Human Molecular Genetics Advance Access originally published online on June 5, 2006
Human Molecular Genetics 2006 15(14):2210-2215; doi:10.1093/hmg/ddl146
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ube3a expression is not altered in Mecp2 mutant mice
1 Department of Genetics and 2 Department of Pediatrics, Stanford University School of Medicine, Stanford, CA, USA
* To whom correspondence should be addressed at: Department of Genetics, Stanford University School of Medicine, Beckman Center for Molecular and Genetic Medicine, 279 Campus Drive, Stanford, CA 94305-5323, USA. Tel: +1 6507258089; Fax: +1 6507258112; Email: ufrancke{at}stanford.edu
Received April 18, 2006; Revised May 21, 2006; Accepted May 31, 2006
| ABSTRACT |
|---|
|
|
|---|
Rett syndrome (RTT) is a neurodevelopmental disorder characterized by cognitive regression, loss of purposeful hand movements and speech, stereotypies, ataxia, seizures, mental retardation and acquired microcephaly. Mutations in MECP2, encoding methyl-CpG-binding protein 2, are responsible for
90% of classic RTT cases. RTT displays phenotypic overlap with Angelman syndrome, a disorder caused by loss of expression of the imprinted gene UBE3A. MeCP2 binds to methylated DNA and may alter the expression of imprinted genes, thereby suggesting a mechanistic link between the two disorders. Here, we tested the hypothesis that MeCP2 deficiency affects expression of Ube3a in mouse models of RTT. As Ube3a is only imprinted in brain, we evaluated Ube3a expression in brains of 15 different litters of neonatal or 8-week-old male Mecp2 mutant mice by real-time quantitative RTPCR and western blot analysis. We found no significant differences between Mecp2tm1.1Bird/Y or Mecp2tm1.1Jae/Y mutants and their wild-type male siblings that served as negative controls. In positive control mice carrying a maternally inherited Ube3a deletion, Ube3a sense transcript and protein levels were drastically reduced. Our data contrast with two recent reports of substantially decreased Ube3a expression in brain tissues of MeCP2-deficient mice. We, therefore, challenge the conclusion that decreased UBE3A/Ube3a expression contributes to the pathophysiology of RTT. | INTRODUCTION |
|---|
|
|
|---|
Rett Syndrome (RTT) (OMIM 312750 [OMIM] ) is characterized by normal neonatal development up to age 718 months followed by rapid regression of brain functions including loss of purposeful hand movements, truncal ataxia and deceleration of brain growth (1,2). Heterozygosity for sporadic mutations or deletions in MECP2, located at Xq28 and subject to X-inactivation, is observed in
90% of females with classic RTT. Males with an inactivating MECP2 mutation have no functional MeCP2 protein and suffer from lack of postnatal development, respiratory insufficiency and early death (3,4) (reviewed in 5). MeCP2, methyl-CpG-binding protein 2, binds to methyl-CpG dinucleotides adjacent to A/T sequences (6,7). CpG methylation at gene promoters is often associated with transcriptional silencing. In cell culture systems, MeCP2 binds to methylated promoter regions and represses transcription of BRCA1, CCNA1, MDR1, H19 and several other genes or genomic elements (811). Although MeCP2 can silence methylated alleles in cell culture, gene expression microarray studies have discovered very few significant changes in samples from RTT individuals or MeCP2-deficient mice (1216). Imprinted genes are attractive potential targets of MeCP2 modulation because their parent-of-origin-specific expression patterns are maintained by differentially methylated regions (DMRs), not limited to promoters (17). Initial studies of imprinting status in samples from RTT individuals, however, showed normal expression of imprinted genes (18).
