Human Molecular Genetics Advance Access originally published online on August 21, 2006
Human Molecular Genetics 2006 15(19):2880-2887; doi:10.1093/hmg/ddl229
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Variation in MICA and MICB genes and enhanced susceptibility to paucibacillary leprosy in South India
,
,

1 The Wellcome Trust Centre for Human Genetics, Roosevelt Drive, Oxford, OX3 7BN, UK and 2 Centre for Excellence in Genomic Sciences, Madurai Kamaraj University, Madurai 625021, India
* To whom correspondence should be addressed. Tel: +44 1865287759; Fax: +44 1865287686; Email: adrian.hill{at}well.ox.ac.uk
Received May 24, 2006; Accepted August 10, 2006
| ABSTRACT |
|---|
|
|
|---|
In a study of mainly paucibacillary leprosy-affected sib-pair families from South India, in addition to the expected associations with the HLA-DRB1 locus, we have identified significant association with a functional variant of the MICA gene as well as a microsatellite in the flanking region of the MICB gene. The associations with MICA and MICB cannot be accounted for by linkage disequilibrium with the HLA class II locus indicating a role in genetic susceptibility to leprosy that is independent of HLA-DRB1. Previous studies have shown that MICA and MICB are expressed on the surface of cells in response to infection, where they are recognized by the NKG2D receptor on

T cells, CD8+
ß T cells and natural killer cells, all of which contribute to defense against mycobacteria. The MICA*5A5.1 allele, associated here with leprosy susceptibility, encodes a protein lacking a cytoplasmic tail providing a possible mechanism for defective immune surveillance against mycobacteria. | INTRODUCTION |
|---|
|
|
|---|
Leprosy is a chronic infectious disease caused by the organism Mycobacterium leprae. Once infected, more than 95% of individuals will clear infection and resist disease, with only a small minority going on to develop clinical symptoms. It has long been recognized that leprosy clusters in families and it is often regarded as a genetic disease and indeed twin studies in India have demonstrated higher concordance rates for leprosy in monozygotic twins (6085%) when compared with dizygotic twins (520%) (1,2). Also complex segregation analyses, carried out on some populations, have found models consistent with one major co-dominant or recessive gene and perhaps several modifying genes controlling susceptibility to leprosy (3).
The most frequently tested genetic markers in leprosy are those of the major histocompatibility complex (MHC) that lie on the short arm of chromosome 6. The MHC is a region of
3.5 Mb in humans and it encompasses 224 loci (http://www.sanger.ac.uk/HGP/Chr6/MHC.shtml). Leprosy was the first infectious disease found to be associated with the HLA and in many studies susceptibility to leprosy per se and leprosy type has been found to be associated with HLA-DR2, in particular the HLA-DR15 subtype (4). Functional evidence has shown that HLA-DR associated immunity may be crucial in the adaptive immune response to infection (5), however, other studies show associations not only with different HLA-DRB1 antigens but also with other genes of the MHC involved in the innate immune response.
Associations with the nearby MHC class III gene encoding the tumor necrosis factor alpha (TNF) and leprosy have been observed (4). TNF is a pro-inflammatory cytokine that plays a key role in response to mycobacterial infection (6,7). High serum levels of TNF have been reported in patients with lepromatous leprosy (8) and also those having erythema nodosum leprosum (9), a reactional state that can occur in lepromatous patients while undergoing treatment. This data suggests that TNF may mediate the immunopathological effects in leprosy patients.
The class I region of the MHC has recently received further interest with the discovery of the highly variable MHC class I chain-related genes A (MICA) and B (MICB) (10). These proteins are expressed on the surface of cells in response to stress where they are recognized by 
T cells, CD8+
ß T cells and natural killer cells (NK) through the NKG2D receptor (11). These genes lie between the TNF and HLA-B loci and unlike other non-classical HLA class I genes, they are highly polymorphic with over 50 MICA alleles and 13 MICB alleles having been identified to date (12). Many of the diseases previously found to be associated with the HLA-B and -C loci have now been found also to be associated with the MIC genes such as psoriasis, ankylosing spondylitis, Behcet's and Kawasaki's disease (13). In the case of psoriatic arthritis, the association with the MICA exon 5 polymorphism appears to be independent of not only the HLA class I genes, but also of the TNF and HLA-DR loci (14,15). A small study of leprosy cases and controls in Southern China suggested that an exon 5 variant of the MICA gene may be associated with resistance to the multibacillary form of the disease, however, the possibility of a linked gene was not excluded (16).
