Skip Navigation


Human Molecular Genetics Advance Access originally published online on June 20, 2006
Human Molecular Genetics 2006 15(15):2324-2334; doi:10.1093/hmg/ddl158
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
15/15/2324    most recent
ddl158v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (34)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Costa, Y.
Right arrow Articles by Cooke, H. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Costa, Y.
Right arrow Articles by Cooke, H. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Mouse MAELSTROM: the link between meiotic silencing of unsynapsed chromatin and microRNA pathway?

Yael Costa1, Robert M. Speed1, Philippe Gautier1, Colin A. Semple1, Klio Maratou1,{dagger}, James M.A. Turner2 and Howard J. Cooke1,*

1 MRC Human Genetics Unit, Western General Hospital, Crewe Road, Edinburgh EH4 2XU, UK and 2 Division of Stem Cell Research and Developmental Genetics, MRC National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, UK

* To whom correspondence should be addressed. Tel: +44 1313322471; Fax: +44 1314678456; Email: howard.cooke{at}hgu.mrc.ac.uk

Received May 11, 2006; Revised June 7, 2006; Accepted June 16, 2006


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Meiotic silencing of unsynapsed chromatin (MSUC) is a key mechanism in spermatogenesis and a model system to study the dynamics of gene silencing. Here we show that MAEL, the ortholog of Drosophila's high mobility group box protein Maelstrom, is associated not only with the silenced XY body, but also with unsynapsed autosomes. Characterization of MAEL revealed that it interacts directly with the chromatin remodeler SNF5/INI1 and chromatin-associated protein SIN3B, which we also find localized to the XY body. This is the first time that a chromatin remodeler has been shown to associate with whole chromosomes. In addition, we show that MAEL is a component of the mouse meiotic nuage and its haploid cell counterpart, the chromatoid body. This is a site of accumulation of RNA and RNA processing enzymes, including proteins involved in the microRNA (miRNA) pathway. Furthermore, in the nuage, MAEL is present in a complex with germ cell specific MVH, an RNA helicase and Argonaute family members, MILI and MIWI. The presence of MAEL in these critical compartments of male germ cells and its interactions provide a link suggesting the involvement of the miRNA pathway in MSUC.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Meiotic sex chromosome inactivation (MSCI) is a mechanism that achieves transcriptional silencing of the X and Y chromosomes during meiosis. This is reflected in the condensation of the gonosomes to form the XY body, the drastic reduction of transcription of X- and Y-linked genes and the exclusion of RNA polymerase II from their territory (16). Germ cell specific autosomal versions of several genes located on the X chromosome are activated during this period, thus circumventing the problem that would arise from their silencing (69). Besides down-regulation of genes in the gonosomes, other marks of gene silencing, such as underacetylation and hyperdimethylation of lysine 9 on histone H3 (H3-K9), have also been shown in the XY body, specifically in late pachytene (10). Because of the scale at which gene silencing occurs in the XY chromosome pair, this makes it an excellent model to study the sequence of events of the factors involved in the process.

Several proteins have been reported to localize or to be enriched in the XY body, including XMR, BRCA1, ATR and other modified form of histones such as ubiquitinated H2A and phosphorylated H2AX ({gamma}H2AX) (1114). However, despite this knowledge, the biological role of MSCI is still only hypothesized. Originally, it was believed that inactivation of the sex chromosomes would be silencing genes that would be detrimental for male meiosis (15), but no evidence for this has ever been obtained. Another hypothesis proposed that silencing of the X and Y chromosomes is a mechanism of camouflaging the unpaired regions of the X and the Y in the XY body, preventing them from activating the pachytene checkpoint that would be monitoring pairing of autosomal homologous chromosomes (16). A third possibility suggested that heterochromatinization of the gonosomes may help them to achieve synapsis between the pseudo-autosomal regions during early pachytene (17). More recently, association of BRCA1, ATR and {gamma}H2AX was described not only with the XY body but also with the unsynapsed autosomes (18). This indicates that a broader mechanism of meiotic silencing of unsynapsed chromatin (MSUC) could be occurring. Through MSUC, asynapsis could be inducing meiotic arrest by silencing genes essential to progression of meiosis (18). This has parallels with the meiotic silencing by unpaired DNA (MSUD) found in Neurospora crassa in which unpaired DNA induces silencing of all homologous sequences during meiosis (19). In the case of Neurospora, mutations suppressing this mechanism have been related to a gene encoding a putative RNA-dependent RNA polymerase sad-1 and an Argonaute-like protein Sms-2 (1921). Importantly, genes required for RNA interference (RNAi) and isolated from different organisms include an RNA-dependent RNA-polymerase and several members of the Argonaute gene family (22,23).

The RNAi pathway component Dicer and Argonaute family member MIWI have recently been localized to the chromatoid body of haploid cells, as have microRNAs (miRNAs), which are generated by this pathway (24). The chromatoid body is a perinuclear granule present in round spermatids and is a putative analog of the Drosophila nuage structure (25). The analogy is based in part on the presence of mouse Vasa homolog (MVH) in the chromatoid body and Vasa in the nuage (2628). Perinuclear granules are already observed earlier in meiosis and represent a form of mammalian nuage (25). The chromatoid body is highly mobile and it has been suggested to accumulate mRNAs by moving around the nuclear envelope and associating with nuclear pores (29). It also transits through the intracellular bridges between spermatids and could play a role in ensuring a uniform mRNA population in the cytoplasm of these haploid cells (30). Other components of the chromatoid body include Tudor domain containing protein TDRD1, snRNPs and hnRNPs (3133).

Here, we describe the characterization of mouse MAELSTROM (MAEL), a novel protein that was identified in a microarray-based approach to search for novel genes expressed in meiosis (34). MAEL localizes to the nuage/chromatoid body and to unsynapsed chromosomes in the spermatocyte nucleus. This includes the X and Y chromosomes and unsynapsed autosomes. In addition, we demonstrate that it interacts with chromatin remodeler SNF5 (also known as INI1) and chromatin-associated protein SIN3B, which we found to be enriched in the XY body. This is the first time that these proteins have been shown to associate with whole chromosome territories rather than gene promoters in particular. Moreover, MAEL interacts with the putative miRNA pathway components MVH and Argonaute family members MILI and MIWI. These results, coupled with the observation that in Drosophila Maelstrom shuttles between the nucleus and the cytoplasm (35), suggests a link between RNAi and MSUC.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Identification of mouse Maelstrom ortholog
We identified the mouse Maelstrom ortholog (Mael) in a microarray-based expression profiling of the first wave of mouse spermatogenesis. Wild-type and Dazlhgutm1/hgutm1 mice testis gene expression was compared using a cDNA microarray prepared from a normalized and subtracted testis library (34,36). Outbred Dazlhgutm1/hgutm1 mice are infertile with cells not progressing beyond the leptotene stage of meiosis (37). Genes that showed increasing levels of expression during testis development at days 7 and 11 postpartum in the wild-type but not in the Dazlhgutm1/hgutm1 mutant were selected and from these, those frequently represented as testis-expressed sequence tags (ESTs) in database searches and of unassigned function were further selected. Mael (GenBank accession no. 29748050) belonged to this subset of genes.

When a multiple tissue northern blot was hybridized with a Mael cDNA probe, only one transcript of ~1.7 kb was detected in testis (Fig. 1A). When more detailed analysis of gene expression was performed by RNA in situ hybridization, we found that Mael mRNA was present in spermatocytes and round and early elongating spermatids (Fig. 1B–E).


