Skip Navigation


Human Molecular Genetics Advance Access originally published online on September 19, 2006
Human Molecular Genetics 2006 15(21):3168-3176; doi:10.1093/hmg/ddl393
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
15/21/3168    most recent
ddl393v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Guzmán, M. A.
Right arrow Articles by Osada, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guzmán, M. A.
Right arrow Articles by Osada, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Cystathionine ß-synthase is essential for female reproductive function

Mario A. Guzmán1, María A. Navarro1, Ricardo Carnicer1, Alfonso J. Sarría1, Sergio Acín1, Carmen Arnal3, Pedro Muniesa2, Joaquín C. Surra1, José M. Arbonés-Mainar1, Nobuyo Maeda4 and Jesús Osada1,*

1 Departamento de Bioquímica y Biología Molecular y Celular, 2 Departamento de Anatomía y Embriología and 3 Departamento de Patología Animal, Facultad de Veterinaria, Universidad de Zaragoza, Miguel Servet 177, E-50013 Zaragoza, Spain and 4 Department of Pathology, University of North Carolina at Chapel Hill, USA

* To whom correspondence should be addressed. Tel: +34 976761644; Fax: +34 976761612; Email: josada{at}unizar.es

Received August 31, 2006; Accepted September 11, 2006


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In human reproduction, hyperhomocysteinemia has been reported as a risk factor for early pregnancy loss and congenital birth defects. Hyperhomocysteinemia is also recognized as a cause of maternal obstetric complications such as preeclampsia. The role of plasma hyperhomocysteinemia in female fertility was examined using cystathionine beta synthase knockout (cbs KO) mice. Cbs KO females were infertile, showed alterations in the estrus cycle and an increased progesterone response during pseudo-pregnancy induction. Both cbs KO ovaries and ovulated oocytes showed no major morphological alterations. However, placental and uterine masses were decreased at day 18 of pregnancy and showed morphological abnormalities. In cbs-KO pregnant females, the number of uterine implantation sites was not decreased despite the low number of surviving embryos. Fertility was restored when cbs-deficient ovaries were transplanted to normal ovarectomized recipients. We detected an increased uterine expression of Grp78, a marker of endoplasmic reticulum stress, which was accompanied by the decreased levels of uterine cbs mRNA in both hyperhomocysteinemic heterozygous (fertile) and homozygous (non-fertile) females. Our results indicate that cbs –/– female infertility is a consequence of the uterine failure and demonstrate that uterine endoplasmic reticulum stress and cbs expression are not determinant of infertility, suggesting that uterine dysfunction is a consequence of either hyperhomocysteinemia or other factor(s) in the uterine environment of cbs –/– animals. In summary, these studies demonstrate the potential importance of homocysteine levels for uterine handling of embryos.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In epidemiological and meta-analysis studies, hyperhomocysteinemia has been found to be a risk factor for placental-mediated diseases, such as preeclampsia, spontaneous abortion and placental abruption (1,2). In case–control studies, it has been reported that homocysteine levels are frequently elevated in pregnancies complicated by preeclampsia or umbilical placental vascular disease over those present in the normal pregnancy group (35).

