Human Molecular Genetics Advance Access originally published online on August 7, 2006
Human Molecular Genetics 2006 15(19):2837-2845; doi:10.1093/hmg/ddl208
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Neurofibromin plays a critical role in modulating osteoblast differentiation of mesenchymal stem/progenitor cells
1 Department of Pediatrics, 2 Department of Biochemistry and Molecular Biology, 3 Department of Medicine/Biostatistics and 4 Herman B. Wells Center for Pediatric Research and Indiana University School of Medicine, Cancer Research Institute, 1044 W. Walnut Street, R4/427 Indianapolis, IN 46202, USA
* To whom correspondence should be addressed. Tel: +1 3172744178; Fax: +1 3172748679; Email: fyang{at}iupui.edu
Received May 30, 2006; Accepted July 29, 2006
| ABSTRACT |
|---|
|
|
|---|
Mutations in the NF1 tumor suppressor gene cause neurofibromatosis type 1, a pandemic autosomal dominant genetic disorder with an incidence of 1:3000. Individuals with NF1 have a variety of malignant and non-malignant manifestations, including skeletal manifestations, such as osteoporosis, scoliosis and short statures. However, the mechanism(s) underlying the osseous manifestations in NF1 are poorly understood. In the present study, utilizing Nf1 haploinsufficient (+/) mice, we demonstrate that Nf1+/ mesenchymal stem/progenitor cells (MSPC) have increased proliferation and colony forming unit-fibroblast (CFU-F) capacity compared with wild-type (WT) MSPC. Nf1+/ MSPC also have fewer senescent cells and have a significantly higher telomerase activity compared with WT MSPC. Nf1+/ MSPC have impaired osteoblast differentiation as determined by alkaline phosphatase staining, and confirmed by single CFU-F replating assays. The impaired osteoblast differentiation in Nf1+/ MSPC is consistent with the reduced expression of osteoblast markers at the mRNA level, including osteocalcin and osteonectin. Importantly, re-expression of the full-length NF1 GTPase activating related domain (NF1 GAP-related domain) is sufficient to restore the impaired osteoblast differentiation in Nf1+/ MSPC. Taken together, our results suggest that neurofibromin plays a crucial role in modulating MSPC differentiation into osteoblasts, and the defect in osteoblast differentiation may contribute at least in part to the osseous abnormalities seen in individuals with NF1.
| INTRODUCTION |
|---|
|
|
|---|
Neurofibromatosis type I (NF1) is a common autosomal dominant genetic disorder with a prevalence of 1 in 3000 individuals worldwide (1,2). NF1 occurs as a consequence of mutations in the NF1 tumor suppressor gene, which encodes the Ras-GTPase activating protein (Ras-GAP), neurofibromin. Neurofibromin functions as a molecular switch that negatively regulates the activation of p21Ras proteins by accelerating intrinsic Ras-guanosine triphosphate (GTP) activity to the inactive Ras-guanosine dephosphate (GDP) state. Ras is at the apex of multiple signaling pathways, including the MEK/ERK and PI3-K pathways, which modulate multiple cellular functions, such as cell proliferation, differentiation and survival (3,4).
NF1 functions as a GTPase in mesothelial-derived tissues including fibroblasts (5,6) and osteoprogenitor cells (7), which are relevant to skeletal development. Individuals with NF1 suffer from a variety of non-malignant, debilitating manifestations, including café-au-lait macules, benign cutaneous neurofibromas and learning disabilities (8,9). In addition, up to 50% of NF1 patients suffer from a variety of skeletal manifestations, including short stature, osteoporosis, pseudoarthrosis of the tibia, kyphoscoliosis and sphenoid wing dysplasia (1014). Recent clinical studies provide evidence that individuals with NF1 are at significant risk for both generalized (13,1517) and focal skeletal abnormalities (16,18), and suggest that the pathogenesis of the osseous manifestations in NF1 may involve impaired development of the skeletal system and impaired maintenance of bone structure (13). Although precise pathology underlying the localized skeletal abnormalities is incompletely understood, surgical attempts to repair these focal skeletal abnormalities often fail due to non-union and/or pseudoarthrosis of the healing bones. Although clinical observations provide support to suggest that generalized mechanisms regulating the generation and remodeling of bone are impaired.
Functional defects in differentiated bone cells or impairment in the self-renewing osteoprogenitor cells may underlie the cause of abnormal bone development, fragility and lowered fracture threshold in the adult skeleton due to perturbations in key biochemical signaling pathways required to maintain bone competence in NF1 (19). In some human diseases and murine disease models with similar skeletal manifestations as NF1, defects in osteoprogenitor proliferation as well as osteoblast differentiation and function are frequently observed (7,20). Osteoblasts originate from pluripotent mesenchymal stem/progenitor cells (MSPC) of the bone marrow (21,22). MSPC are multipotent stem cells that have the ability to give rise to a variety of mesoderm-derived cells, including osteoblasts, chondrocytes, adipocytes and muscle cells. Studies by Horwitz et al. have shown that allogeneic mesenchymal cells offer feasible post-transplantation therapy for osteogenesis imperfecta and likely other disorders originating in mesenchymal precursors (23,24).
Recent insights into the normal physiology of bone formation and remodeling, the development of murine models of NF1 and an increasing understanding of the potential cellular effects of haploinsufficiency of NF1, facilitate a detailed evaluation of the pathological mechanisms underlying skeletal disease in NF1. In the present study, utilizing cells derived from Nf1+/ mice, we investigated the role of neurofibromin in regulating the differentiation of MSPC into osteoblast and chondrocyte lineages. Our study indicates that haploinsufficiency of Nf1 in MSPC leads to impaired osteoblast differentiation. The deficiency in osteoblast differentiation reported herein in part is responsible for the osseous abnormalities observed in NF1 patients.