In order to dissect the genes controlling genetic susceptibility to leprosy in the MHC region from those associated due to linkage disequilibrium (LD), we have carried out a family association study of leprosy in Southern India, mainly including tuberculoid cases, the prevalent form in the subcontinent. This study includes analysis of the class II HLA-DR and -DQ antigens, polymorphisms in the class III tumor necrosis factor locus, and the class I-related MICA and MICB genes.
| RESULTS |
|---|
|
|
|---|
MHC regions studied
South Indian families, consisting of sib pairs with mainly the paucibacillary form of leprosy, were genotyped at the DRB1 and DQB1 loci of HLA, the TNF-308 promoter polymorphism, a microsatellite upstream of the lymphotoxin-alpha (LTA) gene and microsatellites in intron 1 of the MICB gene and exon 5 of the MICA gene. Exon 5 of the MICA gene was selected as it is the most polymorphic and informative of the exons. TNF polymorphisms, HLA-DRB1* and HLA-DQB1* locus were selected because of reported associations with mycobacterial diseases (8,17) and a high frequency of HLA-DR2 in Southern India (18). The distribution of various loci investigated and their relative positions on chromosome 6p21.3 are shown in Figure 1: MHC class II gene, HLA DRB1 and DQB1 are proximal to the centromere and the TNF, MICA and MICB lie some 1000 kb distal to the MHC class II region.
|
Linkage analysis
The frequencies of the alleles studied were calculated from the parental genotypes (Table 1). Each marker was tested for disease association using the transmission disequilibrium test (TDT). When all affected siblings are included in the analysis, then TDT is a test for association and/or linkage; Table 2 presents these data.
|
|
The only polymorphisms to be globally associated with disease were those of MICA and MICB [MICA:
2=13.25 (degree of freedom, df=4), global P=0.01; MICB:
2=29.5, df=12, global P=0.003]. In addition, specific alleles of various loci were also found to be associated and/or linked with the disease. These include MICA*5A5.1 (P=0.017), MICB*CA16 (P=0.031), MICB*CA19 (P=0.021), TNFa*10 (P=0.042) and DRB1*15 (P=0.012). A few other alleles showed a protective effect against the disease: these were MICB*CA21 (P=0.0007), MICB*CA22 (P=0.005) TNFa-5 (P=0.002) and DRB1*09 (P=0.004). Bootstrap P-values [P(bs)]were also calculated for each of the tests. This is an indication of the proportion of bootstrap samples that gave an equal or larger test statistic to those observed. Both the global and allele tests remained significant following bootstrap testing for the MICA and MICB loci (MICA global P(bs)=0.013, MICB global P(bs)=0.002). Thus, two microsatellite alleles within intron 1 of the MICB gene and also the MICA-5A5.1 allele of the exon 5 repeat were found to be associated with disease susceptibility.
Disease association
In TDT analysis, when all affected siblings are included in the analysis, then TDT is a test for association and/or linkage. However, association independent of linkage can be detected by including only one affected offspring at random from each family. In this analysis, global MICA and the MICA*5A5.1 allele were significantly associated with disease (MICA global:
2=7.58, P=0.013; MICA*5A5.1:
2=12.68, P=0.006). The MICB*CA21 allele was negatively associated with leprosy, i.e. protective (
2=5.87, P=0.015), however, the global P-value of MICB was not significant (P=0.14). Also, following bootstrap testing, only the MICA locus remained significant [MICA global P(bs)=0.012, MICA*5A5.1 P(bs)=0.012]. The rare HLA-DRB1*09 allele was found to be protective against the disease, independent of linkage (
2=5.79, P=0.016), but this was not significant after bootstrap testing nor was the global P-value of the locus significant. Overall, the most compelling evidence of an independent association with the disease in this region was with the MICA*5A5.1 allele.
Other alleles in the MHC region positively linked with the disease without a significant association were HLA-DRB1*15 and TNFa*10. It remained possible that the associations observed with MICA and MICB could be due to LD with the other loci in the region such as DRB1, which is 1000 kb away, so further haplotype and LD analysis was undertaken.