Homocysteine is a non-protein sulfur amino acid whose utilization through the trans-sulfuration pathway is its main metabolic fate, requiring the activity of cystathionine ß-synthase. Alternatively, Hcy can be converted to methionine through the remethylation pathway. Two metabolic reactions using different methyl donors are known: one uses betaine and the reaction is catalyzed by betaine: homocysteine methyltransferase, and the other catalyzed by 5-methyltetrahydrofolate: homocysteine methyltransferase uses as donor 5-methyltetrahydrofolate (6). These metabolic pathways are expressed in different tissues during development. Thus, cystathionine ß-synthase is expressed in liver and decidual tissue, whereas methionine synthase is expressed in all embryonic tissues, being the liver the primary site of activity for these enzymes (7,8). Mice deficient in cbs enzyme develop hyperhomocysteinemia and provide an extraordinary tool to evaluate its effects during pregnancy. Embryonic development of homozygous animals lacking the enzyme appears to be normal (9) but there is an increased mortality during postnatal development that results in the death of 90% of the mice by day 21. Animals surviving this critical period usually become adults, but males are fertile and females are not. The availability of these females allows us to evaluate the role of hyperhomocysteinemia in female infertility and to define the molecular and cellular events that may be involved. The endeavor to characterize those events is the basis of the present report.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Reproductive phenotype of cbs female mutants
In a continuous six-month mating study, males lacking cbs were normally fertile (Table 1), as judged by test matings with known fertile females during which they produced litters in due time, with an average litter size of six pups. On the other hand, females lacking cbs showed a significantly decreased number of pups per litter (P<0.001), since five homozygous females had only two born pups, which died soon after birth, compared with 39 for heterozygous cbs females (Table 1). Thus, the homozygous cbs females exhibit infertility despite the detection of vaginal plugs on multiple occasions, demonstrating that the infertility was not caused by any impairment of sexual behavior. When the exploration of the hypothalamic/pituitary-ovarian axis was assessed, after mating females with vasectomized mice, it revealed significantly higher plasma progesterone levels 6 days after mating in pseudo-pregnant KO females than in their normal counterparts (Fig. 1A), suggesting that the hormonal milieu in the –/– animals is not normal. Consequently, we next analyzed the ovaries to determine whether any defects in ovarian structure and function could be indicative of ovarian failure. We found no obvious histological abnormalities in cbs KO ovaries after normal estrus (Fig. 1B and C) or after superovulation experiments (Fig. 1D and E). However, although morphologically normal corpora lutea were present in the ovaries of stimulated cbs –/– females, suggesting that follicles responded to the ovulatory surge of hCG, there was a decreased number of developed follicles with respect to wild-type females, indicating a diminished response to pregnant mare serum gonadotropin. Histochemical analysis of ovaries from superovulated females also showed an increased Oil red O staining of lipids in the ovarian corpora lutea of cbs KO relative to those of wild-type animals (data not shown). Although the cause for this difference in lipid accumulation in response to superovulation remains unknown, it appears to suggest that no defect on cholesteryl ester storage, necessary to sustain adequate steroid hormone production for pregnancy, underlies female cbs KO infertility. When the estrus cycle was studied, we detected a shortened and irregular estrus cycle in infertile cbs KO females (Table 2), with a decreased time of estrus and diestrus periods, and a prolonged metestrus. However, these differences in estrus cycle had no effect over the number of oocytes ovulated during normal estruses, although the yield was significantly lower when cbs-deficient females were superovulated (Table 3). Oocytes presenting morphological alterations were absent in females of both genotypes in pseudo-pregnancy experiments (data not shown) and represented an equal proportion (8% of total oocyte count) in superovulation experiments for both genotypes. No differences in collected oocytes were observed between the two genotypes attending to the presence of polar extrusion body either during normal estrus (58±7% for control versus 60±7 for cbs-deficient mice) or superovulation (36±6% for control versus 40±7 for cbs-deficient mice) experiments. No differences regarding internal diameter of oocytes showing polar body were observed between the two genotypes [85±3 and 84±4 µm for control (n=62) and cbs-deficient (n=32) mice, respectively] in pseudo-pregnancy and supervolulation experiments. However, we observed that the perivitelline space was higher in cbs deficient than in control oocytes in both types of experiments (Fig. 1F and G).


Figure 3931
View larger version (57K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. Histological and functional analysis of ovaries. (A) Plasma progesterone concentrations from pseudo-pregnant females at day 6 after mating with vasectomized males, (n=10 and 6 for wild-type and cbs –/–, respectively; *P<0.05). Hematoxylin and eosin-stained sections of adult wild-type (B) and cbs –/– (C) ovaries at 400x, showing a follicle. Histological sections of a representative ovary from an immature wild-type female (D) and from an immature cbs –/– female (E) both after superovulation. Phase-contrast microscopy of oocytes devoid of cumulus from wild-type (F) or cbs –/– (G).