| RESULTS |
|---|
|
|
|---|
Nf1+/ mice have increased colony forming unit-fibroblast (CFU-F)
To examine whether MSPC express neurofibromin, western blot was performed to check the protein level of neurofibromin. MSPC from WT cultures demonstrate neurofibromin expression (Fig. 1A). In contrast, a significant reduction of neurofibromin expression was observed in Nf1+/ MSPC. We next evaluated the frequency of Nf1+/ MSPC in bone marrow by CFU-F assays. A 2-fold increase in the frequency and total number of Nf1+/ CFU-F was observed compared with WT controls (Fig. 1B and C). Consistently higher numbers of CFU-F were seen over a range of input cells from Nf1+/ mice compared with WT controls as shown quantitatively (Fig. 1D) and qualitatively by photomicroscopy (Fig. 1E). The size of CFU-F derived from Nf1+/ and WT bone marrow was also quantified based on the cell number in each colony, i.e. 50100 cells/colony, 1001000 cells/colony as well as over 1000 cells/colony. A significant increase in the number of colonies containing 50100 cells and 1001000 cells was detected in Nf1+/ cultures compared with cultures containing WT cells (Fig. 1E). The average size of CFU-F was also significantly larger in cultures derived from Nf1+/ mice compared with WT controls utilizing a micrometer inside the objective lens of a microscope (Fig. 1F, 2.7±1.2 mm versus 2.1±0.7 mm, respectively, *P<0.01). These data indicate that Nf1 haploinsufficient mice have an increased frequency and total number of MSPC, which give rise to larger CFU-F compared with WT controls.
|
Nf1+/ MSPC display an increased proliferative potential compared with WT MSPC
The phenotype of MSPC derived from WT and Nf1+/ mice was evaluated by examining the expression of a range of cell surface markers unique to MSPC (Fig. 2A). Consistent with previous studies (25), both WT and Nf1+/ MSPC are negative for the expression of CD45 and CD117, but positive for the expression of CD29, CD105, CD49e, ColIA and CD44. We next evaluated the impact of loss of neurofibromin on MSPC proliferation. Total number of MSPC were scored by counting viable WT and Nf1+/ MSPC cells over a span of 13 continuous passages in the MesenCult complete media (MesenCult basal media+20% of MesenCult Supplemental) as described in Materials and Methods, and the number of MSPC from each passage was recorded, and a growth curve was generated (Fig. 2B). While a steady increase in the number of MSPC from WT and Nf1+/ mice was observed over 13 passages, a significant increase at each time point was observed in Nf1+/ MSPC compared with WT MSPC. Consistently, the increased proliferation was also observed in Nf1+/ MSPC with [3H] thymidine incorporation assay following the 48 h culture in MesenCult complete media after deprivation of 20% of MesenCult Supplemental (Fig. 2C). Together, these results indicate that haploinsufficiency of Nf1 promotes the proliferation of MSPC.
|
Haploinsufficiency of Nf1 modulates senescence and telomerase activity in MSPC
Cellular senescence is associated with a loss of proliferative ability in response to mitogenic agents (26). To test whether the increase in Nf1+/ proliferation was associated with a change in cellular senescence, a senescent assay was performed based upon histochemical staining for ß-galactosidase activity (27). A significant reduction in the number of ß-galactosidase positive cells was observed in Nf1+/ MSPC compared with WT MSPC (Fig. 3A). The quantitative results indicate that nearly 35% of WT MSPC were senescent and ß-galactosidase positive. In contrast, only 5% ß-galactosidase positive senescent cells were observed in Nf1+/ cultures (Fig. 3B). Collectively, these results suggest that the increased proliferation in Nf1+/ MSPC is associated with a decrease in the senescent activity of these cells as compared with WT controls.
|
Telomerase activity has been demonstrated to reflect the proliferation and differentiation status of cells (28). Given that Nf1+/ MSPC have increased proliferation, we then measured telomerase activity in WT and Nf1+/ MSPC utilizing a sensitive polymerase chain reaction- (PCR) based ELISA detection method (29). Consistently, higher levels of telomerase activity were detected in Nf1+/ MSPC as compared with WT MSPC (Fig. 3C). These data indicates that haploinsufficiency of Nf1 results in down-regulation of the senescent activity and increased telomerase activity, which leads to the increase in Nf1+/ MSPC proliferation, indicating an important role of Nf1 in modulating MSPC proliferation.
Haploinsufficiency of Nf1 alters MSPC differentiation in vivo and in vitro
One of the most important features of MSPC is their ability to differentiate into multiple cell types, including osteoblasts and chondrocytes. WT and Nf1+/ bone marrow mononuclear cells (BMMNCs) were cultured under conditions that promote the maturation of osteoblasts and chondrocytes. Osteoblasts from WT controls displayed strong alkaline phosphatase (ALP) activity (Fig. 4A, upper panel). In contrast, significantly less ALP expression was observed in Nf1+/ cultures [Fig. 4A, lower panel]. The CFU-ALP was calculated on a per femur basis and is shown in Figure 4B. A significant reduction in the number of CFU-ALP was observed in Nf1+/ mice as compared with that in WT mice. In addition, the chondrocyte differentiation assay revealed that the CFU-F from both WT and Nf1+/ mice expressed Alcian blue positive nodules, and no significant difference was found between the two genotypes (data not shown). Data from the differentiation assay suggests that haploinsufficiency of Nf1 in MSPC impairs osteogenic differentiation, but not chondrocyte differentiation.
|
Differential mRNA expression of WT and Nf1+/ MSPC
To confirm the role of Nf1 in MSPC differentiation, expression of osteogenic-specific genes, including osteocalcin and osteonectin, was examined in both WT and Nf1+/ MSPC (Fig. 5). Osteocalcin mRNA expression was detected at the end of week 1 and week 4 in WT MSPC cultures. Strikingly, no osteocalcin mRNA expression was detected in Nf1+/ cells at week 1, and low levels were observed in Nf1+/ cultures at week 4. Osteonectin mRNA, another marker for osteogenic differentiation, was consistently reduced in Nf1+/ cells compared with WT MSPC. MSPC differentiation into chondrocytes was examined by assessing mRNA expression of collagen I, collagen II and Aggreacan. Despite low expression of Aggreacan mRNA in the Nf1+/ cells at week 1, similar expression of Aggreacan mRNA was observed in WT and Nf1+/ MSPC at week 4. The expression of collagen I and collagen II was similar in WT and Nf1+/ MSPC at weeks 1 and 4. These results support the observation that haploinsufficiency of Nf1 in MSPC affects osteogenic differentiation, but not the emergence of chondrocytes.