Two locus haplotypes predisposing for leprosy
The advantage of using families was that the haplotypic phase could be assigned and used for TDT analysis and calculations of LD statistics. Table 3A presents the haplotypes associated with susceptibility to the disease and Table 3B, the protective haplotypes. In total, 51 haplotypes were found to be significantly associated with disease, with 42 of these including one of the alleles associated with disease when tested independently. On the basis of these alleles and haplotypes, an extended haplotype-conferring risk can be constructed: MICA*5A5.1MICB*CA16TNFa*10TNFa308*1DRB1*15. Among the DRB1*15 haplotypes, the farthest apart MICA*5A5.1DRB1*15 (P=0.008), MICB*CA16DRB1*15 (P=0.002) and TNFa*10DRB1*15 (P=0.003) gave highly significant and appreciable frequencies of two locus haplotypes associated with the disease. A few other short-distance haplotypes such as MICA*5A5.1TNFa*10 (P=0.014) and MICB*CA16TNFa*10 (P=0.014) revealed somewhat less statistically significant associations.
|
LD between loci/alleles
The two locus LD values obtained by disequilibrium statistic D' showed significant disequilibrium between almost all the various loci studied in the region (Table 4). The chromosomal region included in this study spans a region just over 1 Mb: nevertheless, even the loci farthest apart (MICA and HLA-DQB1) showed a weak but significant LD (P=0.019, D'=0.15), and the two closest loci MICBTNFa showed a high D' (0.56). LD to another predisposing locus in the region could therefore explain many of the haplotype associations.
|
While considering the individual alleles of a locus and their LD with alleles of another locus, only a few alleles showed significant LD. Haplotypes MICA*5A5.1MICB*CA19 (D'=0.68); MICB*CA16TNFa*10 (D'=0.48) and TNFa*10DRB1*15 (D'=0.17) showed significant positive LD with the latter two haplotypes being significant in TDT analysis as well. A few negative linkage disequilibria were also identified and many of them were very strong (D'=0.8 to 0.97).
HLADRB1*15MICA*5A5.1, MICA*5A5.1TNFa*10 and HLADRB1*15MICB*CA16 are significantly associated with leprosy susceptibility, have alleles associated with disease when considered independently but show no significant LD between them. It is therefore likely that the associations detected with the MICA and MICB genes are independent of those found elsewhere on the MHC.
In an attempt to test for the independent effect of the MICA and MICB loci, conditional logistic regression was carried out within the case/pseudocontrol framework (Supplementary Material, Tables S1 and S2). Each of the loci were first re-tested for their association using one case and three pseudocontrols and it was found that all of the alleles found to be significantly associated with disease using TRANSMIT were also associated in this analysis, with the exception of TNF*10 (P=0.066). The effects of the MICA and MICB loci were then conditioned upon the alleles present at the TNFa and HLA-DRB1 locus. The MICA and MICB associations were found to be independent of the TNFa locus and MICB was found to be independent of the effect seen at the HLA-DRB1*15(02) locus. However, due a drop in sample size with the HLA-DRB1 pair-wise combinations, there was not sufficient power to draw a definite conclusion and the HLA-DRB1 data should be interpreted with caution.
| DISCUSSION |
|---|
|
|
|---|
MICA polymorphism and leprosy susceptibility
The present study has provided strong evidence that there is a role for the truncated MICA protein, encoded by the MICA*5A5.1 allele, in leprosy susceptibility in South Indian families. Furthermore, alleles of a microsatellite that occurs within intron 1 of the MICB gene may also be associated with leprosy susceptibility. Many studies have detected associations of HLA-DR2 with leprosy and the finding that HLA-DR rather than DQ antigens are associated with disease is consistent with data indicating that the majority of restriction determinants for M. leprae reside on DR, and not DP or DQ molecules (19). Although we re-confirm here an association for HLA-DRB1 alleles with susceptibility to leprosy, the MICA and MICB genes identified in the present study may have a stronger effect in this population.
Our data show that there is significant LD between most of the loci examined, the extent of which varies within haplotypes. This makes it difficult to separate the effect of each locus. In particular, the TNF locus and the MICA and MICB genes are in strong LD. However, although both HLA-DRB1*15 and HLA-DRB1*09 show some LD with TNF*10, there is no LD with the MICA or MICB-associated alleles. This strongly suggests that that these loci are associated with susceptibility to leprosy, independently of HLA-DRB1. In addition, conditional logistic analysis showed that the MICA and MICB associations were independent of the TNFA locus, however, there was not sufficient power to draw a definite conclusion regarding their independence from HLA-DRB1.
We also find evidence that HLA-DRB1*09 may be associated with protection against leprosy. However, the frequency of the HLA-DRB1*09 allele is very low and, therefore, power to detect this association in previous studies would have been low.