 


View this table:
[in this window]
[in a new window]

 
Table 1. Evaluation of reproductive performance in female according to genotype

 


View this table:
[in this window]
[in a new window]

 
Table 2. Characteristics of the estrus cycle according to genotype

 


View this table:
[in this window]
[in a new window]

 
Table 3. Ovulation pattern according to genotype in the experimental conditions

 
Exploration of pregnancy
Since there were no apparent differences between normal and cbs KO females with respect to the extent of normal ovulation and number of oocytes harvested after natural mating, we analysed uteri of gravid females at the 18th day postmating (Table 4). A striking significant decrease in mass of gravid uterus was found in cbs –/– compared with wild-type females. In addition, there was a dramatic decrease in the percentage of surviving fetuses in homozygous pregnant females despite a similar number of implantation sites. The similar number of implantation sites (Table 4) observed in wild-type and cbs-deficient mice supports the notion that the minimal morphological alterations of cbs KO oocytes are not responsible for cbs-deficient female infertility. However, histological evaluation of uterus (Fig. 2A and B) disclosed a normal endometrium, muscular layer and perimetrium. The decrease in gravid uterine weight was accompanied by significant decreases in placental and fetal weights (Table 4 and Fig. 2C and D) during cbs KO pregnancies when compared with control animals. Cbs KO embryos showed a Theiler Stage of 24–25 (Fig. 2C and D) compared with the 26 of wild-type embryos. Histological assessment of placentas disclosed some abnormalities in 18th day placentas from cbs –/– when compared with wild-type females (Fig. 3A and B). The thickness of the decidual layer was reduced in placentas from cbs –/– females, indicating reduced trophoblast invasion in these females. The labyrinthine zone was enlarged, whereas the junctional zone was smaller in placentas from cbs-deficient females. That these changes are an unlikely result from lack of cbs expression in placental tissue of cbs –/– embryos would appear to be indicated by the very low levels of cbs transcripts detected in placentas from normal animals by semi-quantitative RT–PCR (data not shown). Placental cbs expression was found to be even lower than uterine expression (discussed subsequently), suggesting that cbs may not be a major determinant of placental function at the moment studied.


Figure 3932
View larger version (98K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. Uterine histology in cbs mice. Hematoxylin and eosin-stained sections of wild-type (A) and cbs –/– (B) uteri from day 18 of gestation at 100x magnification. Embryos were collected from normal (C) or cbs –/– (D) at day 18 of gestation. Appearance of uterine horns carrying embryos at 18th day of gestation from normal (E) or cbs –/– (F) with resorbing sites stained with ammonium sulfide.

 


Figure 3933
View larger version (75K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3. Placental histology in cbs mice. Hematoxylin and eosin-stained placental sections of (A) wild-type, (B) cbs –/– and (C) cbs–/– placenta obtained from a cbs–/– ovary transferred to a wild-type female recipient taken at day 18 of gestation and observed at 40x. The different layers of the mouse placenta are shown (d, decidual; j, junctional; l, labyrinthine).

 


View this table:
[in this window]
[in a new window]

 
Table 4. Evaluation of pregnancy characteristics at day 18 of gestation

 
To further discriminate between uterine or placental contributions to the pregnancy failure observed in cbs deficiency, ovary transplantation experiments were performed. The data obtained from these experiments are shown in Table 5. Once the cbs –/– ovary was transferred to the environment of a wild-type or heterozygous animal, both the size of the offspring and the percentage of surviving animals were indistinguishable from those of female recipients of cbs +/+ ovaries, used as controls of the surgical procedure. No significant differences in placental function could be drawn to placental genotype, as the average liter size was similar for recipients of +/+ ovaries mated with +/+ males (+/+ placentas) and recipients of cbs –/– ovaries mated with either cbs –/– (–/– placentas) or wild- type males (+/– placentas). In addition, the histological abnormalities observed in cbs –/– placentas at day 18 were recovered when these were obtained from the mice obtained by cbs –/– ovary transferred to wild-type recipients and mating to homozygous males (Fig. 3C). Taken together, the low placental cbs transcript levels detected, and more importantly, the ovary transplantation experiments demonstrate that cbs placental expression are dispensable in order to get pregnancy success and corroborates that the oocytes produced by the cbs-deficient ovary are quite functional, since the liter size was identical between both genotypes (Table 5). Altogether, our results indicate that uterine failure in cbs –/– females is likely the main cause of infertility.