|
Differentiation of single CFU-F replating assay (SCRA)
Most MSPC studies are based on bulk cell cultures. Smith et al. (30) established a single cell colony assay utilizing human bone marrow-derived MSCs, which permitted analysis of the differential clonal potential of small stem-like cells to differentiate into osteoblasts in vitro. Similarly, in the present study, we developed a colony-replating assay to understand whether single CFU-F displays the potential to differentiate into multiple lineages (Fig. 6). As shown in Table 1, 24 individual colonies picked from six WT marrow cultures were able to generate osteoblasts or chondrocytes. However, in Nf1+/ cultures, 11 out of 24 colonies were able to differentiate into osteoblasts, whereas 24 out of 24 colonies were able to differentiate into chondrocytes. Our study indicates that MSPC from WT mice have the potential to differentiate into osteoblasts as well as chondrocytes. However, haploinsufficiency of Nf1 in MSPC leads to impairment in osteogenesis.
|
|
Expression of Nf1 GAP-related domains into Nf1+/ MSPC increases osteoblast differentiation
Haploinsufficiency of Nf1 results in Ras hyperactivation in multiple lineages (46,3136). We next assessed the Ras activity by Raf pull down assay in Nf1+/ MSPC following 24 h of starvation. Our results show that Nf1+/ MSPC have increased Ras activity at baseline as compared with WT MSPC (Fig. 7A). Ras activity also increased after stimulation with 10% fetal bovine serum (FBS). To determine whether reduced osteoblast differentiation in Nf1+/ MSPC is directly related to altered p21ras activity, WT and Nf1+/ MSPC were transduced with a recombinant retrovirus encoding full length NF1 GAP-related domain (GRD) and a selectable marker, pac, selected in puromycin, and subjected to culture for further osteoblast differentiation. In contrast to Nf1+/ MSPC expressing MSCV-pac alone, expression of NF1 GRD in Nf1+/ MSPC increased osteoblast formation (Fig. 7B). The hyperactivation of Ras in Nf1+/ MSPC at baseline was reduced after re-expression of NF1 GRD (Fig. 7C). The restored osteoblast differentiation is consistent with the normalized Ras GTP activity observed in Nf1+/ MSPC following transduction of NF1 GRD. Thus, increased p21ras activity is directly linked to impaired osteoblast formation in Nf1+/ MSPC.
|
| DISCUSSION |
|---|
|
|
|---|
The detection of somatic mutations in the residual normal NF1 allele within the tumors of individuals with NF1 is consistent with NF1 functioning as a tumor-suppressor gene. However, evidence in selected lineages (46,31,37) now indicates that analogous to recent discoveries in p53 (38) and p27 (39) gene dosage effects of NF1 alter cell fates and functions. The majority of recent studies examining Nf1 haploinsufficiency have focused on the role of NF1 in modulating the tumor microenvironment of plexiform neurofibromas and optic gliomas (46,3136). However, both clinical data from NF1 patients and experimental studies in Nf1+/ mice support the hypothesis that haploinsufficiency of NF1 (Nf1) results in a range of non-malignant phenotypes, including cerebrovascular disease (40), renal vascular hypertension (4143) and osseous abnormalities (10,1315,17,44), suggesting that haploinsufficient NF1 contributes to pathogenesis in multiple lineages. Our present study sought to understand the role of haploinsufficiency of NF1 (Nf1) in disrupting normal MSPC differentiation.
Given that osteoblasts are the progeny of MSPC, we utilized primary MSPC to understand the mechanism underlying the pathological changes in the bone of NF1 patients. The Nf1+/ mouse model is a useful tool to understand the role of Nf1 in modulating the biological functions and differentiation of MSPC. Utilizing Nf1+/ mice, MSPC were cultured from BMMNCs followed by evaluation of proliferation and differentiation. We found that haploinsufficiency of Nf1 promotes MSPC proliferation, but impairs osteoblast differentiation. Given that telomerase activity has been shown to be associated with cellular proliferative potential in cultured cells and is reduced when a variety of cultured cell types are induced to differentiate in vitro (28,45), the elevated proliferation observed in Nf1+/ MSPC in vitro is consistent with the elevated telomerase activity. In addition, the decreased senescence in Nf1+/ MSPC is consistent with an increased proliferation and decreased differentiation. Recently, several groups have reported a spontaneous transformation occurring after a long-term in vitro culture of human and murine MSPC (46,47). Given that cells proliferate rapidly after passage 5 in WT and Nf1+/ MSPC in our study, we performed anchorage-independent soft agar colony assay to check if the MSPC became transformed. No colonies were observed in passage 8 and passage 14 MSPC from WT or Nf1+/ cultures (data not shown). Thus, by one assay, MSPC do not appear to transform under our culture condition through 14 cell passages.
Increasing evidence indicates that MSPC have the potential to differentiate into multiple cell lineages, including osteoblasts and chondrocytes (30,48). We report that haploinsufficiency of Nf1 in MSPC induces an impaired differentiation into osteoblasts compared with WT MSPC. Osteoblastic markers progressively increase at the mRNA level during osteoblastic cell differentiation (49); however, decreased mRNA expression of two osteoblast markers, osteocalcin and osteonectin, was observed in Nf1+/ MSPC as compared with WT cells. Yu et al. (7) recently reported that Nf1+/ mice have less periosteal and endocortical bone formation with significant differences in endocortical percent mineralized bone surface representing active bone forming area and a significantly reduced bone formation rate relative to bone surface area as compared with WT mice. This impaired bone formation in vivo may be related to the impaired osteoblast differentiation from MSPC in vitro in Nf1+/ mice reported herein. Though osteoblasts lineage has impaired differentiation emerging from Nf1+/ MSPC, normal differentiation of the chondrocyte lineage, another lineage arising from Nf1+/ MSPC, was observed with similar levels of expression for three chondrocyte markerscollagen I, collagen II and Aggreacan, as compared with that in WT cells. These results indicate that haploinsufficiency of Nf1 regulates osteoblast differentiation from MSPC but not chondrocyte differentiation.