Figure 1581
View larger version (110K):
[in this window]
[in a new window]
 
Figure 1. Tissue and cellular distribution of Mael. (A) Northern blot assay of polyadenylated RNA from mouse tissues. The blots were initially hybridized with a cDNA probe for Mael, then stripped and re-hybridized with a cDNA probe for S26 ribosomal protein mRNA (72), the loading control. (BF) Localization of Mael transcripts in adult mouse testis by RNA in situ hybridization. Hybridization signals are represented by the purple staining and can be detected in spermatocytes [white arrowhead in (D and E)], round [black arrowheads in (D)] and early elongating spermatids [black arrowhead in (C)]. Boxed area in (B) is shown in higher magnification in (C). Black arrow in (E) indicates a leptotene spermatocyte. Sections hybridized with sense probe show no signal (F). Sections were counterstained with Nuclear fast red. Bars: 100 µm in (B and F); 50 µm in (C); 10 µm in (D) and E.

 
Mael cDNA encodes a 434 amino acid protein with an estimated molecular mass of ~49 kDa. The protein is predicted to be globular, with a high mobility group (HMG) box domain between amino acids 3 and 64 (Supplementary Material, Fig. S1). One or two novel globular domains were also predicted between amino acids 114 and 349, based on ortholog sequences alignment. Putative orthologs were identified by reciprocal BLAST searches in mammals, chicken, frog, sea squirt and mosquito (Supplementary Material, Fig. S1). Reciprocal BLAST searches also found the mouse protein to be the ortholog of a protein described in Drosophila named Maelstrom (35). The N-terminal HMG box domain is not the most conserved region. Conservation is higher in the sequence corresponding to the novel globular domain(s). The presence of an HMG box domain suggested that the MAEL protein could have a nucleic acid binding function.

MAELSTROM is a component of the XY body and the chromatoid body
To assess the protein distribution, we raised antibodies in rabbit and chicken against the C-terminal 14 amino acids. Both antibodies recognized a protein of ~53 kDa and an additional protein of 68 kDa on western blots, with signals being competed by the immunizing peptide (data not shown). When testis sections were incubated with anti-MAEL antibody, staining was found in the nucleus of spermatocytes and cytoplasm of spermatocytes and round and early elongating spermatids (Supplementary Material, Fig. S2A, C and D). The staining in the nucleus of pachytene spermatocytes showed a distinct structural and temporal pattern. As the pachytene stage progressed through meiosis, a specific round shaped region of the nucleus located at the periphery showed increasing staining for MAEL, which could be observed from stage V of the seminiferous epithelial cycle (Supplementary Material, Fig. S2C). This structure seemed likely to be the XY body (also named sex body), which contains the transcriptionally silenced X and Y chromosomes during meiosis. Cytoplasmic aggregates, especially visible in round spermatids as one dark staining focus close to the nuclear envelope could also be detected (Supplementary Material, Fig. S2D). It was possible that these cytoplasmic foci were chromatoid bodies. To confirm the presence of MAEL in the sex body and the chromatoid body, co-localization with XMR and MVH was performed by immunofluorescence of testis sections. XMR is a marker of the sex body, whereas MVH is a known component of the chromatoid body (12,28). As shown in Figure 2A, MAEL co-localizes with XMR in the sex body from mid-pachytene (stage V) onwards. At late pachytene (stage X), however, XMR appears to localize only to part of the region stained by anti-MAEL antibody (Fig. 2B). Staging has been determined according to Russell (38). Localization to the chromatoid body was also confirmed by simultaneous incubation with anti-MVH antibody (Fig. 2C). These results corroborated the RNA in situ hybridization pattern, showing that Mael mRNA and protein are present in the same cell types in the testis. Considering that in Drosophila Mael is present in the nucleus and cytoplasm of germline cells, but especially in the nuage, and that Maelstrom mutants fail to form the karyosome (a heterochromatic structure) during meiosis (35), it is plausible that Mael could have a role in meiotic chromatin condensation, which is associated with heterochromatin formation. Localization of MAEL to the XY body in mouse supports this hypothesis.


Figure 1582
View larger version (117K):
[in this window]
[in a new window]
 
Figure 2. MAEL localizes to the XY body and the chromatoid body. Adult mouse testis sections were co-stained for MAEL (red) and XMR (green) (A and B) or for MAEL (red) and MVH (green) (C). Arrowheads in (C) indicate the chromatoid body. Sections were also stained with DAPI for DNA. Bars: 10 µm in (A and B); 7.5 µm in (C).

 
We also assessed the presence of MAEL during embryonic gonad development. Immunofluorescence of embryonic gonads of both male and female showed that MAELSTROM protein is expressed from day 12.5 postcoitum (pc), although at this stage, protein levels are low (Supplementary Material, Fig. S3A, B, F and G). In the male, from day 12.5 until 14.5 pc, MAEL localizes to the cytoplasm of germ cells, but from days 15.5–16.5 pc, it localizes to the nucleus as well (Supplementary Material, Fig. S3A–E) (data not shown). This distribution remains unchanged at least until birth (data not shown). In the female, MAEL is cytoplasmic in germ cells throughout embryonic gonad development (Supplementary Material, Fig. S3F–J).

MAELSTROM interacts with components of chromatin remodeling complexes and the chromatoid body
To get a better insight into the function of MAEL in the sex and chromatoid bodies, a yeast two-hybrid screen was performed using the full-length sequence of MAELSTROM as bait and a pre-transformed mouse testis library providing the prey (39). Consistent with a role of MAEL in MSCI, we identified SIN3B and SNF5 as interacting proteins. Sin3B is one of two mouse homologs of the Sin3 yeast gene. These represented 3.3 and 7%, respectively, of clones sequenced. SIN3B together with HDAC1 and HDAC2 is part of a co-repressor complex called the Sin3/HDAC complex that also includes RbAp46, RbAp48, SAP30 and SAP18 (40). SIN3B is thought to act as a scaffolding protein by recruiting a range of different proteins such as HDACs and interacting with DNA-binding proteins such as transcription factors. SNF5 is an integral member of all mammalian SWI/SNF complexes (41) and has been shown, together with other components of chromatin remodeling complexes, to interact with the Sin3/HDAC complex (42,43). Other potential interacting proteins detected in this screen were RanBPM (43%) and Trap/TDRD7 (1.6%). RanBPM has been reported to localize to the chromatoid body and to interact with MVH, and Trap/TDRD7 contains tudor domains which have previously been found in proteins of the chromatoid body (44,45). To confirm some of these two hybrid interactions, we have used anti-MAEL antibodies and testis extracts from adult mice in co-immunoprecipitation experiments. These experiments confirmed the interaction between MAEL and chromatin-associated proteins SIN3B and SNF5 (Fig. 3). This is likely to be a direct interaction, given their association in the yeast two-hybrid system. Additionally known components of the chromatoid body, TDRD1 (a Tudor repeat containing protein), MVH and MIWI, were also shown to be partners of MAEL. MILI, another Argonaute family member, which is only expressed until pachytene stage and localizes to perinuclear particles in these cells (46) is another partner of MAEL (Fig. 3). Together, these results confirm the interaction data obtained from the yeast two-hybrid system and conclusively demonstrates that MAEL interacts with two distinct groups of proteins: chromatin remodelers and associated proteins in one hand and RNA metabolism/RNAi pathway components on the other.


Figure 1583
View larger version (75K):
[in this window]
[in a new window]
 
Figure 3. MAEL interacts with chromatin-associated proteins and chromatoid body components. Co-immunoprecipitation of MAEL with SIN3B, SNF5, MVH, TDRD1, MIWI and MILI. Testis extracts were incubated with affinity purified anti-MAEL, with anti-MAEL competed with the immunizing peptide or with the pre-immune serum. Input and immunoprecipitates were analyzed by SDS–PAGE and western blot. Input lane detected with anti- MAEL antibody represents a longer exposure of the same membrane.