View this table:
[in this window]
[in a new window]

 
Table 5. Evaluation of reproductive performance in transplanted females

 
Uterine endoplasmic reticulum stress
To evaluate whether uterine dysfunction could be caused by ERS, Western blotting analysis of Grp78 in uterine homogenates was carried out. As shown in Figure 4A, different expression levels of GRP78 were observed depending on the underlying uterine genotype. Homozygous and heterozygous animals showed elevated levels of the GRP78 protein considered being a marker of ERS. To explore whether ERS could be related directly to decreased cbs expression, and since cbs mRNA levels were below detection using northern blotting analysis (data not shown), we performed semi-quantitative RT–PCR. As shown in Figure 5A, expression levels of cbs mRNA in uteri from normal pregnant females were significantly lower than those present in liver, whereas, as expected, no cbs transcripts could be detected in cbs –/– uteri. We also detected a marked decrease in cbs mRNA levels in heterozygous animals with respect to controls (Fig. 5C). These data indicate that uterine ERS is accompanied by decreased cbs expression in both cbs +/– and –/– animals. However, whether or not there is any causal relationship between ERS and decreased cbs expression, uterine stress cannot by itself be the cause of infertility, since cbs +/– females are fertile despite the presence of ERS to levels similar of those present in cbs –/– infertile females. Our data also indicate that uterine cbs expression may be dispensable for the function of this organ during pregnancy, given that no major changes in cbs transcription associated with pregnancy, as similar low levels of cbs transcripts were detected in uteri from normal pregnant and non-pregnant females (Fig. 5B). This view appears also to be supported by the fact that some KO females are able to deliver in the absence of CBS expression (Table 1). Taken together, our data indicate that cbs –/– uterine dysfunction during pregnancy does not likely result from the lack of cbs expression in this organ. Instead, it appears to be caused by alterations of the internal milieu in these animals, making hyperhomocysteinemia alone, or together with some other cbs –/– induced alteration, a good candidate for uterine failure during pregnancy in this animal model.


Figure 3934
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4. Characterization of ER stress according to genotype in uterus. Western blot of Grp78 according to genotype. Asterisk and degress P<0.05 versus wild-type and +/–, respectively, according to one-way ANOVA.

 


Figure 3935
View larger version (43K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5. Expression of the cbs gene in function of genotype and physiological conditions. (A) Expression of cbs gene in uterus and liver. (B) Expression of uterine cbs gene in pregnant (Up) and non-pregnant (Unp) mice. (C) Expression of uterine cbs gene according to genotype.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
This paper attempts to deepen our understanding of female infertility in cbs-deficient mice. Using diverse observations such as mating monitorization, ovulatory patterns, histological studies, ovary transplantation and molecular biology analysis, cbs KO female infertility may be assigned to a failure in uterine handling of embryos.

Female infertility is a complex process in which several organs such as the hypothalamus, hypofisis, ovaries, uteri and embryonic placenta (10,11) could be involved. Our exploration of the coordinate action of the hypothalamus/pituitary-ovarian axis through the induction of pseudo-gestation indicates that cbs KO females have an impaired response at this level, since cbs –/– females showed an increased production of progesterone with respect to control animals (Fig. 1), suggesting that corpus luteum is maintained longer and/or progesterone is poorly removed in these animals. Estrous cyclicity is also a reflection of the function of the hypothalamic/hypophyseal-ovarian axis. The extension of metestrous 1 and 2, phases characterized by the presence of leukocytosis associated with cornified cells, may indicate a normal production of estradiol but a resistance to luteolytic rupture (12). These data are in agreement with the observation of higher progesterone levels in pseudo-pregnant cbs KO females (Fig. 1) and suggest an unbalanced level of estradiol versus progesterone that could induce the observed shortening of estrous cycle by eliciting the gonadotropin surge. Indeed, the observation of normal numbers of maturing follicles in all stages of development strongly suggests an adequate synthesis of estradiol in cbs KO females. Several of our observations, such as number of oocytes harvested after natural mating, normal histology of the ovaries and restoration of normal pregnancies after ovary transplantation experiments, are indicating a correct structural organization and function of this organ. Moreover, the ovaries by themselves, although influencing the female reproductive performance, are not the cause for cbs KO infertility, on the basis of the data obtained from ovary transplantation experiments into normal or mild hyperhomocysteinemic recipients. Despite this conclusion, the insufficient response to the superovulation challenge and the abnormal estrus cycles indicates that ovaries are susceptible to environmental cues present in cbs KO mice, such as hyperhomocysteinemia. Although it may not be the cause of the pregnancy failure, it may affect uterine receptivity and pregnancy maintenance. The latter observations may have potential clinical implications, since women experiencing metabolic problems similar to those found in cbs –/– females, and undergoing artificial reproductive technology, may have to suffer the inconveniences of having to collect an adequate number of oocytes to use for in vitro fertilization and more difficulties to synchronize hormonal therapy.