Cycling multipotential progenitor cells from bone marrow have been identified as those cells that undergo 40 or more population doublings (50). Few studies have examined the clonogenic behavior of MSPC in vitro. Here, we utilized SCRA which allowed us to detect the differentiation capacity from a single CFU-F colony. Our results suggest that single CFU-F display multiple lineage differentiation potential. Using this method, we report that loss of a single Nf1 allele in MSPC diminishes MSPC differentiation into osteoblasts. Precisely how haploinsufficiency of Nf1 alters MSPC differentiation remains uncertain, but clearly the relative levels of important transcription factors necessary for osteoblast differentiation were altered. A detailed transcriptional comparison of WT and Nf1+/ MSPC may be informative.
Neurofibromin, the protein encoded by NF1, functions as a GAP for p21Ras by accelerating the hydrolysis of active p21Ras-GTP to inactive p21Ras-GDP (36,5153). We and others have shown that neurofibromin-deficient mast cells have increased p21ras activity in response to multiple hematopoietic cell growth factors, which is directly linked to increased proliferation (35,5255). Nose et al. (56) has previously shown that overexpression of Ras and MAP kinase was associated with suppression of c-fos, whose up-regulation is required for normal osteoblast functions. Consistent with our and other previous studies in different cell lineages, Nf1+/ MSPC have increased Ras-GTPase activity. Re-expression of GRD in Nf1+/ MSPC restored the impaired osteoblast differentiation defect, indicating that the reduced osteoblast differentiation is directly associated with the hyper Ras activity.
In conclusion, our study indicates that loss of a single allele of Nf1 in MSPC results in impaired osteoblast differentiation, which is mediated by hyper Ras activity, implying an important role of neurofibromin in regulating osteoblast differentiation. The impaired osteoblast differentiation may be associated with the osseous manifestations found in NF1 patients. Further study of the molecular and biochemical pathway(s) of neurofibromin in modulating MSPC differentiation may help elucidate a better understanding of the pathophysiology underlying the malignant and non-malignant manifestations of this common genetic disorder.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Animals and materials
Nf1+/ mice were obtained from Dr Tyler Jacks at the Massachusetts Institute of Technology (Cambridge, MA, USA) in a C57BL/6J.129 background and backcrossed for 13 generations into a C57BL/6J strain (57). Nf1+/ mice were genotyped by polymerase chain reaction (PCR) as previously described (4). These studies were conducted with a protocol approved by the Indiana University Laboratory Animal Research Center using 48-week-old WT and Nf1+/ mice. Chemicals were purchased from Sigma (St Louis, MO, USA) unless otherwise stated.
Isolation and expansion of MSPC
Bone marrow cells were collected from 4 to 8-week-old WT and Nf1+/ mice by flushing the femurs and tibias with Iscove's MEM (Gibco-Invitrogen, Carsbad, USA) containing 2% FBS using a 21-gauge needle. BMMNCs were then separated by low-density gradient centrifugation (36). Cells were then washed twice with Iscove's MEM and suspended in mouse MesenCult basal medium supplemented with MesenCult Supplemental (Stem Cell Technologies Inc., CA, USA). The cells were diluted to 2x106 cells/ml and 10 ml of the single cell suspension was added into a 10 cm tissue culture plate as previously described (58). The cells were plated into a flask at 2x106/ml in 10 ml of complete MesenCult medium. Once the culture reached 8090% confluency, cells were trypsinized and replated at 5x105 cells/75 cm2. MSPC at passage 5 to passage 10 were used for the following experiments.
CFU-F assay
To measure the frequency of MSPC in bone marrow, CFU-F assay was performed as previously reported (58). Briefly, different concentrations of BMMNCs as indicated in Figure 1C and D were plated into six-well tissue culture plates in triplicate for each condition in complete MesenCult medium and incubated at 37°C, 5% CO2. At day 14 of the culture, media was removed, and each well was washed with PBS and stained with HEMA-3 quick staining kit (Fisher Scientific Company, VA, USA) according to the manufacturer's instruction. The plates were then rinsed in deionized water and air-dried. Colonies with more than 50 cells were counted microscopically at 40X amplification by a phase contract microscope. Colonies whose morphology clearly differed from the MSPC morphology were excluded from the results.
Proliferation assay
To examine the impact of neurofibromin in MSPC proliferation, we performed [3H]thymidine incorporation assays. Briefly, MSPC from WT or Nf1+/ mice were deprived of supplement for 24 h and 1x104 cells were plated in 96-flat bottom well plates in 200 µl of
-MEM in a 37°C, 5% CO2, humidified incubator. The cells were then cultured for 48 h, and [3H]thymidine was added to cultures 6 h prior to harvest with an automated cell harvester (96-well harvester, Brandel, Gaithersburg, MD, USA) and ß emission was measured with a microplate scintillation counter (Packard Bioscience Company, Shelton, CT, USA). Assays were performed in triplicate. For growth curve, MSPC were plated into a flask at 2x106/ml in 10 ml of complete MesenCult medium. Once the culture reached 8090% confluency, cells were trypsinized and replated at 5x105 cells/75 cm2. Cell numbers were then recorded and plated at the same density each time. The fold increase of cells was calculated for each time point compared with the first point and the growth curve was plotted.
Senescent assay
Histochemical staining for ß-galactosidase activity was utilized to measure the senescence of MSPC (27). WT and Nf1+/ MSPC were plated in chamber slides at 2x104/chamber and incubated at 37°C, 5% CO2 for 72 h. Cells were then stained with a Senescent Staining Kit (Sigma) according to the manufacturer's instruction. Senescent cells displayed a blue color in the cytoplasma. Four thousand cells were counted for each chamber and the percentage of positive cells/4000 cells was determined.