The 308 promoter variant of the TNF gene has previously been found to be associated with leprosy in some populations (4) and with a variety of other infectious diseases (2022). However, we did not detect a genetic association in this population. We did, however, find that the TNFa microsatellite, located 3.5 kb upstream of the LTA gene, was associated with disease. Previous studies have found that haplotypes including the TNFa microsatellite locus did not alter LTA secretion but they did show differential levels of TNF secretion (23).
It is interesting that although we have detected disease associations in this region of chromosome 6, there was no significant linkage in a relatively large leprosy genome screen in this population (24). This is consistent with this locus not having a major effect on leprosy susceptibility and probably reflects in part the fact that affected sib pair studies have more power to detect recessive susceptibility effects (25). However, it may also relate to the very complex pattern of LD with multiple susceptibility loci that exists in this region.
The possible role of the MHC class I-related gene products in leprosy has yet to be investigated. However, it is known that these proteins are expressed in response to infection (26) and that cells expressing the molecules are then recognized by 
T cells, CD8+
ß T and NK cells, all of which likely have a role in overcoming mycobacterial infection or disease (27,28). A mechanism by which cytomegalovirus (CMV) evades the immune response has recently been suggested (29): the CMV UL16 protein was found to interfere with the T-cell activation functions of NKG2D, by binding the MICB protein and preventing its expression on the surface of the cell. A similar proteinprotein interaction has yet to be identified for MICA although other possible mechanisms by which MICA may suppress NKG2D signalling have been suggested.
A previous study of the MICA polymorphism in a South Chinese population found an association of the 5A5 allele with protection against the multibacillary form of leprosy (16). An association with paucibacillary leprosy, the predominant form in this study, was not detected but the sample size studied was extremely small (19 patients). The MICA*5A5.1 allele, associated with leprosy susceptibility in this much larger study, has a single G insertion occurring in a background of five alanine repeats, causing a frameshift mutation that results in a premature stop codon and a truncated transmembrane domain. This domain contains many highly hydrophobic amino acids that anchor the protein to the cell membrane, leading Mizuki et al. (30) to suggest that the 5A5.1 allele may encode a secreted protein. Indeed, a tumour-derived soluble form of MICA has been reported to lead to an impaired response by CD8
ß T cells and presumably NK cells (31). However, Salih et al. (31) found that the membrane-bound protein is cleaved by metalloproteinases and is independent of the allelic MICA differences, although the allele 5A5.1 was not specifically studied. More recent experiments have shown that the signal encoded by the cytoplasmic tail is required for determining MICA's physiological location on the basolateral membrane of cells, and in cells expressing the 5A5.1 variant protein MICA was instead transported to the apical surface (32). The importance of this incorrect localization is unclear, however, it has been suggested that individuals homozygous for the 5A5.1 variant could be defective in their immune surveillance mechanism.
The MIC molecules may have a role in the innate immune response to infection, however there are many questions that remain unanswered as to their mechanisms of action. The association of a truncated MICA protein with leprosy susceptibility highlights the importance of future work aimed at the identification of functionally relevant polymorphisms and characterization of the MICA and MICB proteins in disease pathogenesis. Identification of this disease association should also encourage the investigation of the immune response to mycobacteria by NKG2D-bearing cells. It is striking that the MICA allele associated with leprosy susceptibility is not only defective but has been found to be the most frequent allele in Caucasians (33) as well as in the South Indian population studied here. This suggests that this allele has been selected to high frequency despite its deleterious impact on leprosy susceptibility. This encourages assessment of the relevance of MICA polymorphism in other diseases to identify possible infectious agents that might have driven this selective process.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Patients
Two hundred and twenty three families consisting 230 leprosy-affected sib pairs were identified from patient records as described previously (24). The samples were collected from Kumbakonam and Sakthi Nagar provinces in Tamil Nadu, the southernmost part of India. Both of the parents were available in 196 families, 24 had only one parent and three had no parents available. In two of the families where no parents were available, additional unaffected siblings were included. All affected offspring had the paucibacillary form of leprosy except eight families where a single offspring was affected by multibacillary leprosy. All patients were diagnosed using WHO guidelines (http://www.afro.who.int/leprosy/strategy/defs-tech-guidelines.pdf). Considering the fact that most of the cases in high endemic areas were normally paucibacillary, a decision was made to include the cases with the earliest sign of infection, i.e. proven macular anaesthetic patch, mostly of tuberculoid and some borderline tuberculoid leprosy cases.