 
SIN3B and SNF5 also localize to the sex body
As MAEL has two distinct locations in the cell, the localization of interacting proteins could be confined to one or other site or be present at both sites. Published information for MVH, TDRD1, MIWI and MILI suggests that these proteins form a complex with MAEL only in the meiotic nuage and chromatoid body, as they do not localize to the sex body. SIN3B and SNF5 have not been reported to date in either chromatoid body or sex body. Simultaneous labeling with antibodies directed against XMR and SIN3B showed that this protein was detected in the sex body (Fig. 4A). Immunohistochemistry using precipitative staining detection determined that SIN3B is present in the XY body from at least stage III (data not shown). Co-immunostaining for XMR and SNF5 showed that the latter also localizes to the sex body, although later than SIN3B. SNF5 is detected throughout this structure from stage VIII (Fig. 4B), and from stage IX, it coats the sex body (Fig. 4C and Supplementary movie 1). Besides localizing to the sex body, SIN3B and SNF5 were also prominent in the nucleus of Sertoli cells. We also analyzed the location of these proteins during gonad development. SNF5 is present in the nucleus of both somatic and germ cells in male and female gonads at all time points studied (Supplementary Material, Fig. S4). SIN3B, in males, is present in the nucleus of pre-Sertoli cells (but not other testis somatic cell types) and in the cytoplasm of germ cells, from at least day 12.5 pc until day 18.5 pc (Supplementary Material, Fig. S5A–C). This is an unexpected localization, as SIN3B is a chromatin-associated protein. This is also the case in females as staining, although only found on germ cells, remains cytoplasmic until the onset of the pachytene stage of meiosis, when it becomes nuclear (Supplementary Material, Fig. S5D–F). Overall, SIN3B and SNF5 appear to concentrate in the nucleus or a compartment of the nucleus of germ cells during the pachytene stage of meiosis.


Figure 1584
View larger version (90K):
[in this window]
[in a new window]
 
Figure 4. SNF5 and SIN3B localize to the XY body. Adult mouse testis sections were co-stained for SIN3B (green) and XMR (red) (A) or SNF5 (green) and XMR (red) (B and C). (B) represents a stage VIII tubule and (C) a IX–X tubule. Arrowheads in (A) indicate Sertoli cell nuclei. Sections were also stained for DNA with DAPI. Bars: 5 µm.

 
Other members of chromatin remodeling complexes are excluded from the sex body
SNF5 is an integral member of chromatin remodeling complexes. Other proteins that associate with SNF5 in these complexes in tissue culture systems include BRM, BRG1, BAF155, BAF60 and BAF57, among others (47). Other proteins that have also been shown to associate with remodeling complexes are BRCA1 and protein arginine methyl transferase PRMT5 (42,48). BRCA1 is a known component of the sex body, so we decided to determine the localization of other partners of SNF5 in an attempt to increase our knowledge of other putative partners of MAEL in the sex body. Of the above mentioned, we determined the localization of BRG1, BAF155 and PRMT5, but contrary to our expectations, none of the proteins was enriched in the XY body. Except for DAPI dense regions, they were diffusely distributed in pachytene spermatocyte nuclei until stage VII–VIII but started being excluded from the XY body from then on (data not shown). By late pachytene and diplotene stages, the exclusion of BRG1, BAF155 and PRMT5 is maximal showing that these proteins are probably not involved in processes in the XY body (Fig. 5). This further suggests that the composition of the complex involved in silencing of the gonosomes is different from the complex involved in silencing of specific genes.


Figure 1585
View larger version (105K):
[in this window]
[in a new window]
 
Figure 5. Localization of BRG1, BAF155 and PRMT5 in adult mouse testis. Immunofluorescent double labeling of paraffin sections for XMR (red) and BRG1 (A), BAF155 (B) or PRMT5 (C) (green). Arrowheads highlight reduced levels of BRG1, BAF155 and PRMT5 in the sex body. Sections were also stained for DNA with DAPI. Bars: 10 µm in (A); 5 µm in (B and C).

 
MAEL and SIN3B are present in unsynapsed autosomes
Turner et al. (18) have recently shown that proteins localizing to the sex body, namely BRCA1, ATR and {gamma}H2AX, are also present in other unsynapsed regions of the nucleus, having a general role in the silencing of unsynapsed chromosomes during meiosis (MSUC). This was an important finding and prompted us to test whether the presence of MAEL and interactors was specific to the sex body or whether they are present on unsynapsed regions in general. To do this, we localized MAEL and SIN3B in testis sections of the mice carrying a translocation between chromosomes X and 16–T(X;16) (49). Ideally, meiotic spread preparations are used for these analyses. They have the advantage of displaying all the chromosomes in a single plane. As our anti-MAEL antibody is inefficient in detecting MAEL in spread preparations, we have used testis sections and deconvolution microscopy to produce images which are 2D sections of 3D objects (cells in paraffin sections). The resulting images (Fig. 6) only display part of the 3D chromosome territory, as they represent a single optical section.


Figure 1586
View larger version (69K):
[in this window]
[in a new window]
 
Figure 6. MAEL and SIN3B localize to unsynapsed autosomes. (A) Diagram depicting the karyotype of wild-type and T(X;16) mice. The translocation breakpoints map to the middle of chromosomes X and 16. (BG) T(X;16) mouse testis sections were stained for MAEL or SIN3B (red), chromosome 16 (green) and chromosome X (blue) and deconvolution microscopy performed. Each panel represents a single optical section of a pachytene stage spermatocyte where only part of the chromosomes territories are displayed. (B–D) Diagrams of possible configurations for the bivalents or quadrivalents are displayed on the right of each panel. Chromosome cores are depicted in the diagrams to aid interpretation of synapsis or unsynapsis events, but are not visible in the microscope images, where their arrangement is tri-dimensional rather than bi-dimentional. The black dashed lines in the diagrams are the equivalent to the white dashed lines in the microscope images. The colors in the diagrams relate to the colors in the microscope images (MAEL/SIN3B, pink; chromosome 16, green; chromosome X, blue/lilac; overlap of MAEL/SIN3B and chromosome 16, yellow). When full synapsis of chromosome 16 is achieved, this chromosome territory localizes to the vicinity of the XY body stained by MAEL and SIN3B but does not overlap with it (B and E). In addition, when part of the X chromosome engages in autosynapsis, this is also negative for MAEL and SIN3B (C and F). In the cases when chromosome 16 cannot achieve full synapsis, part of chromosome 16 territory overlaps with the area stained for MAEL and SIN3B (D and G). Dashed lines define limit of area stained for MAEL or SIN3B (B, D, E and G) or areas stained for chromosome 16 territory and MAEL or SIN3B (C and F). Bars: 5 µm.