Telomerase activity assay
Telomerase activity was examined using a telomeric repeat amplification protocol (TRAP) TRAPeze Elisa telomerase detection kit (Chemicon, Temecula, CA, USA) according to the manufacturer's instructions (29). Briefly, cell extracts were incubated with biotinylated telomerase substrate oligonucleotide at 30°C for 30 min. The extended products were amplified by PCR using Taq polymerase (Amersham International), reverse primers and a deoxynucleotide mix containing dCTP labeled with dinitrophenyl (DNP). The conditions for the two-step PCR were 33 cycles of 94°C for 30 s, and 55°C for 30 s on a PTC-100TM Programmable Thermal Controller (MJ Research, Inc.). The amplification products were immobilized on streptavidin-coated microtitre plates, and then detected by anti-DNP antibody conjugated to horseradish peroxidase. After addition of the peroxidase substrate (3,3',5,5'tetramethylbenzidine), the amount of TRAP product was determined by measuring the absorbance at 450 nm and 650 nm via fast kinetic mode for 100 s using an Lmax microplate luminometer and SoftMax Pro software (Molecular Devices, Sunnyvale, CA, USA). For negative controls, lysates were heat-treated by incubating at 85°C for 10 min prior to the TRAP assay to inactivate telomerase. The activity was semi-quantified by ELISA as recommended by the manufacturer.
Analysis of surface markers expression
Antibodies for flow cytometry were purchased from BD PharMingen. MSPC were incubated with fluorescein isothiocyanate (FITC) anti-mouse CD44, R-phycoerythrin (R-PE)-conjugated anti-mouse CD49e, R-PE-conjugated anti-mouse CD29, purified anti-rat CD105 and anti-rat R-PE antibody. After 30 min of incubation at 4°C, cells were washed three times with PBS containing 0.1% BSA and analyzed by fluorescence-activated cytometric analysis (Becton Dickinson, San Jose, CA, USA).
Differentiation assays
Osteogenic differentiation was analyzed by quantitation of mineral deposition. WT and Nf1+/ BMMNCs were plated at 2x106/ml in osteogenic differentiation medium (MesenCult+Supplemental, 108mol/l dexamethasone, 5 µg/ml ascorbic acid 2-phosphate and 10 mmol/l ß-glycerophosphate) and maintained for 2 weeks, followed by ALP activity assays. Briefly, cells were fixed in citrate-buffered acetone for 30 s, incubated in alkaline-dye mix for 30 min and counter-stained with Mayer's Hematoxylin for 10 min. Cells were then evaluated microscopically, and the intensity of ALP staining was recorded.
To induce chondrogenic differentiation, BMMNCs were maintained in chondrogenic differentiation medium (MesenCult+Supplemental, 108mol/l dexamethasone, 5 µg/ml ascorbic acid 2-phosphate, 10 mmol/l ß-glycerophosphate and 10 ng/ml TGFß3) for 4 weeks. Cells were then fixed in 4% paraformaldehyde in PBS for 30 min at room temperature, washed with PBS and incubated with 1% Alcian Blue in 0.1 M HCl (pH 1.0). Chondrogenic cells were visualized as blue-stained cells under the microscope.
To determine the differentiation potential of WT and Nf1+/ MSPC, an SCRA was performed. Briefly, 5x105 cells/well in a six-well plate was seeded for CFU-F culture as described earlier. Two weeks after the culture, single CFU-Fs were picked up individually by adding EDTAtrypsin for 5 min and stopped by adding 10% FBS, and transferred into each Eppendrof tube. The cells from the single colony were then divided among two tubes, and plated to two different wells osteogenic and chondrogenic differentiation medium in a 48-well plate. Four weeks later, the cells were stained for specific differentiation markers as described earlier. Twenty-four individual colonies were picked from each genotype for the analysis.
Reverse-transcriptase polymerase chain reaction (RT-PCR)
MSPC were incubated in differentiation medium and total RNA was extracted using the RNeasy mini kit (Qiagen, Valencia, CA, USA) to purify total RNA and 100 ng RNA was used for each reaction. RT-PCR was performed using Qiagen one step RT-PCR kit according to the manufacturer's instruction at week 1 and week 4. The PCR products were resolved on a 1.2% agarose gel. The primers used were GTAGCCATCCAGGCTGTGTTGTC, ACAGCACTGTGTTGGCATAGAGG for ß-actin; Osteopontin TCACCATTCGGATGAGTCTG, ACTTGTGGCTCTGATGTTCC 437 bp (59); Osteonectin AGCGCCTGGAGGCTGGAGAC, CTTGATGCCAAAGCAGCCGG 269 bp HM; Osteocalcin TCTGCTCACTCTGCTGAC, GGAGCTGCTGTGACATCC 388 bp (60); Type I collagen GAAGTCAGCTGCATACAC, AGGAAGTCCAGGCTGTCC 313 bp (60); Type II collagen GCCTCGCGGTGAGCCTGATC, CTCCATCTCTGCACGGGGT, IIA: 472 bp (61), IIB: 268 bp; Aggreacan CCAAGTTCCAGGGTCACTGTTACCG, TCCTCTCCGGTGGCAAAGAAGTTG 271 bp (61). All the primers were synthesized by Sigma.
Generation of recombinant retroviral plasmids and retroviral transduction of MSPC
Previously developed recombinant retrovirus constructs were used in these studies (53). The internal sequences of these constructs are under the transcriptional control of the myeloproliferative sarcoma retrovirus promoter. Constructs also contain a puromycin resistance gene, pac, which is under the transcriptional control of the phosphoglycerate kinase (PGK) promoter. Two viruses were used in these experiments: a virus expressing the full-length NF1 GTPase activating related domain (NF1 GRD) and pac (MSCV-NF1 GRD-pac) and a virus expressing the selectable marker gene alone (MSCV-pac). The transduction protocol has been previously described and was used here with minor modifications (53). Briefly, MSPC were cultured in liquid cultures of MesenCult+Supplemental and transduced with either MSCV-NF1GRD or MSCV-Pac (control), and puromycin-resistant cells were selected after 3 days.