Genotyping
Semi-automated fluorescent genotyping was used to type the microsatellite markers. The primers for the TNFa microsatellite, 3.5 kb upstream of the LTA gene, have been described previously (34). The GCT repeat in exon 5 of the MICA gene (30) was amplified using the following primers. For 5' FAM-GAAAGTGCTGGTGCTTCAG and Rev 5' CTATCTTTGCAGGAGCAATG. The microsatellite repeat in intron 1 of the MICB gene (35) was amplified using the primers. For 5' HEX-GAGGAATCACCATAGTGTTTTC and Rev 5' CCAATCAGGGTGGCTATTATC. The promoter region of the TNF gene was amplified using the primers. For 5' GTGGGGAGAACAAAAGGATAAG and Rev 5' GATGTGGCGTCTGAGGGTTGTTTT. The 308 polymorphism (36) was then genotyped by the ligation detection reaction (LDR) (37) using the following probes: TNF-308.com 5' GGACGGGGTTCAGCCTCCAGGGAAAA, TNF-308.A 5' FAM-TAAAAGGCAATAGGTTTTGAGGGGCATGA and TNF-308.G 5' FAM-AAAGGCAATAGGTTTTGAGGGGCATGG. The microsatellite repeat lengths were confirmed by sequencing homozygous individuals with BigDye Terminators (Applied Biosystems). Sequencing, LDR and PCR products were analyzed by capillary electrophoresis using the ABI Prism 3700 DNA Analyzer (Applied Biosystems). Genotype analysis was carried out using Genotyper software (Applied Biosystems).
HLA genotyping
MHC class II, DRB1 and DQB1 genotyping was carried out using the PCR-SSOP method, employing XI IHWC primers and probes (17). Necessary quality control measures were followed to avoid misclassification errors: 13 reference DNA samples from 12th International Histocompatibility workshop were included along with our samples and the HLA-DRB1 and -DQB1 typing carried out. The concordance between the assignments obtained in the present study and the original assignments were 90%. A total of 15 probes for DRB1* locus and 18 probes to define DQB1* loci alleles, at the generic level (equivalent to serological definitions) were used. Among probes defining DRB1* alleles, four gave a probe versus alleles (assigned in the leprosy family members of the present study) r-value >0.9, eight gave >0.8, one >0.7 and two 0.5. Among DQB1 probes, three gave an r-value >0.9, four >0.8, three >0.7 and three 0.5. Rest of the probes could not be assigned with an r-value for lack of enough samples to calculate the r-value. Another seven probes were used to characterize the DR2 subtypes: probe 8603 was used to characterize DRB1*1501 and probe 8601 for DRB1*1502; selected alleles identified by these probes were further studied and confirmed by sequence-based typing. In our reference panel, the most common DR2 subtypes in this populations are DRB1* 15021 (13/20) and DRB1*15011 (5/20), and DRB1*1602 was rare (2/20) (38).
Statistical analysis
TDT of single locus and two locus (pair-wise) haplotypes were carried out using the program TRANSMIT (39,40). Haplotypes were constructed using Genehunter (41,42) and in addition, the parental haplotypes were then used to obtain LD statistics. Global LD values were calculated using HaploXT (43) and the LD between individual alleles were calculated using Arlequin (http://lgb.unige.ch/arlequin). Conditional logistic regression models were carried out using matched casepseudocontrol sets, where we generated up to three possible pseudocontrols for each case (44). The analysis was carried out using the rclogit command from the Genassoc package in Stata (http://www-gene.cimr.cam.ac.uk/clayton/software/). We used robust variance estimation to correct for the correlation between multiple affected siblings. In the conditional analyses, we compared the fit of models where the main effects at two loci are modelled to models that only include the main effects at the primary locus. Significance was assessed using the Wald test and the results are uncorrected for multiple testing.
| SUPPLEMENTARY MATERIAL |
|---|
|
|
|---|
Supplementary Material is available at HMG Online.
| ACKNOWLEDGEMENTS |
|---|
The authors are grateful to the patients, their families, physicians and volunteers for their valuable cooperation and participation in the study. They thank the Indian Council of Medical Research, New Delhi and Hindu Mission Hospital, Kumbakonam for their Ethical Committee Approval. This work was supported by Grants from Wellcome Trust and the Medical Research Council, UK. A.V.S.H. is a Wellcome Trust Principal Research Fellow.