A potential candidate for MeCP2 modulation is the UBE3A locus that is controlled by complex imprinting mechanisms in brain. UBE3A encodes E6AP (human papillomavirus E6-associated protein) that was initially discovered as a protein required for the association of human papillomavirus with p53. E6AP is a ubiquitin ligase and mediates the ubiquitin-dependent degradation of p53. Mutations or deletions of UBE3A affecting the maternally inherited allele cause Angelman syndrome (AS) (OMIM 105830 [OMIM] ), a neurodevelopmental disorder. The phenotypic overlap between RTT and AS includes microcephaly, seizures, absence of speech, ataxia and mental retardation. Therefore, the hypothesis that the genes responsible for the two disorders could be mechanistically linked is attractive. UBE3A is imprinted in brain, and MeCP2 may mediate imprinting by binding to methylated DNA and silencing transcription.
UBE3A is biallelically expressed in peripheral tissues, but in brain the maternal allele is predominantly expressed (19,20). As the UBE3A promoter lacks a DMR, suppression of the paternal allele is thought to be mediated by a brain-specific anti-sense transcript (Ube3a-AS) that acts in cis (2124). A recent report showed that maternal expression of Ube3a-AS reduces maternal expression of sense Ube3a in cis (25). If MeCP2 deficiency were to cause de-repressed Ube3a-AS transcription from the maternal allele, a reduction of Ube3a sense transcript would be expected. Indeed, Ube3a expression levels were reported to be decreased in RTT brains and MeCP2-deficient mouse models. Samaco et al. (26) found a modest reduction (1.5-fold) in Ube3a mRNA and protein in whole brain samples of 10-week-old MeCP2-deficient mice with either one of two different mutant alleles (27,28). However, this reduction was not due to alteration in allele-specific expression, and Ube3a-AS expression was unchanged. They concluded, nevertheless, that MeCP2 deficiency causes reduced Ube3a expression, as well as reduced Gabrb3 expression, possibly by disturbing long-range cis-regulatory interactions in this region. More dramatically, Makedonski et al. (29) reported a 6-fold decrease in the level of Ube3a RNA and a greater than 10-fold decrease in the level of E6AP protein in brains of male MeCP2-deficient mice with the Mecp2tm1.1Bird/Y mutation (28). These drastic changes were associated with biallelic expression of the Ube3a-AS transcript. Previous cDNA microarray studies by four different groups, however, had failed to detect a significant difference in UBE3A/Ube3a expression in MeCP2-deficient mouse or RTT brain (12,1416). But Makedonski et al. (29) studied Ube3a expression in the whole brain of neonatal mice, unlike previous studies that focused on older mice.
Although RTT and AS share several clinical features, mice that lack MeCP2 are very different from mice that lack E6AP. Male mice deficient for MeCP2 have truncal ataxia and immobility by 8 weeks of age and die by 1214 weeks (27,28). Ube3a deficiency causes mild motor dysfunction, inducible seizures and context-dependent learning deficits, with survival variably affected in a strain-background-dependent manner (30). Therefore, if Ube3a expression were indeed decreased in Mecp2-deficient mice, it might contribute to the phenotype but would not account for the complete phenotype observed.
Here, we have used real-time quantitative RTPCR and western blot analysis to evaluate Ube3a expression in brain of neonatal and adult mice with mutations in Mecp2. Establishing or rejecting a molecular link between UBE3A and MECP2 will provide insight into the molecular pathophysiology of RTT and AS. Contrary to the two previous reports, we find no significant change in the expression of Ube3a in Mecp2-deficient mice, even in mice of the same age and genetic background as in the previous publications.