 
In T(X;16) mice, cells that do not achieve full synapsis of chromosome 16 have BRCA1, ATR and {gamma}H2AX staining in the unsynapsed regions (18). On the contrary, cells that achieve full synapsis of the autosome do not display staining for these proteins outside the gonosome territory. This is also the case for MAEL and SIN3B. Analysis of single optical sections for the presence or absence of co-localization between MAEL or SIN3B and chromosome territories across pachytene stage spermatocytes in T(X;16) testis sections revealed that when full synapsis of chromosome 16 is achieved, MAEL and SIN3B are present only in the X and Y chromosomes (Fig. 6B and E). This represents the majority of the cells, as had previously been reported for BRCA1, ATR and {gamma}H2AX. In cells in which chromosome 16 fully synapses and part of the X chromosome engages in autosynapsis, this part of the X chromosome is also negative for both MAEL and SIN3B staining (Fig. 6C and F). In the cases when chromosome 16 cannot fully synapse, the two proteins are present not only in the XY body but also in the unsynapsed region of the autosome (Fig. 6D and G). These results suggest that MAEL and SIN3B are involved in the silencing of unsynapsed chromatin in general rather than the sex chromatin specifically.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
MAELSTROM is a component of the murine nuage and interacts with putative miRNA pathway components
In Drosophila, Maelstrom is a component of the nuage, visualized as perinuclear granules of electron dense material. Comparable structures are widely found in the animal kingdom, with Vasa, a DEAD box RNA helicase, as common hallmark (2628). In mammals, the nuage structures are not found until primordial germ cells are committed to the germline and are more prominent in meiotic spermatocytes and round spermatids (25,50). Besides MVH, miRNAs and other proteins involved in RNA metabolism have also been identified in the chromatoid body. These include ribonucleoproteins and recently miRNA pathway components Dicer and Argonaute family members Ago2, 3 and the germ cell specific argonaute protein MIWI (24,31,33). Argonaute proteins and miRNAs are also present in P-bodies, and components of the P-body Dcp1a, GW182 and Xrn1 are present in the chromatoid body (24,5153). One view of P-bodies suggests that these are the sites of coupled RNA silencing and degradation and the sharing of components with the chromatoid body imply sharing of functions. Kotaja et al. (24). hypothesize that the chromatoid body through its movements around the nucleus collects miRNA precursors and mRNA for further distribution. The movement of chromatoid bodies through the cytoplasm of intracellular bridges connecting haploid spermatids supports a role in RNA transport (30). In this context, it seems plausible that MAEL has a role in the miRNA-mediated gene expression regulation. MAEL is in the same complex with MVH, which in turn interacts directly with Dicer (24). It also interacts with MIWI, whose human homolog HIWI is another partner of Dicer (54). Furthermore, in Drosophila, the localization of Maelstrom in nuage is dependent on Vasa, Aubergine and Spindle-E and is, in turn, required for localization of Dicer and Argonaute2, the last four genes being components of miRNA/RNAi processing pathways (35). The exact role of MAEL, however, has not been determined, but its localization to unsynapsed chromosomes suggests a mechanism.

MAEL and SIN3B are associated with silenced unpaired chromatin
In mouse, MSUC has been described as a process which involves not only the gonosomes but any unpaired segment of the genome. Through a process in which BRCA1 recruits ATR, histone H2AX is phosphorylated on the unpaired chromatin and RNA polymerase II excluded (18). MAEL accumulates in the XY body from mid-pachytene onwards. It also accumulates in unsynapsed regions of autosomes, as we show in spermatocytes of T(16;X) mice. This distribution mimics that of BRCA1 and ATR suggesting but not proving a role for MAEL in MSUC. Interactions between MAEL and other proteins suggest possible mechanisms at work. MAEL interacts directly with SIN3B, which also accumulates in unsynapsed regions of chromatin. This is a protein without DNA-binding properties that acts in a co-repressor complex by associating with proteins involved in gene silencing (40). These include HDACs. Deacetylation is one of the first marks of gene silencing detected in chromatin being repressed. MAEL also interacts with SNF5, a member of chromatin remodeling complexes. These complexes are thought to use the energy of ATP hydrolysis to alter nucleosome structure (5557). Both SIN3B and SNF5 localize to the sex body, although their timing varies. The first to localize to the XY body is SIN3B at stage III, followed by MAEL at stage V and then finally SNF5 at stage VIII. Given this sequence and the interactions, we hypothesize that SIN3B recruits MAEL to the sex body, which in turn recruits SNF5. SIN3B and SNF5 have been shown to be involved in the silencing of specific genes (5861), but this is the first time they are found associated with whole silenced chromosome territories. In our hypothesis, SIN3B could be effecting its silencing activity in a traditional way, by recruiting HDACs, which will deacetylate chromatin. SNF5 could be acting through its chromatin remodeling activity in the whole gonosomes. However, because SNF5 is mainly concentrated at the periphery of the sex body in later stages of meiosis, appearing to coat it, it could be defining a physical compartment in the nucleus. The composition of the complex that localizes to the sex body is not canonical, as it excludes other common members of chromatin remodeling complexes, such as BRG1, BAF155 and PRMT5. A role of MAEL in chromatin silencing also finds parallels in Drosophila, as Maelstrom mutant oocytes fail to form the karyosome and instead DNA forms variably distended loops and threads (35).

A putative link between MSUC and RNAi?
MSUC in mouse evokes the mechanism that occurs in N. crassa termed MSUD. The latter has been associated with proteins potentially involved in RNAi (1921). RNA-mediated silencing has been demonstrated in several systems. In mammalian cultured somatic cells, localization to pericentromeric chromatin of methylated H3-K9 and HP1, which are marks of silent chromatin and are enriched in the XY body, is abolished by RNase treatment (62). De-repression of centromeric heterochromatin was also demonstrated in Dicer-deficient cells (63). Furthermore, promoter-directed siRNA has been reported to induce gene silencing mediated by DNA and H3-K9 methylation in human cells (64,65). In fission yeast, formation and maintenance of heterochromatin is dependent upon functional RNAi machinery, namely argonaute, dicer and RNA-dependent RNA polymerase (66). Although we have not demonstrated a definitive association between MSUC and the RNAi pathway, we hypothesize that MAEL could be the link that connects them. Research in miRNA biology has uncovered an increasing number of these short RNAs and has produced tissue profiles for them. The testis alone has been shown to contain several (67). miRNAs have recently been demonstrated to accumulate in the chromatoid body. Even more recently, a novel class of germ cell specific small RNA molecules has been found, termed piRNAs, which also interact with MILI and MIWI (68,69). Taking into account that in Drosophila, Mael is known to shuttle between the nucleus and cytoplasm (35), we speculate that in mouse, MAEL may be transporting miRNAs between the nucleus and the nuage. This could be happening either from the nucleus to the nuage, where pre-miRNAs will be processed by Dicer and the Argonaute family proteins, or from the nuage to the nucleus after the processing or may be both. These hypotheses could imply a role for miRNAs in silencing of unsynapsed chromatin that would relate to RNA-mediated silencing mechanisms in Neurospora during meiosis, heterochromatin formation and maintenance in fission yeast and mammalian cells, and X-inactivation (1921,62,66,70,71). miRNA association with the XY body remains to be demonstrated, but the accumulation of RNA in this domain of silenced chromatin has been described (72). Taking our data and the available literature together, we propose that MAEL could be the link between MSUC and the miRNA pathways.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Animal tissue
C57Bl/6 mice were euthanized and immediately dissected to retrieve the testes. For fetal and embryonic material, development was timed from the first observation of a vaginal plug which was taken as day 0.5. T(X;16) mice are maintained on a mixed C129/C3H background.

Northern blots
A multiple tissue mouse northern blot (Ambion) was hybridized sequentially with cDNA probes for Mael and S26 (loading control) (73). Probes were labeled using the Strip-EZ DNA kit (Ambion) and hybridized with ULTRAhyb hybridization buffer (Ambion) according to manufacturer's recommendations. Signals were detected by fluorography.

RNA in situ hybridization
Paraffin sections (8 µm thick) of PFA-fixed 8-week-old mouse testis were hybridized with anti-sense and sense digoxigenin (DIG)-labeled RNA probes that were prepared by in vitro transcription of Mael cDNA fragments (~200 bp) using a DIG RNA labeling kit (Roche). Mael cDNA fragments were amplified adding the T7 and T3 promoter sequences with the primers TAATACGACTCACTATAGGGTTCCACGAGGATTTCG ATTC (upstream) and ATTAACCCTCACTAAAGGGATCCATACGCTTCAAACACC A (downstream). Removal of unincorporated NTPs, enzymes and buffer components of the labeling reaction was performed using a MEGAclear kit (Ambion). Immunohistochemical detection of DIG-labeled RNA was carried out with alkaline phosphatase-conjugated anti-DIG antibody (Roche) and an alkaline phosphatase substrate kit (BCIP/NBT) (Vector Laboratories). Counter-staining was performed with Nuclear fast red. Colorimetric signal was visualized as described below.