Conflict of Interest statement. All the authors named on this publication have contributed to this study and there are no conflicts of interest.
| FOOTNOTES |
|---|
The authors wish it to be known that, in their opinion, the first two authors should be considered as joint First Authors.
Present Addresses: Kerrie Tosh, AstraZeneca, Mereside, Alderley Park, Macclesfield, Cheshire, SK10 4TG, UK; Muthuswamy Ravikumar, Department of Pathology, 323A, Health Science Research Facility, 89 Beaumont Avenue, Burlington, Vermont-05405, USA; Sarah Meisner, Bath Royal United Hospital Trust, Combe Park, Bath BA1 3NG, UK. ![]()
| REFERENCES |
|---|
|
|
|---|
- Chakravartti M.R. and Vogel F.A. (1973) A twin study on leprosy. In Becker P.E. (Ed.). Topics in Human Genetics (Georg Thieme, Stuttgart) 1: pp. 1123.
- Mohammed Ali P. and Ramanujam K. (1966) Leprosy in twins. Int. J. Lepr. 34:405406.
- Abel L. and Demenais F. (1988) Detection of major genes for susceptibility to leprosy and its subtypes in a Caribbean island: Desirade island. Am. J. Hum. Genet 42:256266.[Web of Science][Medline]
- Fitness J., Tosh K., Hill A.V. (2002) Genetics of susceptibility to leprosy. Genes Immun. 3:441453.[CrossRef][Web of Science][Medline]
-
Thole J.E., Janson A.A., Cornelisse Y., Schreuder G.M., Wieles B., Naafs B., de Vries R.R., Ottenhoff T.H. (1999) HLA-class II-associated control of antigen recognition by T cells in leprosy: a prominent role for the 30/31-kDa antigens. J. Immunol. 162:69126918.
[Abstract/Free Full Text] - Aarestrup F.M., Goncalves-da-Costa S.C., Sarno E.N. (1995) The effect of thalidomide on BCG-induced granulomas in mice. Braz. J. Med. Biol. Res. 28:10691076.[Web of Science][Medline]
- Grau G.E., Parida S.K., Pointaire P., Barnes P.F., Modlin R.L. (1992) Tumour necrosis factor-the molecules and their emerging role in medicine. In Beutler B. (Ed.). Biology of Tumor Necrosis Factors (Raven Press, New York) pp. 329340.
- Parida S.K., Grau G.E., Zaheer S.A., Mukherjee R. (1992) Serum tumor necrosis factor and interleukin 1 in leprosy and during lepra reactions. Clin. Immunol. Immunopathol. 63:2327.[CrossRef][Web of Science][Medline]
-
Barnes P.F., Chatterjee D., Brennan P.J., Rea T.H., Modlin R.L. (1992) Tumor necrosis factor production in patients with leprosy. Infect. Immun. 60:14411446.
[Abstract/Free Full Text] -
Bahram S., Bresnahan M., Geraghty D.E., Spies T. (1994) A second lineage of mammalian major histocompatibility complex class I genes. Proc. Natl. Acad. Sci. USA 91:62596263.
[Abstract/Free Full Text] - Steinle A., Li P., Morris D.L., Groh V., Lanier L.L., Strong R.K., Spies T. (2001) Interactions of human NKG2D with its ligands MICA, MICB, and homologs of the mouse RAE-1 protein family. Immunogenetics 53:279287.[CrossRef][Web of Science][Medline]
- Perez-Rodriguez M., Arguello J.R., Fischer G., Corell A., Cox S.T., Robinson J., Hossain E., McWhinnie A., Travers P.J., Marsh S.G., Madrigal J.A. (2002) Further polymorphism of the MICA gene. Eur. J. Immunogenet. 29:3546.[CrossRef][Web of Science][Medline]
- Stephens H.A. (2001) MICA and MICB genes: can the enigma of their polymorphism be resolved? Trends Immunol. 22:378385.[CrossRef][Web of Science][Medline]
- Gonzalez S., Martinez-Borra J., Lopez-Vazquez A., Garcia-Fernandez S., Torre-Alonso J.C., Lopez-Larrea C. (2002) MICA rather than MICB, TNFA, or HLA-DRB1 is associated with susceptibility to psoriatic arthritis. J. Rheumatol. 29:973978.[Web of Science][Medline]