| RESULTS |
|---|
|
|
|---|
Ube3a expression is markedly reduced in the brain of mice with a maternal deletion of Ube3a
As a foundation to evaluate Ube3a expression in the brain of wild-type and MeCP2-deficient mice, we defined the global level of Ube3a imprinting in the whole mouse brain. Because the imprinted, maternal allele-specific, expression of Ube3a is restricted to the nervous system, we compared the level of Ube3a transcripts in the brains of P21 mice with a maternal Ube3a deletion and wild-type mice. All six mice studied were from the same litter, and the mutant mice harbor a deletion from Snrpn to Ube3a on a C57Bl/6J background (31). For each brain, the cerebellum was separated from the remainder of the brain and assayed separately. Our quantitative RTPCR studies revealed that mice with a maternal deletion of Ube3a have less than 20% of Ube3a transcripts relative to their wild-type siblings (Fig. 1). The results for cerebellum and the remainder of the brain were similar and are consistent with wide-spread imprinting of Ube3a in brain, as reported by Landers et al. (32). The low levels of Ube3a transcripts detected could be derived from glia cells where imprinting of this locus is not observed (24). These results would predict that in mice with paternally derived deletion, the Ube3a transcript level should be 8590% of normal. Because the majority of these mice die during the neonatal period, we were unable to obtain age-matched (P21) controls. We studied a litter of 3-day-old mice and found no differences between paternal deletion and wild-type sibs in the level of Ube3a transcripts (data not shown). This result may indicate a lower number of glia cells in 3-day-old brain or may simply be due to the limit of the qRTPCR assay in detecting such small changes. The initial control experiment with the maternal Ube3a deletion mice documents that our quantitative RNA assay is able to detect robust changes and is specific for Ube3a.
|
Ube3a transcript levels are not significantly different in the brain of neonatal wild-type and MeCP2-deficient mice
To evaluate the expression of Ube3a in neonatal MeCP2-deficient mouse brain, we extracted RNA from whole brains of three different litters born to Mecp2tm1.1Bird/+ females. The mice had been obtained from the Jackson laboratory on a C57Bl/6J background and had been backcrossed to C57Bl/6J mice locally for at least six generations. The mothers were 24 months old and asymptomatic. The litters included six wild-type, three heterozygotes and five male mutants. We performed qRTPCR with SYBR Green and analyzed the data using the Standard Curve Method (Applied Biosystems) to determine the relative amount of Ube3a mRNA compared to endogenous controls. Mecp2 expression was also evaluated in all samples and correlated with the genotype (Fig. 2A).
|
We found no significant difference in Ube3a expression in the whole brain of neonatal Mecp2 mutant and wild-type mice (Fig. 2A). The standard error of mean (SEM) is overlapping for each set of samples, and unpaired t-tests revealed P>0.4. These data differ from the 6-fold decrease in Ube3a expression reported by Makedonski et al. (29). Attempting to reproduce their published data, we used mice with the same mutant allele (Mecp2tm1.1Bird/y) on the same C57Bl/6J background and at the same age (13 days). In comparison, Samaco et al. (26) reported qRTPCR data for only two sets of male Mecp2-null mice and normal littermates at 10 weeks of age, with the allele not specified. Although Ube3a expression in whole brain was lower in the mutants, the SEM data, based on four experimental repetitions, show a wide range, and the results are not statistically significant.
Having confirmed that neurons in the cerebellum preferentially express Ube3a from the maternal allele (Fig. 1), we then compared the expression of Ube3a in the cerebellum of Mecp2 mutant and wild-type mice at 8 weeks of age. We compared two different Mecp2 mutant alleles. Mecp2tm1.1Jae/Y (J allele) has an in-frame deletion of exon 3 and produces a stable mRNA (27). Exon 3 encodes part of the methyl-CpG-binding domain of MeCP2. Mecp2tm1.1Bird/Y (B allele) is deleted for exon 3 and the coding region of exon 4; it does not produce a stable mRNA (28). Six mutant and six wild-type males with the J allele and eight mutant and six wild-type males with the B allele were tested. We found no significant differences in the level of Ube3a transcripts between mutant and wild-type mice of either allele (Fig. 2B). Real-time qRTPCR reliably detects changes in expression that are at least 2-fold (33) (Ambion Technical Bulletin). We, therefore, conclude that Ube3a expression is changed by less than 2-fold, if at all, in MeCP2-deficient mice. As Mecp2tm1.1Bird/Y mice were on a C57Bl/6J background and Mecp2tm1.1Jae/Y mice on a 129/Sv, C57BL/6 and BALB/c mixed background, we conclude that strain background is not a major contributor to the reported Ube3a expression differences.