Detection of p21Ras-GTP levels
MSPC were deprived of serum for 24 h and collected with or without 10% FBS stimulation for 5 min. p21Ras activation was subsequently determined using p21Ras activation assay kits (Upstate Biotechnology, Lake Placid, NY, USA) according to the manufacturer's protocol and as described previously (53).
Statistical analysis
Student's t-test and
2 analysis was used to evaluate statistical differences between WT and Nf1+/ MSPC. Statistical significance was defined as P<0.05.
| ACKNOWLEDGEMENTS |
|---|
We thank Dr Wade Clapp for his helpful scientific advice, Dr Brenda R. Grimes for her scientific suggestion, Dr Rebecca J. Chan for her critical reading the manuscript, Marilyn L. Wales and Janice Walls for administrative support. This work was supported by Department of Defense (DOD) NF043032 (FCY).
Conflict of Interest statement. No conflicts declared.
| REFERENCES |
|---|
|
|
|---|
- Riccardi V. (1992) Neurifbromatosis: Phenotype, Natural History and Pathogenesis (The Johns Hopkins University Press, Baltimore, MD, USA) pp. 479.
- Friedman J.M. (1999) Epidemiology of neurofibromatosis type 1. Am. J. Med. Genet. 89:16.[CrossRef][ISI][Medline]
- Giehl K. (2005) Oncogenic Ras in tumour progression and metastasis. Biol. Chem. 386:193205.[CrossRef][ISI][Medline]
-
Ingram D.A., Yang F.C., Travers J.B., Wenning M.J., Hiatt K., New S., Hood A., Shannon K., Williams D.A., Clapp D.W. (2000) Genetic and biochemical evidence that haploinsufficiency of the Nf1 tumor suppressor gene modulates melanocyte and mast cell fates in vivo. J. Exp. Med. 191:181188.
[Abstract/Free Full Text] - Atit R.P., Mitchell K., Nguyen L., Warshawsky D., Ratner N. (2000) The neurofibromatosis type 1 (Nf1) tumor suppressor is a modifier of carcinogen-induced pigmentation and papilloma formation in C57BL/6 mice. J. Invest. Dermatol. 114:10931100.[CrossRef][ISI][Medline]
-
Johannessen C.M., Reczek E.E., James M.F., Brems H., Legius E., Cichowski K. (2005) The NF1 tumor suppressor critically regulates TSC2 and mTOR. Proc. Natl Acad. Sci. USA 102:85738578.
[Abstract/Free Full Text] - Yu X., Chen S., Potter O.L., Murthy S.M., Li J., Pulcini J.M., Ohashi N., Winata T., Everett E.T., Ingram D., et al. (2005) Neurofibromin and its inactivation of Ras are prerequisites for osteoblast functioning. Bone 36:793802.[Medline]
- Riccardi V.M. (1981) Von Recklinghausen neurofibromatosis. N. Engl. J. Med. 305:16171627.[ISI][Medline]
- Friedman J.M. and Birch P.H. (1997) Type 1 neurofibromatosis: a descriptive analysis of the disorder in 1728 patients. Am. J. Med. Genet. 70:138143.[CrossRef][ISI][Medline]
- Crawford A.H. Jr and Bagamery N. (1986) Osseous manifestations of neurofibromatosis in childhood. J. Pediatr. Orthop. 6:7288.[ISI][Medline]
- Crawford A.H. (1989) Pitfalls of spinal deformities associated with neurofibromatosis in children. Clin. Orthop. Relat. Res. 245:2942.[Medline]
- Sbihi A., Balafrej A., Iraqui-Hamdouch N., Hamdouch M., Baroudi A. (1980) Osseous manifestations of Recklinghausen's disease. The role of vertebral scalloping. Maroc. Med. 2:393398.[Medline]
- Kuorilehto T., Poyhonen M., Bloigu R., Heikkinen J., Vaananen K., Peltonen J. (2005) Decreased bone mineral density and content in neurofibromatosis type 1: lowest local values are located in the load-carrying parts of the body. Osteoporos. Int. 16:928936.[CrossRef][ISI][Medline]
- Kuorilehto T., Nissinen M., Koivunen J., Benson M.D., Peltonen J. (2004) NF1 tumor suppressor protein and mRNA in skeletal tissues of developing and adult normal mouse and NF1-deficient embryos. J. Bone Miner. Res. 19:983989.[CrossRef][ISI][Medline]
- Lammert M., Kappler M., Mautner V.F., Lammert K., Storkel S., Friedman J.M., Atkins D. (2005) Decreased bone mineral density in patients with neurofibromatosis 1. Osteoporos. Int. 16:11611166.[CrossRef][ISI][Medline]
- Jacques C. and Dietemann J.L. (2005) Imaging features of neurofibromatosis type 1. J. Neuroradiol. 32:180197.[ISI][Medline]
- Illes T., Halmai V., de Jonge T., Dubousset J. (2001) Decreased bone mineral density in neurofibromatosis-1 patients with spinal deformities. Osteoporos. Int. 12:823827.[CrossRef][ISI][Medline]
- Heuze Y., Piot B., Mercier J. (2002) Difficult surgical management of facial neurofibromatosis type I or von Recklinghausen disease in children. Rev. Stomatol. Chir. Maxillofac. 103:105113.[Medline]
- Bilezekian J., Raisz L., Rodan G. (2002) Principles of Bone Biology (Academic Press, San Diego, CA, USA).
- Kawaguchi H., Manabe N., Miyaura C., Chikuda H., Nakamura K., Kuro-o M. (1999) Independent impairment of osteoblast and osteoclast differentiation in klotho mouse exhibiting low-turnover osteopenia. J. Clin. Invest. 104:229237.[ISI][Medline]
- Malaval L., Modrowski D., Gupta A.K., Aubin J.E. (1994) Cellular expression of bone-related proteins during in vitro osteogenesis in rat bone marrow stromal cell cultures. J. Cell. Physiol. 158:555572.[CrossRef][ISI][Medline]
- Olsen B.R., Reginato A.M., Wang W. (2000) Bone development. Annu. Rev. Cell. Dev. Biol. 16:191220.[CrossRef][ISI][Medline]
-
Horwitz E.M., Gordon P.L., Koo W.K., Marx J.C., Neel M.D., McNall R.Y., Muul L., Hofmann T. (2002) Isolated allogeneic bone marrow-derived mesenchymal cells engraft and stimulate growth in children with osteogenesis imperfecta: implications for cell therapy of bone. Proc. Natl Acad. Sci. USA 99:89328937.