Antibodies generation
Antibodies were raised in rabbit and chicken using a synthetic peptide, derived from the MAEL sequence, coupled to keyhole limpet hemocyanin. The peptide used was 421TPQKDGYKPFSSFS434. Antibodies were purified by affinity purification to this peptide immobilized on Sulpholink (Pierce) columns.

Immunohistochemistry
For indirect immunohistochemistry, paraffin sections (8 µm thick) of PFA-fixed 8-week-old mouse testis were incubated in 9% H2O2 in methanol for 30 min, and antigen retrieved by microwave treatment in 10 mM sodium citrate (pH 6.0). Sections were blocked in 20% horse serum in TBS and probed with a rabbit anti-MAEL antibody (1:300 in blocking solution). The signal was revealed using a biotin-conjugated goat anti-rabbit IgG (1:300) (DakoCytomation), followed by StreptAB complex conjugated to horseradish peroxidase and a peroxidase substrate kit (DAB) (DakoCytomation). Sections were counter-stained with hematoxilin and mounted in DPX permanent medium (BDH). For fluorescent immunohistochemistry, antigens were retrieved and sections blocked in 5% goat serum, 3% BSA in PBS–0.1% Tween. Sections were then incubated with primary antibodies and detected with secondary antibodies (Molecular Probes), both diluted in blocking solution. Slides were mounted in Vectashield mounting medium (Vector Laboratories) containing DAPI (100 ng/ml). Primary antibodies used for immunofluorescence: rabbit anti-MAEL (1:300); anti-XMR (1:500) (12); anti-MVH (1:5000) (28); anti-SIN3B (1:100) (AK12, Santa Cruz) (74); anti-SNF5 (1:100) (75); anti-BAF155 (1:100) (47); anti-PRMT5 (1:100) (Upstate) (76); anti-GCNA (1:10) (77); anti-OCT4 (1:100) (C10, Santa Cruz) (78). Secondary antibodies (goat anti-rabbit conjugated to Alexa 488 or Alexa 594, goat anti-IgG1 conjugated to Alexa 594, goat anti-rat conjugated to Alexa 488) were purchased from Molecular Probes and used at a concentration of 1:1000. Slides were visualized using a Zeiss Axioplan 2 microscope (Carl Zeiss) equipped with Ludl filter wheel (Ludl Electronic Products) and Chroma 83000 triple bandpass filter set (Chroma Technology Corp.). Brightfield microscopy was also performed on this microscope. The objectives used were Plan-Neofluar (Carl Zeiss Ltd) of the following magnifications and numerical aperture: 100x/1.30 NA, 63x/1.25 NA, 40x/1.30 NA, 20x/0.50 NA, 10x/0.30 NA. Gray-scale images were collected with a Coolsnap HQ cooled CCD camera (Roper Scientific). In-house scripts written for IPLab (Scanalytics Corp.) were employed for image capture. 3D imaging was performed using a Deltavision RT image restoration microscope system (Applied Precision-Deltavision). This was composed of an Olympus IX71 inverted microscope with Plan Apochromat 60x/1.4 NA Oil objective and equipped with a standard Deltavision filter set, a nanomotion stage (Applied Precision), a Coolsnap HQ CCD camera (Roper Scientific) and a 100 W mercury source. Image acquisition and deconvolution was carried out using SoftWoRx Explorer suite (Applied Precision).

Immunofluorescent in situ hybridization (ImmunoFISH)
Fluorescent immunohistochemistry was performed as described earlier followed by FISH. The FISH protocol has been described elsewhere (79). Whole chromosome 16 and X paints were used either FITC- or biotin-labeled, respectively (Cambio). Signal amplification of biotinylated X paint was performed with streptavidin conjugated to Alexa 647 (1:1000) and biotinylated anti-avidin (1:500) (Vector Laboratories). Thirty-three Z-sections were aquired for each selected field with 0.25 µm steps in a Zeiss Axiovert 200 microscope with Plan-Apochromat 100x/1.40 Oil objective (Carl Zeiss Ltd). The microscope was equipped with a Chroma 86000 Sedat Quad Set filter set (Chroma Technology Corp.), a Lambda LS lamphouse ozone free 300 W lamp (Sutter Inc) and a PZ2000 Motorized Stage (Applied Scientific Instrumentation). Gray-scale images were collected with a Coolsnap HQ cooled CCD camera (Roper Scientific) using IPLab software (Scanalytics Corp.). Each Z-section was individually analyzed for the presence or absence of co-localization between protein and chromosome territories.

Two-hybrid screening
A Matchmaker Two-Hybrid System 3 (Clontech) testis library was screened according to manufacturer's instructions with full-length Mael coding sequence cloned into the pGBKT7 vector (Clontech). The calculated number of plasmids screened was 8x107. Verified interacting plasmids were sequenced using standard techniques.

Co-immunoprecipitation
Co-imunoprecipitation was performed using chicken anti-MAEL antibody and PrecipHen agarose (Aves Labs) according to manufacturer's instructions. Briefly, protein extracts were prepared by homogenizing adult mouse testes in 10 mM Tris, pH 8.0, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 1% iodoacetamide, 1 mM PMSF with Complete protease inhibitor (Roche). After sonication and centrifugation, lysates were incubated with PrecipHen agarose and centrifuged at 10 000g for 10 min. Five micrograms of chicken anti-MAEL antibody was added to 1 mg of extract and incubated overnight at 4°C. Twenty microliters of PrecipHen was added and incubated with gentle agitation for 3 hours. PrecipHen beads were harvested by centrifugation at 10 000g for 2 min and were washed twice in 10 mM Tris, pH 8.0, 150 mM NaCl, 0.1% Triton X-100, twice in 10 mM Tris, pH 8.0, 150 mM NaCl and twice in 50 mM Tris, pH 6.8. Beads were resupended and analyzed by SDS–PAGE and western blot. The following primary antibodies were used for western blot: rabbit anti-MAEL (1:1000); anti-SIN3B (1:500) (80); anti-SNF5 (1:1000); anti-MVH (1:500) (Abcam); anti-TDRD1 (1:1000) (32); anti-Mili/Miwi (1:250) (46). Secondary antibodies were horseradish peroxidase-conjugated (1:10000) and purchased from Sigma.

Orthology
Searches of protein sequences in Swissprot, Trembl and Ensembl, of EST sequences in the sequencing and annotation projects databases of EMBL/Sanger Institute, NCBI and TIGR-identified homologous proteins. Each protein is the best reciprocal BLAST hit of the query protein within the appropriate genome. Sequence alignments were generated with ClustalW and displayed using Boxshade 3.21.


    SUPPLEMENTARY MATERIAL
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Supplementary Material is available at HMG Online.


    ACKNOWLEDGEMENTS
 
We thank Shinichiro Chuma, George Enders, Anthony Imbalzano, Toshiaki Noce, Weidong Wang for the gift of antibodies; Mary Taggart and Paul Perry for assistance with mice stocks and imaging; José Silva and members of the department for helpful discussions. This work was supported by the Medical Research Council and a PRAXIS XXI grant (BD/21802/99) to Y.C.

Conflict of Interest statement. None declared.