E6AP levels are similar in the brain of wild-type and Mecp2 mutant mice
We next took the analysis to the protein level by studying E6AP, the
100 kDa protein product encoded by the Ube3a gene. In situ hybridization studies of mice with partial uniparental disomy for chromosome 7 had shown that Ube3a is exclusively expressed from the maternal allele in hippocampal neurons and Purkinje cells (34). To confirm the specificity of our antibody, we analyzed immunoblots with samples from a mouse with a maternal deletion of Ube3a (31) (Fig. 3, lane 7). Note that E6AP is absent, whereas control proteins (GAPDH and MeCP2) are present. To compare the level of E6AP in the brain of Mecp2tm1.1Bird/Y and wild-type mice, we performed three independent western blot analyses with protein amounts ranging from 2.5 µg to 10 µg (examples are shown in Fig. 3). There was no consistent difference in E6AP level between wild-type and mutant samples. Specifically, we did not observe a 10-fold decrease in E6AP levels in neonatal, MeCP2-deficient mouse brain (B allele) as reported by Makedonski et al. (29).
|
| DISCUSSION |
|---|
|
|
|---|
To determine whether Ube3a is an in vivo target of MeCP2, possibly via relaxation of Ube3a-AS imprinting in neurons, we evaluated Ube3a expression in whole brain and cerebellum of MeCP2-deficient mice using qRTPCR and western blot analysis. Neonatal or 8-week-old mice from 15 different litters and from two different Mecp2 mutant mouse models were examined. No significant change in Ube3a expression was observed. We first optimized our qRTPCR and western blot assays by using both negative and positive controls. qRTPCR is a very robust procedure that reliably distinguishes 2-fold differences between two RNA samples. Our results differ markedly from the 6-fold decrease in RNA levels and 10-fold decrease in protein levels reported by Makedonski et al. (29). The large changes in Ube3a expression in MeCP2-deficient mice reported should be easily reproducible with qRTPCR and western blot analyses. By using laser-scanning cytometry of tissue microarrays, Samaco et al. (26) reported a 1.52-fold decrease in E6AP immunofluorescence in MeCP2-deficient cells; however, the reduction was less striking on immunoblots. Adult heterozygotes for the B or J allele had levels ~20% lower than +/+ female controls (P<0.05), and the single male Mecp2-/Y sample fell into the same range.
Possible biological factors that could account for discrepant results include differences in mutant allele, strain background, age of experimental animals and tissue type. To match the published report, we used mice with the same mutant allele (Mecp2tm1.1Bird) on the same C57Bl/6J background, at the same age (13 days) and the same tissue (whole brain). We conclude that the reported data are not reproducible. As for the Samaco et al. (26) paper, their claim that MeCP2-deficiency causes reduction in UBE3A is primarily based on quantitative immunofluorescence data obtained by LSC microscopy, a technique not available to us. Their qRTPCR and western blot results are derived from only two or one (respectively) mutant male brain and are not convincing. Therefore, the hypothesis that reduced Ube3a levels, possibly due to de-repression of Ube3a-AS transcript on the maternal allele, contribute to the MeCP2-deficiency phenotype in mice is not supported.
We have not evaluated UBE3A expression in the brain of RTT individuals and, therefore, cannot exclude the possibility that UBE3A is decreased in human, but not in mouse MeCP2-deficient brain. We consider this unlikely, however, for multiple reasons. Colantuoni et al. (12) used cDNA microarrays and subtractive hybridization to compare gene expression in the cortex of six RTT individuals to six controls. They did not observe a consistent change in UBE3A expression, but one cannot exclude that UBE3A expression may be altered in select brain regions at specific developmental time points.
Samaco et al. (26) quantitated UBE3A on human tissue microarrays containing different brain regions, as previously described (35). They reported a general reduction in levels of transcripts and proteins for UBE3A, as well as of the non-imprinted locus GABRB3, in individuals with RTT, AS and autism. Makedonski et al. (29) studied three human RTT brain samples by semi-quantitative RTPCR and western blot analyses. While they reported a mild reduction in UBE3A in RTT females, the single brain from a RTT male revealed results similar to an AS brain (29).