- Gonzalez S., Brautbar C., Martinez-Borra J., Lopez-Vazquez A., Segal R., Blanco-Gelaz M.A., Enk C.D., Safriman C., Lopez-Larrea C. (2001) Polymorphism in MICA rather than HLA-B/C genes is associated with psoriatic arthritis in the Jewish population. Hum. Immunol. 62:632638.[CrossRef][Web of Science][Medline]
- Wang L.M., Kimura A., Satoh M., Mineshita S. (1999) HLA linked with leprosy in southern China: HLA-linked resistance alleles to leprosy. Int. J. Lepr. Other Mycobact. Dis. 67:403408.[Web of Science][Medline]
- Ravikumar M., Dheenadhayalan V., Rajaram K., Lakshmi S.S., Kumaran P.P., Paramasivan C.N., Balakrishnan K., Pitchappan R.M. (1999) Associations of HLA-DRB1, DQB1 and DPB1 alleles with pulmonary tuberculosis in south India. Tubercle. Lung. Dis. 79:309317.[CrossRef][Medline]
- Shanmugalakshmi S., Balakrishnan K., Manoharan K., Pitchappan R.M. (2003) HLA-DRB1*, -DQB1* in Piramalai Kallars and Yadhavas, two Dravidian speaking castes of Tamil Nadu, south India. Tissue Antigens 61:451464.[CrossRef][Web of Science][Medline]
- Ohyama H., Matsushita S., Nishimura F., Kato N., Hatano K., Takashiba S., Murayama Y. (2001) T cell responses to major membrane protein II (MMP II) of Mycobacterium leprae are restricted by HLA-DR molecules in patients with leprosy. Vaccine 20:475482.[CrossRef][Web of Science][Medline]
-
Cabrera M., Shaw M.A., Sharples C., Williams H., Castes M., Convit J., Blackwell J.M. (1995) Polymorphism in tumor necrosis factor genes associated with mucocutaneous leishmaniasis. J. Exp. Med. 182:12591264.
[Abstract/Free Full Text] - McGuire W., Hill A.V., Allsopp C.E., Greenwood B.M., Kwiatkowski D. (1994) Variation in the TNF-alpha promoter region associated with susceptibility to cerebral malaria. Nature 371:508510.[CrossRef][Medline]
- Nadel S., Newport M.J., Booy R., Levin M. (1996) Variation in the tumor necrosis factor-alpha gene promoter region may be associated with death from meningococcal disease. J. Infect. Dis. 174:878880.[Web of Science][Medline]
- Pociot F., Briant L., Jongeneel C.V., Molvig J., Worsaae H., Abbal M., Thomsen M., Nerup J., Cambon-Thomsen A. (1993) Association of tumor necrosis factor (TNF) and class II major histocompatibility complex alleles with the secretion of TNF-alpha and TNF-beta by human mononuclear cells: a possible link to insulin-dependent diabetes mellitus. Eur. J. Immunol. 23:224231.[Web of Science][Medline]
- Siddiqui M.R., Meisner S., Tosh K., Balakrishnan K., Ghei S., Fisher S.E., Golding M., Shanker Narayan N.P., Sitaraman T., Sengupta U., Pitchappan R.M., Hill A.V. (2001) A major susceptibility locus for leprosy in India maps to chromosome 10p13. Nat. Genet. 27:439441.[CrossRef][Web of Science][Medline]
- Feingold E. and Siegmund D.O. (1997) Strategies for mapping heterogeneous recessive traits by allele-sharing methods. Am. J. Hum. Genet. 60:965978.[Web of Science][Medline]
- Groh V., Rhinehart R., Randolph-Habecker J., Topp M.S., Riddell S.R., Spies T. (2001) Costimulation of CD8alphabeta T cells by NKG2D via engagement by MIC induced on virus-infected cells. Nat. Immunol. 2:255260.[CrossRef][Web of Science][Medline]
- Bermudez L.E. and Young L.S. (1991) Natural killer cell-dependent mycobacteriostatic and mycobactericidal activity in human macrophages. J. Immunol. 146:265270.[Abstract]
-
Yoneda T. and Ellner J.J. (1998) CD4(+) T cell and natural killer cell-dependent killing of Mycobacterium tuberculosis by human monocytes. Am. J. Respir. Crit. Care Med. 158:395403.
[Abstract/Free Full Text] -
Wu J., Chalupny N.J., Manley T.J., Riddell S.R., Cosman D., Spies T. (2003) Intracellular Retention of the MHC Class I-Related Chain B Ligand of NKG2D by the Human Cytomegalovirus UL16 Glycoprotein. J. Immunol. 170:41964200.