    FOOTNOTES
 
{dagger} Present address: Neural Plasticity Unit, Institute of Child Health, 30 Guilford Street, London WC1 N1EH, UK. Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 

  1. Fernandez-Capetillo O., Mahadevaiah S.K., Celeste A., Romanienko P.J., Camerini-Otero R.D., Bonner W.M., Manova K., Burgoyne P., Nussenzweig A. (2003) H2AX is required for chromatin remodeling and inactivation of sex chromosomes in male mouse meiosis. Dev. Cell 4:497–508.[CrossRef][Web of Science][Medline]

  2. Mahadevaiah S.K., Odorisio T., Elliott D.J., Rattigan A., Szot M., Laval S.H., Washburn L.L., McCarrey J.R., Cattanach B.M., Lovell-Badge R., et al. (1998) Mouse homologues of the human AZF candidate gene RBM are expressed in spermatogonia and spermatids, and map to a Y chromosome deletion interval associated with a high incidence of sperm abnormalities. Hum. Mol. Genet. 7:715–727.[Abstract/Free Full Text]

  3. Odorisio T., Mahadevaiah S.K., McCarrey J.R., Burgoyne P.S. (1996) Transcriptional analysis of the candidate spermatogenesis gene Ube1y and of the closely related Ube1x shows that they are coexpressed in spermatogonia and spermatids but are repressed in pachytene spermatocytes. Dev. Biol. 180:336–343.[CrossRef][Web of Science][Medline]

  4. Singer-Sam J., Robinson M.O., Bellve A.R., Simon M.I., Riggs A.D. (1990) Measurement by quantitative PCR of changes in HPRT, PGK-1, PGK-2, APRT, MTase, and Zfy gene transcripts during mouse spermatogenesis. Nucleic Acids Res. 18:1255–1259.[Abstract/Free Full Text]

  5. Solari A.J. (1974) The behavior of the XY pair in mammals. Int. Rev. Cytol. 38:273–317.[Web of Science][Medline]

  6. McKee B.D. and Handel M.A. (1993) Sex chromosomes, recombination, and chromatin conformation. Chromosoma 102:71–80.[CrossRef][Web of Science][Medline]

  7. Bradley J., Baltus A., Skaletsky H., Royce-Tolland M., Dewar K., Page D.C. (2004) An X-to-autosome retrogene is required for spermatogenesis in mice. Nat. Genet. 36:872–876.[CrossRef][Web of Science][Medline]

  8. Elliott D.J., Venables J.P., Newton C.S., Lawson D., Boyle S., Eperon I.C., Cooke H.J. (2000) An evolutionarily conserved germ cell-specific hnRNP is encoded by a retrotransposed gene. Hum. Mol. Genet. 9:2117–2124.[Abstract/Free Full Text]

  9. Rohozinski J. and Bishop C.E. (2004) The mouse juvenile spermatogonial depletion (jsd) phenotype is due to a mutation in the X-derived retrogene, mUtp14b. Proc. Natl Acad. Sci. USA 101:11695–11700.[Abstract/Free Full Text]

  10. Khalil A.M., Boyar F.Z., Driscoll D.J. (2004) Dynamic histone modifications mark sex chromosome inactivation and reactivation during mammalian spermatogenesis. Proc. Natl Acad. Sci. USA 101:16583–16587.[Abstract/Free Full Text]

  11. Baarends W.M., Hoogerbrugge J.W., Roest H.P., Ooms M., Vreeburg J., Hoeijmakers J.H., Grootegoed J.A. (1999) Histone ubiquitination and chromatin remodeling in mouse spermatogenesis. Dev. Biol. 207:322–333.[CrossRef][Web of Science][Medline]

  12. Calenda A., Allenet B., Escalier D., Bach J.F., Garchon H.J. (1994) The meiosis-specific Xmr gene product is homologous to the lymphocyte Xlr protein and is a component of the XY body. EMBO J. 13:100–109.[Web of Science][Medline]

  13. Mahadevaiah S.K., Turner J.M., Baudat F., Rogakou E.P., de Boer P., Blanco-Rodriguez J., Jasin M., Keeney S., Bonner W.M., Burgoyne P.S. (2001) Recombinational DNA double-strand breaks in mice precede synapsis. Nat. Genet. 27:271–276.[CrossRef][Web of Science][Medline]

  14. Turner J.M., Aprelikova O., Xu X., Wang R., Kim S., Chandramouli G.V., Barrett J.C., Burgoyne P.S., Deng C.X. (2004) BRCA1, histone H2AX phosphorylation, and male meiotic sex chromosome inactivation. Curr. Biol. 14:2135–2142.[CrossRef][Web of Science][Medline]

  15. Lifschytz E. and Lindsley D.L. (1972) The role of X-chromosome inactivation during spermatogenesis. Proc. Natl Acad. Sci. USA 69:182–186.[Abstract/Free Full Text]

  16. Jablonka E. and Lamb M.J. (1988) Meiotic pairing constraints and the activity of sex chromosomes. J. Theor. Biol. 133:23–36.[CrossRef][Web of Science][Medline]

  17. Turner J.M., Mahadevaiah S.K., Benavente R., Offenberg H.H., Heyting C., Burgoyne P.S. (2000) Analysis of male meiotic ‘sex body’ proteins during XY female meiosis provides new insights into their functions. Chromosoma 109:426–432.[Web of Science][Medline]

  18. Turner J.M., Mahadevaiah S.K., Fernandez-Capetillo O., Nussenzweig A., Xu X., Deng C.X., Burgoyne P.S. (2005) Silencing of unsynapsed meiotic chromosomes in the mouse. Nat. Genet. 37:41–47.[Web of Science][Medline]

  19. Shiu P.K., Raju N., Zickler D., Metzenberg R.L. (2001) Meiotic Silencing by Unpaired DNA. Cell 107:905–916.[CrossRef][Web of Science][Medline]

  20. Lee D.W., Pratt R.J., McLaughlin M., Aramayo R. (2003) An argonaute-like protein is required for meiotic silencing. Genetics 164:821–828.[Abstract/Free Full Text]

  21. Shiu P.K. and Metzenberg R.L. (2002) Meiotic silencing by unpaired DNA: properties, regulation and suppression. Genetics 161:1483–1495.[Abstract/Free Full Text]

  22. Fagard M., Boutet S., Morel J.B., Bellini C., Vaucheret H. (2000) AGO1, QDE-2 and RDE-1 are related proteins required for post-transcriptional gene silencing in plants, quelling in fungi, and RNA interference in animals. Proc. Natl Acad. Sci. USA 97:11650–11654.[Abstract/Free Full Text]

  23. Hammond S.M., Boettcher S., Caudy A.A., Kobayashi R., Hannon G.J. (2001) Argonaute2, a link between genetic and biochemical analyses of RNAi. Science 293:1146–1150.[Abstract/Free Full Text]

  24. Kotaja N., Bhattacharyya S.N., Jaskiewicz L., Kimmins S., Parvinen M., Filipowicz W., Sassone-Corsi P. (2006) The chromatoid body of male germ cells: similarity with processing bodies and presence of Dicer and microRNA pathway components. Proc. Natl Acad. Sci. USA.

  25. Eddy E.M. (1975) Germ plasm and the differentiation of the germ cell line. Int. Rev. Cytol. 43:229–280.[Web of Science][Medline]

  26. Hay B., Ackerman L., Barbel S., Jan L.Y., Jan Y.N. (1988) Identification of a component of Drosophila polar granules. Development 103:625–640.[Abstract/Free Full Text]

  27. Lasko P.F. and Ashburner M. (1990) Posterior localization of vasa protein correlates with, but is not sufficient for, pole cell development. Genes Dev. 4:905–921.[Abstract/Free Full Text]

  28. Toyooka Y., Tsunekawa N., Takahashi Y., Matsui Y., Satoh M., Noce T. (2000) Expression and intracellular localization of mouse Vasa-homologue protein during germ cell development. Mech. Dev. 93:139–149.[CrossRef][Web of Science][Medline]

  29. Parvinen M. (2005) The chromatoid body in spermatogenesis. Int. J. Androl. 28:189–201.[CrossRef][Web of Science][Medline]

  30. Ventelä S., Toppari J., Parvinen M. (2003) Intercellular organelle traffic through cytoplasmic bridges in early spermatids of the rat: mechanisms of haploid gene product sharing. Mol. Biol. Cell 14:2768–2780.[Abstract/Free Full Text]