To explain these different reports, the origin of the brain samples, both cases and controls, needs to be considered. The patterns of gene expression in post mortem brain are distinctly influenced by the conditions of death and by pH changes that may occur due to prolonged respiratory arrest, multi-organ failure or coma (36). In addition, the time interval between death and collection of the sample may influence RNA integrity. The two female RTT individuals, with unknown MECP2 mutation status, studied by Makedonski et al. (29), died from complications of the disorder, and the post mortem intervals were 20 h (UMB no. 448) and 18 h, respectively (UMB no. 1420). The male RTT sample (UMB no. 1238) was obtained within 2 h of death, but the genotype and karyotype of this sample are unknown. If he had been a 46,XY male and hemizygous for a MECP2 mutation, he would have suffered from congenital encephalopathy, a condition characterized by prolonged central hypoxia and episodes of respiratory arrest. This disorder is very different from the RTT-like phenotype in a 47,XXY male who is heterozygous for a MECP2 mutation or in a 46,XY male with mosaicism for a postzygotic MECP2 mutation (reviewed in 5). Samaco et al. (26) report UBE3A expression data for four RTT brain samples that are not further described, except that MECP2 mutations were detected in only two of them. We, therefore, cannot reconcile the discrepant literature data on human UBE3A expression that have been obtained on a small number of poorly characterized and heterogeneous brain samples. Although mutations in MECP2 were identified as the cause of RTT in 1999 (3), the downstream molecular pathways that lead to the neuropathology of RTT remain elusive. Defining the mechanisms of MeCP2 action that are altered in MeCP2 deficiency will move us closer to understanding this multifunctional protein and developing treatments for the disorder.
| MATERIALS AND METHODS |
|---|
|
|
|---|
MeCP2-deficient mice
Female heterozygotes for an Mecp2 mutation (B allele) (Mecp2tm1.1Bird) (28) were purchased from The Jackson Laboratory where they had been bred on C57BL/6J for several generations. At Stanford, heterozygous females were bred for at least six generations to C57BL/6J males. For the studies reported here, the females were 24 months old at the time of delivery and asymptomatic. Newborn mice were genotyped for Mecp2 and Sry (for sexing). Mecp2tm1.1Jae (J allele) (27) heterozygotes were obtained from Rudolf Jaenisch on a mixed 129/Sv, C57Bl/6 and BALB/c background and were bred for several generations to BALB/cJ males.
Snrpn-Ube3a deletion mice (31) were kindly provided by Arthur Beaudet and were bred on a C57Bl/6J background.
Real-time qRTPCR
RNA was extracted from brains by using TRIzol Reagent and was purified with Y30 microcon tubes (Millipore). Two micrograms of each sample were treated with 2 U DNase I (Ambion) and reverse transcribed with Superscript II (Invitrogen). The Ube3a amplicon spans two exons flanking a 7.7 kb intron, ensuring that we are not detecting genomic DNA or the Ube3a antisense transcript. Gel electrophoresis revealed a single PCR product and melting curve analysis showed a single peak. Real-time quantitative expression analysis was performed using an ABI 5700 (AME Bioscience) instrument. Primer pairs are as follows: Mecp2 (F: TGACTTCACGGTAACTGGGAG; R: TTTCACCTGAACACCTTCTGATG), Ube3a (F: TGCACTGGTCCGGCTAGAG; R: TTCAAGTCTGCAGGATTTTCCA), ß2m (F: ACCCGCCTCACATTGAAATCC; R: CGATCCCAGTAGACGGTCTTG); ß-actin (F: CCTCACCTGAAGTACCCCA; R: TCGTCCCAGTTGGTGACGAT).