A candidate target organ to develop problems upon cbs loss of function is the placenta, since placental abruption in humans is associated with hyperhomocysteinemia (1,2). Our experimental data indicate that in cbs KO females, there is a decrease of placental mass that correlates with the presence of weakened layers on histological observation. However, the occurrence of normal pregnancies in recipients of cbs –/– ovaries mated with cbs –/– males, where placenta belongs to cbs –/– genotype, indicates that placental abnormalities detected in cbs KO females are not a consequence of embryo cbs deficiency, and that cbs heterozygosity of the placental donor cell genome is not critical for fetal survival. Indeed, the normal development of –/– embryos and the normal liter size in recipients of cbs –/– ovaries with respect to control animals points to the cbs –/– uterus as the site of primary failure. The differences in weight of gravid uteri between wild-type and homozygous cbs-deficient mice at day 18 of gestation and the striking differences in the percentages of surviving fetuses are all indicative of an important problem concerning the uterus. In addition, neither fertilization nor embryo implantation appears to be substantially compromised in cbs –/– females, as suggested by the existence of similar numbers of implantation sites between normal and mutant animals (Table 4). However, the existence of a complicated implantation can be inferred by the appearance of a delayed embryological stage of cbs –/– embryos (Fig. 2D). Likewise, data from ovary transplantation into normal or cbs +/– females confirm that mild hyperhomocysteinemia does not preclude successful fertilization of oocytes by spermatozoa and suggest that it is not the cause for cbs KO female infertility.

Deciphering the molecular events involved in reproductive physiology is an interesting arena where transgenic and knockout mice are very useful models. Thus, it has been found that defects in preantral and antral follicle growth associate with different molecules, and molecules implicated in ovulation and corpus luteum have been characterized (10). Implantation failure has been associated with the absence of progesterone receptor A and gp130—a signaling mediator of LIF. Improper decidualization was found in mice lacking IL-11R{alpha}. Both phenomena were reported in COX2 and in cannabinoid receptor KO animals (11). Taking into consideration this scenario, our data provide a new molecular paradigm in which normally implanted, well-decidualized mice die from a failure in uterine handling due either to (i) a primary uterine defect caused by the total absence of cbs expression in this organ or (ii) uterine failure secondary to internal milieu alterations in these mice. Although we cannot exclude the first possibility, the fact that uterine cbs mRNA expression levels are very low—at least two orders of magnitude lower than cbs liver transcript levels—that there are no major changes during pregnancy and that some females are able to deliver would suggest that cbs expression may be dispensable for uterine function. That this assumption could be correct appears to be sustained also by the fact that lower than normal levels of uterine cbs mRNA, like those present in cbs +/– females, are compatible with uterine reproductive fitness in these animals. Therefore, we suggest that uterine failure is secondary to alterations in the internal milieu of cbs –/– females. Severe hyperhomocysteinemia is a good candidate to be the cause underlying uterine malfunctioning in homozygous cbs-deficient mice. A potential mechanism for uterine dysfunction mediated by hyperhomocysteinemia is likely to be related with an impairment of the endothelial-dependent vasodilatation response, since it has been reported that arteries of pregnant mice are more sensitive to the effects of increased homocysteine than arteries from nonpregnant mice (13). Our data also indicate the existence of uterine ER stress in both heterozygous- and homozygous-deficient mice, since Grp78 (Fig. 4A) was increased without alteration of Grp94 (data not shown). It has been claimed that sensitive organs, developing ER stress, firstly increase the former chaperone (14) what would classify uterus in this category. However, the marked increase of Grp78, as indicative of ER stress, in heterozygous uterus of fertile females indicates that this phenomenon is not relevant to the process of uterine handling of embryos and that moderate levels of homocysteine in vivo (~15 µM) are at least as effective as severe hyperhomocysteinemia (~200 µM) in arising intracellular signaling. An observation already found by other authors in other cell types (15).