[Abstract/Free Full Text] -
Mizuki N., Ota M., Kimura M., Ohno S., Ando H., Katsuyama Y., Yamazaki M., Watanabe K., Goto K., Nakamura S., Bahram S., Inoko H. (1997) Triplet repeat polymorphism in the transmembrane region of the MICA gene: a strong association of six GCT repetitions with Behcet disease. Proc. Natl. Acad. Sci. USA 94:12981303.
[Abstract/Free Full Text] -
Salih H.R., Rammensee H.G., Steinle A. (2002) Cutting edge: down-regulation of MICA on human tumors by proteolytic shedding. J. Immunol. 169:40984102.
[Abstract/Free Full Text] -
Suemizu H., Radosavljevic M., Kimura M., Sadahiro S., Yoshimura S., Bahram S., Inoko H. (2002) A basolateral sorting motif in the MICA cytoplasmic tail. Proc. Natl. Acad. Sci. USA 99:29712976.
[Abstract/Free Full Text] - Petersdorf E.W., Shuler K.B., Longton G.M., Spies T., Hansen J.A. (1999) Population study of allelic diversity in the human MHC class I-related MIC-A gene. Immunogenetics 49:605612.[CrossRef][Web of Science][Medline]
-
Jongeneel C.V., Briant L., Udalova I.A., Sevin A., Nedospasov S.A., Cambon-Thomsen A. (1991) Extensive genetic polymorphism in the human tumor necrosis factor region and relation to extended HLA haplotypes. Proc. Natl. Acad. Sci. USA 88:97179721.
[Abstract/Free Full Text] - Kimura T., Goto K., Yabuki K., Mizuki N., Tamiya G., Sato M., Kimura M., Inoko H., Ohno S. (1998) Microsatellite polymorphism within the MICB gene among Japanese patients with Behcet's disease. Hum. Immunol. 59:500502.[CrossRef][Web of Science][Medline]
-
Wilson A.G., di Giovine F.S., Blakemore A.I., Duff G.W. (1992) Single base polymorphism in the human tumour necrosis factor alpha (TNF alpha) gene detectable by NcoI restriction of PCR product. Hum. Mol. Genet. 1:353.
[Free Full Text] - Day D.J., Speiser P.W., White P.C., Barany F. (1995) Detection of steroid 21-hydroxylase alleles using gene-specific PCR and a multiplexed ligation detection reaction. Genomics 29:152162.[CrossRef][Web of Science][Medline]
- Ravikumar M. The immunogenetics of mycobacterial susceptibility in S.India. Ph.D., Thesis submitted to,(Madurai Kamaraj University, India).
- Clayton D. (1999) A generalization of the transmission/disequilibrium test for uncertain- haplotype transmission. Am. J. Hum. Genet. 65:11701177.[CrossRef][Web of Science][Medline]
- Spielman R.S., Mc Ginnis R.E., Ewens W.J. (1993) Transmission test for linkage disequilibrium: the insuling gene region and insulin-dependent diabetes mellitus (IDDM). Am. J. Hum. Genet. 52:506516.[Web of Science][Medline]
- Kruglyak L., Daly M.J., Reeve-Daly M.P., Lander E.S. (1996) Parametric and nonparametric linkage analysis: a unified multipoint approach. Am. J. Hum. Genet. 58:13471363.[Web of Science][Medline]
- Kruglyak L. and Lander E.S. (1998) Faster multipoint linkage analysis using Fourier transforms. J. Comput. Biol. 5:17.[Web of Science][Medline]
-
Abecasis G.R. and Cookson W.O. (2000) GOLDgraphical overview of linkage disequilibrium. Bioinformatics 16:182183.
[Abstract/Free Full Text] - Cordell H.J. and Clayton D.G. (2002) A unified stepwise regression procedure for evaluating the relative effects of polymorphisms within a gene using case/control or family data: application to HLA in type 1 diabetes. Am. J. Hum. Genet. 70:124141.[CrossRef][Web of Science][Medline]
-
van der Slik A.R., Shing D.C., Eerligh P., Giphart M.J. (2000) Subtyping for TNFa microsatellite sequence variation. Immunogenetics 52:2934.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
J. M. Blackwell, S. E. Jamieson, and D. Burgner HLA and Infectious Diseases Clin. Microbiol. Rev., April 1, 2009; 22(2): 370 - 385. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