Western blot analysis
Whole brain samples were rapidly homogenized in lysis buffer with a mortar and pestle and then boiled for 35 min in lysis buffer (10 mM Tris pH 7.4, 1% SDS). Protein samples were quantitated using a modified Lowry assay (Bio-Rad DC Protein Assay). Quantities ranging from 2.5 to 10µg were separated by polyacrylamide gel electrophoresis and transferred to PVDF membranes. A monoclonal mouse antibody against E6AP amino acids 501712 (BD Transduction Laboratories, Cat. no. 611416) was used, at 1:500 and 1:1000 dilutions in blocking buffer, followed by an HRP-conjugated secondary antibody at 1:1000 dilution in blocking buffer. The procedures were optimized with control mice having a Ube3a deletion (31).
| ACKNOWLEDGEMENTS |
|---|
The authors are grateful to Helen Kwan, Hong-Hua Li and Feng Ding for helpful discussions and assistance and to Rudolf Jaenisch and Arthur Beaudet for mutant mice. C.J. was supported by the Stanford Genome Training Program (T32 HG00044 from the National Human Genome Research Institute). This work was supported in part by research grants from the NIH and the International Rett Syndrome Association.
Conflict of Interest statement. The authors declare that they have no conflict of interest.
| REFERENCES |
|---|
|
|
|---|
- Rett A. (1966) Uber ein eigenartiges hirnatrophisches Syndrom bei Hyperammonamie im Kindesalter. Wien. Med. Wochenschr. 116:723738.[Medline]
- Hagberg B., Aicardi J., Dias K., Ramos O. (1983) A progressive syndrome of autism, dementia, ataxia, and loss of purposeful hand use in girls: Rett's syndrome: report of 35 cases. Ann. Neurol. 14:471479.[CrossRef][ISI][Medline]
- Amir R.E., Van den Veyver I.B., Wan M., Tran C.Q., Francke U., Zoghbi H.Y. (1999) Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat. Genet. 23:185188.[CrossRef][ISI][Medline]
- Wan M., Lee S.S., Zhang X., Houwink-Manville I., Song H.R., Amir R.E., Budden S., Naidu S., Pereira J.L., Lo I.F., et al. (1999) Rett syndrome and beyond: recurrent spontaneous and familial MECP2 mutations at CpG hotpots. Am. J. Hum. Genet. 65:15201529.[CrossRef][ISI][Medline]
- Francke U. (2006) Mechanisms of disease: neurogenetics of MeCP2 deficiency. Nat. Clin. Pract. Neurol. 2:212221.
- Lewis J.D., Meehan R.R., Henzel W.J., Maurer-Fogy I., Jeppesen P., Klein F., Bird A. (1992) Purification, sequence, and cellular localization of a novel chromosomal protein that binds to methylated DNA. Cell 69:905914.[CrossRef][ISI][Medline]
- Klose R.J., Sarraf S.A., Schmiedeberg L., McDermott S.M., Stancheva I., Bird A.P. (2005) DNA binding selectivity of MeCP2 due to a requirement for A/T sequences adjacent to methyl-CpG. Mol. Cell 19:667678.[CrossRef][ISI][Medline]
-
Magdinier F., Billard LM., Wittmann G., Frappart L., Benchaib M., Lenoir G.M., Guerin J.F., Dante R. (2000) Regional methylation of the 5' and CpG island of BRCA1 is associated with reduced gene expression in human somatic cells. FASEB J. 14:15851594.
[Abstract/Free Full Text] -
El-Osta A., Kantharidis P., Zalcberg J.R., Wolffe A.P. (2002) Precipitous release of methyl-CpG binding protein 2 and histone deacetylase 1 from the methylated human multidrug resistance gene (MDR1) on activation. Mol. Cell. Biol. 22:18441857.
[Abstract/Free Full Text] -
Drewell R.A., Goddard C.J., Thomas J.O., Surani M.A. (2002) Methylation-dependent silencing at the H19 imprinting control region by MeCP2. Nucleic Acids Res. 30:11391144.
[Abstract/Free Full Text] -
Muller C., Readhead C., Diederichs S., Idos G., Yang R., Tidow N., Serve H., Berdel W.E., Koeffler H.P. (2000) Methylation of the cyclin A1 promoter correlates with gene silencing in somatic cell lines, while tissue-specific expression of cyclin A1 is methylation independent. Mol. Cell. Biol. 20:33163329.