Mammalian female fertility depends on complex interactions between the reproductive organs and their environment. Since liver is the primary site of cbs activity (16), its functional loss could, by inducing alterations of the internal milieu (i.e. hyperhomocysteinemia), be the underlying cause of cbs KO uterine dysfunction. This would imply the potential existence of a defective hepatic-uterine axis in cbs KO mice, just as a defective hepatic-ovarian axis has been suggested to underlie female infertility caused by abnormal HDLs in the SR-B1 KO mice (17). In addition, considering that the basal metabolic rate per gram of body weight—the mass-specific rate—is seven times greater or even higher in mice than in humans (18), the effects observed in mice at the level of 200 µM homocysteine may be observed in humans at the level of ~20 µM. This level can be easily presented in some common mutations of the CBS gene in the human population (19,20) and whose levels may be aggravated in the presence of some environmental habits (21). Therefore, our data could contribute to understand the human fertility failure associated with hyperhomocysteinemia and thus may help to overcome it. Although additional mechanistic studies are necessary, the current data unequivocally establish that hyperhomocysteinemia is important for normal uterine embryonic development and female fertility in mice.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Animals
Generation of cbs-deficient mice was as described (9). Heterozygous and homozygous cbs 5–6-week-old mice were used in natural matings. CBS-deficient mice (mixed C57BL/6Jx129Ola background) were housed and fed a normal chow diet and drinking water supplemented with 0.5% (wt/wt) choline chloride (Sigma Chemical Co., Madrid, Spain). All animal studies were approved by the Ethical Committee for Animal Research of the University of Zaragoza.

PCR genotyping
Three oligonucleotides were used in PCR amplification of tail DNA to detect both the endogenous and altered cbs genes simultaneously. The sense primer was 5'-cbs (GAAGTGGAGCTATCAGAGCA). Downstream primers were neo (GAGGTCGACGGTATCGATA) and 3'-cbs (CGGATGACCTGCATTCATCT) specific for the endogenous and altered cbs genes, respectively. PCR amplification results in a 0.5-kb band from the wild-type gene and a 0.4 kb band from the knockout gene. PCR amplification was carried out as follows: 94°C for 1 min; 94°C for 20 s; 59°C for 30 s; 72°C for 30 s for 45 cycles, followed by a 5 min elongation period at 72°C.

Estrous cycles analysis and fertility assessment
Estrous cycles were monitored by daily vaginal smears from mutant and control mice over a period of 1 month. A small drop of sterile saline was flushed into the vagina and then dried on a slide. Cells were fixed in methanol for 40 s, stained with 0.8% eosin for 40 s and 0.2% azur B for another 40 s and rinsed to remove excess stains. Smears were taken daily between 9 and 10 a.m. Smears were evaluated by two experienced observers blinded to the genotype of the mice (12). To assess the fertility of female mice, virgin females were housed continuously with wild-type or mutant males, and numbers of litters and pups were counted for 6 months.