  31. Biggiogera M., Von Schack M.L., Martin T.E., Gordon J., Muller M., Fakan S. (1993) Immunoelectron microscope localization of snRNP, hnRNP, and ribosomal proteins in mouse spermatogenesis. Mol. Reprod. Dev. 35:261–271.[CrossRef][Web of Science][Medline]

  32. Chuma S., Hiyoshi M., Yamamoto A., Hosokawa M., Takamune K., Nakatsuji N. (2003) Mouse Tudor repeat-1 (MTR-1) is a novel component of chromatoid bodies/nuages in male germ cells and forms a complex with snRNPs. Mech. Dev. 120:979–990.[CrossRef][Web of Science][Medline]

  33. Moussa F., Oko R., Hermo L. (1994) The immunolocalization of small nuclear ribonucleoprotein particles in testicular cells during the cycle of the seminiferous epithelium of the adult rat. Cell Tissue Res. 278:363–378.[Web of Science][Medline]

  34. Maratou K., Forster T., Costa Y., Taggart M., Speed R., Ireland J., Teague P., Roy D., Cooke H.J. (2004) Expression Profiling of the Developing Testis in Wild-Type and Dazl Knockout Mice. Mol. Reprod. Dev. 67:26–54.[CrossRef][Web of Science][Medline]

  35. Findley S.D., Tamanaha M., Clegg N.J., Ruohola-Baker H. (2003) Maelstrom, a Drosophila spindle-class gene, encodes a protein that colocalizes with Vasa and RDE1/AGO1 homolog, Aubergine, in nuage. Development 130:859–871.[Abstract/Free Full Text]

  36. Ruggiu M., Speed R., Taggart M., McKay S.J., Kilanowski F., Saunders P., Dorin J., Cooke H.J. (1997) The mouse Dazla gene encodes a cytoplasmic protein essential for gametogenesis. Nature 389:73–77.[CrossRef][Medline]

  37. Saunders P.T., Turner J.M., Ruggiu M., Taggart M., Burgoyne P.S., Elliott D., Cooke H.J. (2003) Absence of mDazl produces a final block on germ cell development at meiosis. Reproduction 126:589–597.[Abstract]

  38. Russell L.D. (1990) Histological and Histopathological Evaluation of the Testis (Cache River Press, Bolesta).

  39. Chien C.T., Bartel P.L., Sternglanz R., Fields S. (1991) The two-hybrid system: a method to identify and clone genes for proteins that interact with a protein of interest. Proc. Natl Acad. Sci. USA 88:9578–9582.[Abstract/Free Full Text]

  40. Silverstein R.A. and Ekwall K. (2004) Sin3: a flexible regulator of global gene expression and genome stability. Curr. Genet. 47:1–17.[Medline]

  41. Muchardt C. and Yaniv M. (2001) When the SWI/SNF complex remodels the cell cycle. Oncogene 20:3067–3075.[CrossRef][Web of Science][Medline]

  42. Pal S., Yun R., Datta A., Lacomis L., Erdjument-Bromage H., Kumar J., Tempst P., Sif S. (2003) mSin3A/histone deacetylase 2- and PRMT5-containing Brg1 complex is involved in transcriptional repression of the Myc target gene cad. Mol. Cell. Biol. 23:7475–7487.[Abstract/Free Full Text]

  43. Sif S., Saurin A.J., Imbalzano A.N., Kingston R.E. (2001) Purification and characterization of mSin3A-containing Brg1 and hBrm chromatin remodeling complexes. Genes Dev. 15:603–618.[Abstract/Free Full Text]

  44. Hirose T., Kawabuchi M., Tamaru T., Okumura N., Nagai K., Okada M. (2000) Identification of tudor repeat associator with PCTAIRE 2 (Trap). A novel protein that interacts with the N-terminal domain of PCTAIRE 2 in rat brain. Eur. J. Biochem. 267:2113–2121.[Web of Science][Medline]

  45. Shibata N., Tsunekawa N., Okamoto-Ito S., Akasu R., Tokumasu A., Noce T. (2004) Mouse RanBPM is a partner gene to a germline specific RNA helicase, mouse vasa homolog protein. Mol. Reprod. Dev. 67:1–7.[CrossRef][Web of Science][Medline]

  46. Kuramochi-Miyagawa S., Kimura T., Ijiri T.W., Isobe T., Asada N., Fujita Y., Ikawa M., Iwai N., Okabe M., Deng W., et al. (2004) Mili, a mammalian member of piwi family gene, is essential for spermatogenesis. Development 131:839–849.[Abstract/Free Full Text]

  47. Wang W., Cote J., Xue Y., Zhou S., Khavari P.A., Biggar S.R., Muchardt C., Kalpana G.V., Goff S.P., Yaniv M., et al. (1996) Purification and biochemical heterogeneity of the mammalian SWI-SNF complex. EMBO J. 15:5370–5382.[Web of Science][Medline]

  48. Bochar D.A., Wang L., Beniya H., Kinev A., Xue Y., Lane W.S., Wang W., Kashanchi F., Shiekhattar R. (2000) BRCA1 is associated with a human SWI/SNF-related complex: linking chromatin remodeling to breast cancer. Cell 102:257–265.[CrossRef][Web of Science][Medline]

  49. Ford C.E. and Evans E.P. (1964) A reciprocal translocation in the mouse between the X chromosome and a short autosome. Cytogenetics 15:295–305.[Medline]

  50. Fawcett D.W., Eddy E.M., Phillips D.M. (1970) Observations on the fine structure and relationships of the chromatoid body in mammalian spermatogenesis. Biol. Reprod. 2:129–153.[Medline]

  51. Liu J., Valencia-Sanchez M.A., Hannon G.J., Parker R. (2005) MicroRNA-dependent localization of targeted mRNAs to mammalian P-bodies. Nat. Cell Biol. 7:719–723.[CrossRef][Web of Science][Medline]

  52. Pillai R.S., Bhattacharyya S.N., Artus C.G., Zoller T., Cougot N., Basyuk E., Bertrand E., Filipowicz W. (2005) Inhibition of translational initiation by Let-7 MicroRNA in human cells. Science 309:1573–1576.[Abstract/Free Full Text]

  53. Sen G.L. and Blau H.M. (2005) Argonaute 2/RISC resides in sites of mammalian mRNA decay known as cytoplasmic bodies. Nat. Cell Biol. 7:633–636.[CrossRef][Web of Science][Medline]

  54. Tahbaz N., Kolb F.A., Zhang H., Jaronczyk K., Filipowicz W., Hobman T.C. (2004) Characterization of the interactions between mammalian PAZ PIWI domain proteins and Dicer. EMBO Rep. 5:189–194.[CrossRef][Web of Science][Medline]

  55. Becker P.B. and Horz W. (2002) ATP-dependent nucleosome remodeling. Annu. Rev. Biochem. 71:247–273.[CrossRef][Web of Science][Medline]

  56. Becker P.B. (2002) Nucleosome sliding: facts and fiction. EMBO J. 21:4749–4753.[CrossRef][Web of Science][Medline]

  57. Narlikar G.J., Fan H.Y., Kingston R.E. (2002) Cooperation between complexes that regulate chromatin structure and transcription. Cell 108:475–487.[CrossRef][Web of Science][Medline]

  58. Kang H., Cui K., Zhao K. (2004) BRG1 controls the activity of the retinoblastoma protein via regulation of p21CIP1/WAF1/SDI. Mol. Cell. Biol. 24:1188–1199.[Abstract/Free Full Text]

  59. Pan X., Zhai L., Sun R., Li X., Zeng X. (2005) INI1/hSNF5/BAF47 represses c-fos transcription via a histone deacetylase-dependent manner. Biochem. Biophys. Res. Commun. 337:1052–1058.[CrossRef][Web of Science][Medline]