[Abstract/Free Full Text] - Le Blanc K., Gotherstrom C., Ringden O., Hassan M., McMahon R., Horwitz E., Anneren G., Axelsson O., Nunn J., Ewald U., et al. (2005) Fetal mesenchymal stem-cell engraftment in bone after in utero transplantation in a patient with severe osteogenesis imperfecta. Transplantation 79:16071614.[CrossRef][ISI][Medline]
-
Oswald J., Boxberger S., Jorgensen B., Feldmann S., Ehninger G., Bornhauser M., Werner C. (2004) Mesenchymal stem cells can be differentiated into endothelial cells in vitro. Stem Cells 22:377384.
[Abstract/Free Full Text] - Ding W., Gao S., Scott R.E. (2001) Senescence represses the nuclear localization of the serum response factor and differentiation regulates its nuclear localization with lineage specificity. J. Cell Sci. 114:10111018.[Abstract]
- Michaloglou C., Vredeveld L.C., Soengas M.S., Denoyelle C., Kuilman T., van der Horst C.M., Majoor D.M., Shay J.W., Mooi W.J., Peeper D.S. (2005) BRAFE600-associated senescence-like cell cycle arrest of human naevi. Nature 436:720724.[CrossRef][Medline]
-
Greider C.W. (1998) Telomerase activity, cell proliferation, and cancer. Proc. Natl Acad. Sci. USA 95:9092.
[Free Full Text] - Parsch D., Fellenberg J., Brummendorf T.H., Eschlbeck A.M., Richter W. (2004) Telomere length and telomerase activity during expansion and differentiation of human mesenchymal stem cells and chondrocytes. J. Mol. Med. 82:4955.[CrossRef][ISI][Medline]
-
Smith J.R., Pochampally R., Perry A., Hsu S.C., Prockop D.J. (2004) Isolation of a highly clonogenic and multipotential subfraction of adult stem cells from bone marrow stroma. Stem Cells 22:823831.
[Abstract/Free Full Text] -
Bajenaru M.L., Hernandez M.R., Perry A., Zhu Y., Parada L.F., Garbow J.R., Gutmann D.H. (2003) Optic nerve glioma in mice requires astrocyte Nf1 gene inactivation and Nf1 brain heterozygosity. Cancer Res. 63:85738577.
[Abstract/Free Full Text] -
Zhu Y., Ghosh P., Charnay P., Burns D.K., Parada L.F. (2002) Neurofibromas in NF1: Schwann cell origin and role of tumor environment. Science 296:920922.
[Abstract/Free Full Text] - Atit R.P., Crowe M.J., Greenhalgh D.G., Wenstrup R.J., Ratner N. (1999) The Nf1 tumor suppressor regulates mouse skin wound healing, fibroblast proliferation, and collagen deposited by fibroblasts. J. Invest. Dermatol. 112:835842.[CrossRef][ISI][Medline]
-
Rutkowski J.L., Wu K., Gutmann D.H., Boyer P.J., Legius E. (2000) Genetic and cellular defects contributing to benign tumor formation in neurofibromatosis type 1. Hum. Mol. Genet. 9:10591066.
[Abstract/Free Full Text] -
Ingram D.A., Hiatt K., King A.J., Fisher L., Shivakumar R., Derstine C., Wenning M.J., Diaz B., Travers J.B., Hood A., et al. (2001) Hyperactivation of p21(ras) and the hematopoietic-specific Rho GTPase, Rac2, cooperate to alter the proliferation of neurofibromin-deficient mast cells in vivo and in vitro. J. Exp. Med. 194:5769.
[Abstract/Free Full Text] - Yang F.C., Ingram D.A., Chen S., Hingtgen C.M., Ratner N., Monk K.R., Clegg T., White H., Mead L., Wenning M.J., et al. (2003) Neurofibromin-deficient Schwann cells secrete a potent migratory stimulus for Nf1+/ mast cells. J. Clin. Invest. 112:18511861.[CrossRef][ISI][Medline]
- Wu M., Wallace M.R., Muir D. (2005) Nf1 haploinsufficiency augments angiogenesis. Oncogene 25:22972303.[CrossRef]
- Venkatachalam S., Shi Y.P., Jones S.N., Vogel H., Bradley A., Pinkel D., Donehower L.A. (1998) Retention of wild-type p53 in tumors from p53 heterozygous mice: reduction of p53 dosage can promote cancer formation. EMBO J. 17:46574667.[CrossRef][ISI][Medline]
- Fero M.L., Randel E., Gurley K.E., Roberts J.M., Kemp C.J. (1998) The murine gene p27Kip1 is haplo-insufficient for tumour suppression. Nature 396:177180.[CrossRef][Medline]
-
Rosser T.L., Vezina G., Packer R.J. (2005) Cerebrovascular abnormalities in a population of children with neurofibromatosis type 1. Neurology 64:553555.
[Abstract/Free Full Text] - Fossali E., Signorini E., Intermite R.C., Casalini E., Lovaria A., Maninetti M.M., Rossi L.N. (2000) Renovascular disease and hypertension in children with neurofibromatosis. Pediatr. Nephrol. 14:806810.[CrossRef][ISI][Medline]
- Cormier J.M., Cormier F., Mayade F., Fichelle J.M. (1999) Arterial complications of neurofibromatosis. J. Mal. Vasc. 24:281286.[ISI][Medline]
-
Kurien A., John P.R., Milford D.V. (1997) Hypertension secondary to progressive vascular neurofibromatosis. Arch. Dis. Child. 76:454455.