[Abstract/Free Full Text] - Colantuoni C., Jeon O.H., Hyder K., Chenchik A., Khimani A.H., Narayanan V., Hoffman E.P., Kaufmann W.E., Naidu S., Pevsner J. (2001) Gene expression profiling in postmortem Rett Syndrome brain: differential gene expression and patient classification. Neurobiol. Dis. 8:847865.[CrossRef][ISI][Medline]
- Traynor J., Agarwal P., Lazzeroni L., Francke U. (2002) Gene expression patterns vary in clonal cell cultures from Rett syndrome females with eight different MECP2 mutations. BMC Med. Genet. 3:12.[CrossRef][Medline]
-
Tudor M., Akbarian S., Chen R.Z., Jaenisch R. (2002) Transcriptional profiling of a mouse model for Rett syndrome reveals subtle transcriptional changes in the brain. Proc. Natl Acad. Sci. USA 99:1553615541.
[Abstract/Free Full Text] - Ballestar E., Ropero S., Alaminos M., Armstrong J., Setien F., Agrelo R., Fraga M.F., Herranz M., Avila S., Pineda M., et al. (2005) The impact of MECP2 mutations in the expression patterns of Rett syndrome patients. Hum. Genet. 116:91104.[CrossRef][ISI][Medline]
-
Nuber U.A., Kriaucionis S., Roloff T.C., Guy J., Selfridge J., Steinhoff C., Schulz R., Lipkowitz B., Ropers H.H., Holmes M.C., et al. (2005) Up-regulation of glucocorticoid-regulated genes in a mouse model of Rett syndrome. Hum. Mol. Genet. 14:22472256.
[Abstract/Free Full Text] - Razin A. and Shemer R. (1999) Epigenetic control of gene expression. Results Probl. Cell Differ. 25:189204.[Medline]
- Balmer D., Arredondo J., Samaco R.C., LaSalle J.M. (2002) MECP2 mutations in Rett syndrome adversely affect lymphocyte growth, but do not affect imprinted gene expression in blood or brain. Hum. Genet. 110:545552.[CrossRef][ISI][Medline]
- Rougeulle C., Glatt H., Lalande M. (1997) The Angelman syndrome candidate gene, UBE3A/E6-AP, is imprinted in brain. Nat. Genet. 17:1415.[CrossRef][ISI][Medline]
- Vu T.H. and Hoffman A.R. (1997) Imprinting of the Angelman syndrome gene, UBE3A, is restricted to brain. Nat. Genet. 17:1213.[CrossRef][ISI][Medline]
- Rougeulle C., Cardoso C., Fontes M., Colleaux L., Lalande M. (1998) An imprinted antisense RNA overlaps UBE3A and a second maternally expressed transcript. Nat. Genet. 19:1516.[ISI][Medline]
-
Runte M., Huttenhofer A., Gross S., Kiefmann M., Horsthemke B., Buiting K. (2001) The IC-SNURF-SNRPN transcript serves as a host for multiple small nucleolar RNA species and as an antisense RNA for UBE3A. Hum. Mol. Genet. 10:26872700.
[Abstract/Free Full Text] - Chamberlain S.J. and Brannan C.I. (2001) The PraderWilli syndrome imprinting center activates the paternally expressed murine Ube3a antisense transcript but represses paternal Ube3a. Genomics 73:316322.[CrossRef][ISI][Medline]
-
Yamasaki K., Joh K., Ohta T., Masuzaki H., Ishimaru T., Mukai T., Niikawa N., Ogawa M., Wagstaff J., Kishino T. (2003) Neurons but not glial cells show reciprocal imprinting of sense and antisense transcripts of Ube3a. Hum. Mol. Genet. 12:837847.
[Abstract/Free Full Text] -
Johnstone K.A., DuBose A.J., Futtner C.R., Elmore M.D., Brannan C.I., Resnick J.L. (2006) A human imprinting centre demonstrates conserved acquisition but diverged maintenance of imprinting in a mouse model for Angelman syndrome imprinting defects. Hum. Mol. Genet. 15:393404.