  60. Rampalli S., Pavithra L., Bhatt A., Kundu T.K., Chattopadhyay S. (2005) Tumor suppressor SMAR1 mediates cyclin D1 repression by recruitment of the SIN3/histone deacetylase 1 complex. Mol. Cell. Biol. 25:8415–8429.[Abstract/Free Full Text]

  61. Rayman J.B., Takahashi Y., Indjeian V.B., Dannenberg J.H., Catchpole S., Watson R.J., te Riele H., Dynlacht B.D. (2002) E2F mediates cell cycle-dependent transcriptional repression in vivo by recruitment of an HDAC1/mSin3B corepressor complex. Genes Dev. 16:933–947.[Abstract/Free Full Text]

  62. Maison C., Bailly D., Peters A.H., Quivy J.P., Roche D., Taddei A., Lachner M., Jenuwein T., Almouzni G. (2002) Higher-order structure in pericentric heterochromatin involves a distinct pattern of histone modification and an RNA component. Nat. Genet. 30:329–334.[CrossRef][Web of Science][Medline]

  63. Fukagawa T., Nogami M., Yoshikawa M., Ikeno M., Okazaki T., Takami Y., Nakayama T., Oshimura M. (2004) Dicer is essential for formation of the heterochromatin structure in vertebrate cells. Nat. Cell Biol. 6:784–791.[CrossRef][Web of Science][Medline]

  64. Kawasaki H. and Taira K. (2004) Induction of DNA methylation and gene silencing by short interfering RNAs in human cells. Nature 431:211–217.[CrossRef][Medline]

  65. Morris K.V., Chan S.W., Jacobsen S.E., Looney D.J. (2004) Small interfering RNA-induced transcriptional gene silencing in human cells. Science 305:1289–1292.[Abstract/Free Full Text]

  66. Volpe T.A., Kidner C., Hall I.M., Teng G., Grewal S.I., Martienssen R.A. (2002) Regulation of heterochromatic silencing and histone H3 lysine-9 methylation by RNAi. Science 297:1833–1837.[Abstract/Free Full Text]

  67. Lagos-Quintana M., Rauhut R., Meyer J., Borkhardt A., Tuschl T. (2003) New microRNAs from mouse and human. RNA 9:175–179.[Abstract/Free Full Text]

  68. Aravin A., Gaidatzis D., Pfeffer S., Lagos-Quintana M., Landgraf P., Iovino N., Morris P., Brownstein M.J., Kuramochi-Miyagawa S., Nakano T., et al. (2006) A novel class of small RNAs bind to MILI protein in mouse testes. Nature 10.1038/nature04916.

  69. Girard A.I., Sachidanandam R., Hannon G.J., Carmell M.A. (2006) A germline-specific class of small RNAs binds mammalian Piwi proteins. Nature 10.1038/nature04917.

  70. Silva J., Mak W., Zvetkova I., Appanah R., Nesterova T.B., Webster Z., Peters A.H., Jenuwein T., Otte A.P., Brockdorff N. (2003) Establishment of histone h3 methylation on the inactive X chromosome requires transient recruitment of Eed-Enx1 polycomb group complexes. Dev. Cell 4:481–495.[CrossRef][Web of Science][Medline]

  71. Wutz A. and Jaenisch R. (2000) A shift from reversible to irreversible X inactivation is triggered during ES cell differentiation. Mol. Cell 5:695–705.[CrossRef][Web of Science][Medline]

  72. Escalier D. and Garchon H.J. (2005) XMR, a dual location protein in the XY pair and in its associated nucleolus in mouse spermatocytes. Mol. Reprod. Dev. 72:105–112.[CrossRef][Web of Science][Medline]

  73. Vincent S., Marty L., Fort P. (1993) S26 ribosomal protein RNA: an invariant control for gene regulation experiments in eucaryotic cells and tissues. Nucleic Acids Res. 21:1498.[Free Full Text]

  74. Chadwick B.P. and Willard H.F. (2003) Chromatin of the Barr body: histone and non-histone proteins associated with or excluded from the inactive X chromosome. Hum. Mol. Genet. 12:2167–2178.[Abstract/Free Full Text]

  75. de la Serna I., Carlson K.A., Hill D.A., Guidi C.J., Stephenson R.O., Sif S., Kingston R.E., Imbalzano A.N. (2000) Mammalian SWI–SNF complexes contribute to activation of the hsp70 gene. Mol. Cell. Biol. 20:2839–2851.[Abstract/Free Full Text]

  76. Richard S., Morel M., Cleroux P. (2005) Arginine methylation regulates IL-2 gene expression: a role for protein arginine methyltransferase 5 (PRMT5). Biochem. J. 388:379–386.[CrossRef][Web of Science][Medline]

  77. Enders G.C. and May J.J. (1994) Developmentally regulated expression of a mouse germ cell nuclear antigen examined from embryonic day 11 to adult in male and female mice. Dev. Biol. 163:331–340.[CrossRef][Web of Science][Medline]

  78. Avilion A.A., Nicolis S.K., Pevny L.H., Perez L., Vivian N., Lovell-Badge R. (2003) Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev. 17:126–140.[Abstract/Free Full Text]

  79. Macpherson H., Keir P., Webb S., Samuel K., Boyle S., Bickmore W., Forrester L., Dorin J. (2005) Bone marrow-derived SP cells can contribute to the respiratory tract of mice in vivo. J. Cell Sci. 118:2441–2450.[Abstract/Free Full Text]

  80. Yang L., Mei Q., Zielinska-Kwiatkowska A., Matsui Y., Blackburn M.L., Benedetti D., Krumm A.A., Taborsky G.J. Jr, Chansky H.A. (2003) An ERG (ets-related gene)-associated histone methyltransferase interacts with histone deacetylases 1/2 and transcription co-repressors mSin3A/B. Biochem. J. 369:651–657.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
GENES CELLSHome page
K. Kojima, S. Kuramochi-Miyagawa, S. Chuma, T. Tanaka, N. Nakatsuji, T. Kimura, and T. Nakano
Associations between PIWI proteins and TDRD1/MTR-1 are critical for integrated subcellular localization in murine male germ cells
Genes Cells, October 1, 2009; 14(10): 1155 - 1165.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
D. Homolka, R. Ivanek, J. Capkova, P. Jansa, and J. Forejt
Chromosomal rearrangement interferes with meiotic X chromosome inactivation
Genome Res., October 1, 2007; 17(10): 1431 - 1437.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
T. D. Gallardo, G. B. John, L. Shirley, C. M. Contreras, E. A. Akbay, J. M. Haynie, S. E. Ward, M. J. Shidler, and D. H. Castrillon
Genomewide Discovery and Classification of Candidate Ovarian Fertility Genes in the Mouse
Genetics, September 1, 2007; 177(1): 179 - 194.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. M. A. Turner
Meiotic sex chromosome inactivation
Development, May 15, 2007; 134(10): 1823 - 1831.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. K. Lim and T. Kai
Unique germ-line organelle, nuage, functions to repress selfish genetic elements in Drosophila melanogaster
PNAS, April 17, 2007; 104(16): 6714 - 6719.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
E. Bolcun-Filas, Y. Costa, R. Speed, M. Taggart, R. Benavente, D. G De Rooij, and H. J Cooke
SYCE2 is required for synaptonemal complex assembly, double strand break repair, and homologous recombination
J. Cell Biol., March 12, 2007; 176(6): 741 - 747.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
B. Furnes and J. Schimenti
Fast forward to new genes in mammalian reproduction
J. Physiol., January 1, 2007; 578(1): 25 - 32.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
15/15/2324    most recent
ddl158v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (34)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Costa, Y.
Right arrow Articles by Cooke, H. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Costa, Y.
Right arrow Articles by Cooke, H. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?