[Abstract/Free Full Text] - Stevenson D.A., Birch P.H., Friedman J.M., Viskochil D.H., Balestrazzi P., Boni S., Buske A., Korf B.R., Niimura M., Pivnick E.K., et al. (1999) Descriptive analysis of tibial pseudarthrosis in patients with neurofibromatosis 1. Am. J. Med. Genet. 84:413419.[CrossRef][ISI][Medline]
- Till J.E. (1982) Stem cells in differentiation and neoplasia. J. Cell. Physiol. Suppl. 1:311.[Medline]
-
Miura M., Miura Y., Padilla-Nash H.M., Molinolo A.A., Fu B., Patel V., Seo B.M., Sonoyama W., Zheng J.J., Baker C.C., et al. (2006) Accumulated chromosomal instability in murine bone marrow mesenchymal stem cells leads to malignant transformation. Stem Cells 24:10951103.
[Abstract/Free Full Text] -
Rubio D., Garcia-Castro J., Martin M.C., de la Fuente R., Cigudosa J.C., Lloyd A.C., Bernad A. (2005) Spontaneous human adult stem cell transformation. Cancer Res. 65:30353039.
[Abstract/Free Full Text] - Jiang Y., Jahagirdar B.N., Reinhardt R.L., Schwartz R.E., Keene C.D., Ortiz-Gonzalez X.R., Reyes M., Lenvik T., Lund T., Blackstad M., et al. (2002) Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418:4149.[CrossRef][Medline]
- Lian J.B., Javed A., Zaidi S.K., Lengner C., Montecino M., van Wijnen A.J., Stein J.L., Stein G.S. (2004) Regulatory controls for osteoblast growth and differentiation: role of Runx/Cbfa/AML factors. Crit. Rev. Eukaryot. Gene Expr. 14:141.[ISI][Medline]
-
Reyes M., Lund T., Lenvik T., Aguiar D., Koodie L., Verfaillie C.M. (2001) Purification and ex vivo expansion of postnatal human marrow mesodermal progenitor cells. Blood 98:26152625.
[Abstract/Free Full Text] -
Wallace M.R., Marchuk D.A., Andersen L.B., Letcher R., Odeh H.M., Saulino A.M., Fountain J.W., Brereton A., Nicholson J., Mitchell A.L., et al. (1990) Type 1 neurofibromatosis gene: identification of a large transcript disrupted in three NF1 patients. Science 249:181186.
[Abstract/Free Full Text] - Bollag G., Clapp D.W., Shih S., Adler F., Zhang Y.Y., Thompson P., Lange B.J., Freedman M.H., McCormick F., Jacks T., et al. (1996) Loss of NF1 results in activation of the Ras signaling pathway and leads to aberrant growth in haematopoietic cells. Nat. Genet. 12:144148.[CrossRef][ISI][Medline]
-
Hiatt K.K., Ingram D.A., Zhang Y., Bollag G., Clapp D.W. (2001) Neurofibromin GTPase-activating protein-related domains restore normal growth in Nf1/ cells. J. Biol. Chem. 276:72407245.
[Abstract/Free Full Text] - Largaespada D.A., Brannan C.I., Jenkins N.A., Copeland N.G. (1996) Nf1 deficiency causes Ras-mediated granulocyte/macrophage colony stimulating factor hypersensitivity and chronic myeloid leukaemia. Nat. Genet. 12:137143.[CrossRef][ISI][Medline]
-
Zhang Y.Y., Vik T.A., Ryder J.W., Srour E.F., Jacks T., Shannon K., Clapp D.W. (1998) Nf1 regulates hematopoietic progenitor cell growth and ras signaling in response to multiple cytokines. J. Exp. Med. 187:18931902.
[Abstract/Free Full Text] - Nose K., Itami M., Satake M., Ito Y., Kuroki T. (1989) Abolishment of c-fos inducibility in ras-transformed mouse osteoblast cell lines. Mol. Carcinog. 2:208216.[ISI][Medline]
- Jacks T., Shih T.S., Schmitt E.M., Bronson R.T., Bernards A., Weinberg R.A. (1994) Tumour predisposition in mice heterozygous for a targeted mutation in Nf1. Nat. Genet. 7:353361.[CrossRef][ISI][Medline]
- Meirelles Lda S. and Nardi N.B. (2003) Murine marrow-derived mesenchymal stem cell: isolation, in vitro expansion, and characterization. Br. J. Haematol. 123:702711.[CrossRef][ISI][Medline]
- Chackalaparampil I., Peri A., Nemir M., McKee M.D., Lin P.H., Mukherjee B.B., Mukherjee A.B. (1996) Cells in vivo and in vitro from osteopetrotic mice homozygous for c-src disruption show suppression of synthesis of osteopontin, a multifunctional extracellular matrix protein. Oncogene 12:14571467.[ISI][Medline]
- Windahl S.H., Vidal O., Andersson G., Gustafsson J.A., Ohlsson C. (1999) Increased cortical bone mineral content but unchanged trabecular bone mineral density in female ERbeta(/) mice. J. Clin. Invest. 104:895901.[ISI][Medline]
-
Tropel P., Noel D., Platet N., Legrand P., Benabid A.L., Berger F. (2004) Isolation and characterisation of mesenchymal stem cells from adult mouse bone marrow. Exp. Cell. Res. 295:395406.[CrossRef][ISI][Medline]
This article has been cited by other articles:
![]() |
J. Yan, S. Chen, Y. Zhang, X. Li, Y. Li, X. Wu, J. Yuan, A. G. Robling, R. Karpur, R. J. Chan, et al. Rac1 mediates the osteoclast gains-in-function induced by haploinsufficiency of Nf1 Hum. Mol. Genet., April 1, 2008; 17(7): 936 - 948. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Chen, Y. Qiu, L. Chen, L. Li, J. Chen, C. Zhang, B. Wang, Y. Yu, Z. Zhu, F. Zhu, et al. The Expression of Neurofibromin in Human Osteoblasts and Chondrocytes Ann. Clin. Lab. Sci., January 1, 2008; 38(1): 25 - 30. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||