[Abstract/Free Full Text] -
Samaco R.C., Hogart A., LaSalle J.M. (2005) Epigenetic overlap in autism-spectrum neurodevelopmental disorders: MECP2 deficiency causes reduced expression of UBE3A and GABRB3. Hum. Mol. Genet. 14:483492.
[Abstract/Free Full Text] - Chen R.Z., Akbarian S., Tudor M., Jaenisch R. (2001) Deficiency of methyl-CpG binding protein-2 in CNS neurons results in a Rett-like phenotype in mice. Nat. Genet. 27:327331.[CrossRef][ISI][Medline]
- Guy J., Hendrich B., Holmes M., Martin J.E., Bird A. (2001) A mouse Mecp2-null mutation causes neurological symptoms that mimic Rett syndrome. Nat. Genet. 27:322326.[CrossRef][ISI][Medline]
-
Makedonski K., Abuhatzira L., Kaufman Y., Razin A., Shemer R. (2005) MeCP2 deficiency in Rett syndrome causes epigenetic aberrations at the PWS/AS imprinting center that affects UBE3A expression. Hum. Mol. Genet. 14:10491058.
[Abstract/Free Full Text] - Jiang Y.H., Armstrong D., Albrecht U., Atkins C.M., Noebels J.L., Eichele G., Sweatt J.D., Beaudet A.L. (1998) Mutation of the Angelman ubiquitin ligase in mice causes increased cytoplasmic p53 and deficits of contextual learning and long-term potentiation. Neuron 21:799811.[CrossRef][ISI][Medline]
-
Tsai T.F., Jiang Y.H., Bressler J., Armstrong D., Beaudet A.L. (1999) Paternal deletion from Snrpn to Ube3a in the mouse causes hypotonia, growth retardation and partial lethality and provides evidence for a gene contributing to PraderWilli syndrome. Hum. Mol. Genet. 8:13571364.
[Abstract/Free Full Text] -
Landers M., Calciano M.A., Colosi D., Glatt-Deeley H., Wagstaff J., Lalande M. (2005) Maternal disruption of Ube3a leads to increased expression of Ube3a-ATS in trans. Nucleic Acids Res. 33:39763984.
[Abstract/Free Full Text] - Vandesompele J., De Preter K., Pattyn F., Poppe B., Van Roy N., De Paepe A., Speleman F. (2002) Accurate normalization of real-time quantitative RTPCR data by geometric averaging of multiple internal control genes. Genome Biol. 3:research0034.10034.117.
- Albrecht U., Sutcliffe J.S., Cattanach B.M., Beechey C.V., Armstrong D., Eichele G., Beaudet A.L. (1997) Imprinted expression of the murine Angelman syndrome gene, Ube3a, in hippocampal and Purkinje neurons. Nat. Genet. 17:7578.[CrossRef][ISI][Medline]
-
Samaco R.C., Nagarajan R.P., Braunschweig D., LaSalle J.M. (2004) Multiple pathways regulate MeCP2 expression in normal brain development and exhibit defects in autism-spectrum disorders. Hum. Mol. Genet. 13:629639.
[Abstract/Free Full Text] -
Li J.Z., Vawter M.P., Walsh D.M., Tomita H., Evans S.J., Choudary P.V., Lopez J.F., Avelar A., Shokoohi V., Chung T., et al. (2004) Systematic changes in gene expression in postmortem human brains associated with tissue pH and terminal medical conditions. Hum. Mol. Genet. 13:609616.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
A. Hogart, R. P. Nagarajan, K. A. Patzel, D. H. Yasui, and J. M. LaSalle 15q11-13 GABAA receptor genes are normally biallelically expressed in brain yet are subject to epigenetic dysregulation in autism-spectrum disorders Hum. Mol. Genet., March 15, 2007; 16(6): 691 - 703. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Giacometti, S. Luikenhuis, C. Beard, and R. Jaenisch Partial rescue of MeCP2 deficiency by postnatal activation of MeCP2 PNAS, February 6, 2007; 104(6): 1931 - 1936. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




