In Toms J.R. (Ed.). Cancerstats Monograph (2004) (Cancer Research, UK).

  2. Fong K.M., Kida Y., Zimmerman P.V., Ikenaga M., Smith P.J. (1995) Loss of heterozygosity frequently affects chromosome 17q in non-small cell lung cancer. Cancer Res. 55:4268–4272.[Abstract/Free Full Text]

  3. Neville E.M., Stewart M.P., Swift A., Liloglou T., Ross H., Gosney J.R., Donnelly R.J., Field J.K. (1996) Allelotype of non small cell lung cancer. Int. J. Oncol. 9:533–539.

  4. Abujiang P., Mori T.J., Takahashi T., Tanaka F., Kasyu I., Hitomi S., Hiai H. (1998) Loss of heterozygosity (LOH) at 17q and 14q in human lung cancers. Oncogene 17:3029–3033.[CrossRef][Web of Science][Medline]

  5. Castilla L.H., Couch F.J., Erdos M.R., Hoskins K.F., Calzone K., Garber J.E., Boyd J., Lubin M.B., Deshano M.L., Brody L.C., et al. (1994) Mutations in the BRCA1 gene in families with early-onset breast and ovarian cancer. Nat. Genet. 8:387–391.[CrossRef][Web of Science][Medline]

  6. Russell S.E., McIlhatton M.A., Burrows J.F., Donaghy P.G., Chanduloy S., Petty E.M., Kalikin L.M., Church S.W., McIlroy S., Harkin D.P., et al. (2000) Isolation and mapping of a human septin gene to a region on chrosome 17q, commonly deleted in sporadic epithelial ovarian tumors. Cancer Res. 60:4729–4734.[Abstract/Free Full Text]

  7. Harada H., Nagai H., Tsuneizumi M., Mikami I., Sugano S., Emi M. (2001) Identification of DMC1, a novel gene in the TOC region on 17q25.1 that shows loss of expression in multiple human cancers. J. Hum. Genet. 46:90–95.[CrossRef][Medline]

  8. Presneau N., Dewar K., Forgetta V., Provencher D., Mes-Masson A.M., Tonin P.N. (2005) Loss of heterozygosity and transcriptome anlyses of a 1.2 Mb candidate ovarian cancer tumor suppressor locus region at 17q25.1-q25.2. Mol. Carcinog. 43:141–154.[Medline]

  9. Langan J.E., Cole C.G., Huckle E.J., Byrne S., McRonald F.E., Rowbottom L., Ellis A., Shaw J.M., Leigh I.M., Kelsell D.P., et al. (2004) Novel microsatellite markers and single nucleotide polymorphisms refine the tylosis with oesophageal cancer (TOC) minimal region on 17q25 to 42.5 kb: sequencing does not identify the causative gene. Hum. Genet. 114:534–540.[CrossRef][Web of Science][Medline]

  10. Shahabi M., Noori Daloii M.R., Langan J.E., Rowbottom L., Jahanzad E., Khoshbin E., Taghikhani M., Field J.K., Risk J.M. (2004) An investigation of the tylosis with oesophageal cancer (TOC) locus in Iranian patients with oesophageal squamous cell carcinoma. Int. J. Oncol. 25:389–395.[Web of Science][Medline]

  11. Shaw R.J., Liloglou T., Rogers S.N., Brown J.S., Vaughan E.D., Lowe D., Field J.K., Risk J.M. (2006) Promoter methylation of P16, RARbeta, E-cadherin, cyclin A1 and cytoglobin in oral cancer: quantitative evaluation using pyrosequencing. Br. J. Cancer 94:561–568.[CrossRef][Web of Science][Medline]

  12. Strathdee G. and Brown R. (2002) Aberrant DNA methylation in cancer: potential clinical interventions. Expert Rev. Mol. Med. 2002:1–17.[Medline]

  13. Jones P.A. and Baylin S.B. (2002) The fundamental role of epigenetic events in cancer. Nat. Rev. Genet. 3:415–428.[Web of Science][Medline]

  14. Ehrlich M. (2002) DNA methylation in cancer: too much, but also too title. Oncogene 21:5400–5413.[CrossRef][Web of Science][Medline]

  15. Belinsky S.A., Nikula K.J., Palmisano W.A., Michels R., Saccomanno G., Gabrielson E., Baylin S.B., Herman J.G. (1998) Aberrant methylation of p16(INK4a) is an early event in lung cancer and a potential biomarker for early diagnosis. Proc. Natl Acad. Sci. USA 95:11891–11896.[Abstract/Free Full Text]

  16. Brown R. and Strathdee G. (2002) Epigenomics and epigenetic therapy of cancer. Trends Mol. Med. 8:S43–S48.[CrossRef][Web of Science][Medline]

  17. Belinsky S.A., Klinge D.M., Dekker J.D., Smith M.W., Bocklage T.J., Gilliland F.D., Crowell R.E., Karp D.D., Stidley C.A., Picchi M.A. (2005) Gene promoter methylation in plasma and sputum increases with lung cancer risk. Clin. Cancer Res. 11:6505–6511.[Abstract/Free Full Text]

  18. Morita M., Kuwano H., Nakashima T., Taketomi A., Baba H., Saito T., Tomoda H., Egashira A., Kawaguchi H., Kitamura K., et al. (1998) Family aggregation of carcinoma of the hypopharynx and cervical esophagus: special reference to multiplicity of cancer in upper aerodigestive tract. Int. J. Cancer 76:468–471.[Medline]

  19. Schmidt M., Gerlach F., Avivi A., Laufs T., Wystub S., Simpson J.C., Nevo E., Saaler-Reinhardt S., Reuss S., Hankeln T., et al. (2004) Cytoglobin is a respiratory protein in connective tissue and neurons, which is up-regulated by hypoxia. J. Biol. Chem. 279:8063–8069.[Abstract/Free Full Text]

  20. Nakatani K., Okuyama H., Shimahara Y., Saeki S., Kim D.H., Nakajima Y., Seki S., Kawada N., Yoshizato K. (2004) Cytoglobus/STAP, its unique localization in splanchnic fibroblast-like cells and function in organ fibrogenesis. Lab. Invest. 84:91–101.[CrossRef][Web of Science][Medline]

  21. Trent J.T. III and Hargrove M.S. (2002) A ubiquitously expressed human hexsacoordinate hemoglobin. J. Biol. Chem. 277:19538–19545.[Abstract/Free Full Text]

  22. Burmester T., Ebner B., Weich B., Hankeln T. (2002) Cytoglobin: a novel globin type ubquitously expressed in vertebrate tissues. Mol. Biol. Evol. 19:416–421.[Abstract/Free Full Text]

  23. Asahina K., Kawada N., Kristensen D.B., Nakatani K., Seki S., Shiokawa M., Tateno C., Obara M., Yoshizato K. (2002) Characterization of human stellate cell activation-associated protein and its expression in human liver. Biochim. Biophys. Acta. 1577:471–475.[Medline]

  24. Fordel E., Geuens E., Dewilde S., Rottiers P., Carmeliet P., Grooten J., Moens L. (2004) Cytoglobin expression in upregulated in al tissues upon hypoxia: an in vitro and in vivo study by quantitative real-time PCR. Biochem. Biophys. Res. Commun. 319:342–348.[CrossRef][Web of Science][Medline]

  25. Colella S., Shen L., Baggerly K.A., Issa J.P., Krahe R. (2003) Sensitive and quantitative universal Pyrosequencing methylation analysis of CpG sites. Biotechniques 35:146–150.[Web of Science][Medline]

  26. Dupont J.M., Tost J., Jammes H., Gut I.G. (2004) De novo quantitative bisulfire sequencing usign the pyrosequencing technology. Anal. Biochem. 333:119–127.[CrossRef][Web of Science][Medline]

  27. Zochbauer-Muller S., Lam S., Toyooka S., Virmani A.K., Toyooka K.O., Seidl S., Minna J.D., Gazdar A.F. (2003) Aberrant methylation of multiple genes in the upper aerodigestive tract epithelium of heavy smokers. Int. J. Cancer 107:612–616.[CrossRef][Web of Science][Medline]

  28. McRonald F.E., Liloglou T., Xinarianos G., Hill L., Rowbottom L., Langan J.E., Ellis A., Shaw J.M., Field J.K., Risk J.M. (2006) Down-regulation of the cytoglobin gene, located on 17q25, in tylosis with oesophageal cancer (TOC): evidence for trans-allele repression. Hum. Mol. Genet. 15:1271–1277.[Abstract/Free Full Text]

  29. Savinainen K.J., Saramaki O.R., Linja M.J., Bratt O., Tammela T.L., Isola J.J., Visakorpi T. (2002) Expression and gene copy number analysis of ERBB2 oncogene in prostate cancer. Am. J. Pathol. 160:339–345.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Cancer Res.Home page
N. Shivapurkar, V. Stastny, N. Okumura, L. Girard, Y. Xie, C. Prinsen, F. B. Thunnissen, I. I. Wistuba, B. Czerniak, E. Frenkel, et al.
Cytoglobin, the Newest Member of the Globin Family, Functions as a Tumor Suppressor Gene
Cancer Res., September 15, 2008; 68(18): 7448 - 7456.
[Abstract] [Full Text] [PDF]

Home page
 J. Mol. Diagn.Home page
E. Dejeux, V. Audard, C. Cavard, I. G. Gut, B. Terris, and J. Tost
Rapid Identification of Promoter Hypermethylation in Hepatocellular Carcinoma by Pyrosequencing of Etiologically Homogeneous Sample Pools
J. Mol. Diagn., September 1, 2007; 9(4): 510 - 520.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
15/13/2038    most recent
ddl128v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Xinarianos, G.
Right arrow Articles by Liloglou, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xinarianos, G.
Right arrow Articles by Liloglou, T.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?