Superovulation, pseudo-pregnancy, hormonal assays and oocyte analysis
Superovulation was induced in immature (22–23 days old) mice by i.p. injections of 5 U of pregnant mare's serum gonadotropin (Folligon, Intervet, Boxmeer, The Netherlands), followed by 5 U of human chorionic gonadotropin (Chorulon, Intervet) 48 h later (22). Pseudo-pregnancy was induced by mating (confirmed by inspection of vaginal seminal plug) with vasectomized males and estimation of serum progesterone 6 days after. Progesterone concentrations were assayed with an analyzer using a commercial kit (IMMULITE 2000, Diagnostic Products Corporation, Los Angeles, CA, USA) validated for mouse sera. In both superovulation and pseudo-pregnancy experiments, oviducts were collected. Once recovered from the oviduct, the cumulus–oocyte complexes were treated with 3 mg/ml hyaluronidase in the M2 medium for 5 min at room temperature to liberate the oocytes. These were washed three times with fresh medium to remove hyaluronidase and transferred to a drop of M2 medium covered with paraffin. A complete fresh observation of specimens utilizing a Leica Wild M650 binocular microscope was achieved rotating them. Images were captured using a Canon digital camera. Morphometric analyses were performed using NIH Image software conveniently calibrated with micrometric ocular. Those oocytes presenting morphological alterations were considered as abnormal (22). Each sample was assayed for number of oocytes collected, the presence of oocytes with polar body extrusion and the internal oocyte diameter.

Ovary transplantation
Donor cbs KO or control wild-type mice of similar age and from the same breeding (5–6 weeks of age) were sacrificed by cervical dislocation, and the ovaries were removed. Ovaries were maintained in PBS until required for transfer. Hosts were anesthetized with 2.5% avertin (intraperitoneally), and ovary transfer surgery was performed as described previously (22). Basically, ovaries of the host mice were carefully dissected from the surrounding ovarian bursa. Half-ovary from the donor mice was then inserted into the ovarian bursa. Transplanted hosts were mated with cbs KO or wild-type males 2 weeks after surgery and tested for fertility. The offspring was genotyped as described earlier.

Presence of sperm in the isthmus and embryo implantation analysis
Twelve hours after observation of vaginal seminal plug, sperm from itsmus was flushed into phosphate buffered medium and semi-quantitatively assessed. At 18 days of postcoitum, pregnant mothers were anesthetized with 2.5% avertin and sacrificed. Ovaries and uterus were harvested. Once the amniotic sacs and placenta were removed, the gravid uteri were weighted and prepared for sectioning as described subsequently. Placentas and fetuses were also weighted. Live and dead fetuses were scored and the number of implant sites analyzed after immersion of uteri in 0.5% ammonium sulfide solution for 10 min (23).

Histology
Paraffin sections (4 µm) of cbs and WT tissues were stained with hematoxylin and eosin.

Assesment of cbs transcript levels by semi-quantitative RT–PCR
At the moment of sacrifice, organs were obtained and quickly frozen in liquid nitrogen. Total RNA from liver or uteri from 18 days of gestational animals was extracted using Trigent reagent MRC (Sigma, Madrid, Spain) (24). Semi-quantitative RT–PCR was performed using the enhanced avian HS RT–PCR Kit (Sigma), according to manufacturer's instructions. Reverse transcription was performed by the two-step protocol using for cDNA synthesis 2.5 µg of template RNA in a final reaction volume of 20 µl. One microliter of the cDNA obtained was then PCR amplified with cbs or ß-actin specific primers. For cbs, we designed primers CBS-1 GAA CAC CCC TAT GGT CAG AA and CBS-2 GGA TTT TCG TTC TTC AGT CG which do not amplify genomic sequences and produce a 388 bp amplification product. The 470 bp PCR product from actin was obtained using primers actin-1 GAT CAT GTT TGA GAC CTT CAA CAC C and actin-2 AGT TTC ATG GAT GCC ACA GGA TTC C. Actin and cbs amplifications were performed separately to avoid amplicon interference during amplification. PCR was carried out at 94° for 45 s, annealing at 62° for 45 s and extension at 72° for 45 s. After 29 cycles of amplification (or 52 cycles in Fig. 5c), the material was subjected to a final extension step at 72° for 5 min. PCR products were resolved by electrophoresis in 1% agarose gels and confirmed by DNA sequencing.

Western blot
Uterine homogenates from cbs KO or control wild-type mice were analyzed to test the unfolded protein response. About 50 µg of protein was loaded onto a gradient (4–24%) SDS–polyacrylamide gel. Gel was transferred to PVDF membranes (Millipore, Madrid). Protein bands were detected using rabbit polyclonal antibodies against mouse GADD 153 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and Grp78 (Stressgen, Victoria, Canada), followed by detection with a secondary antibody anti-rabbit IgG peroxidase conjugate (GE Healthcare) and chemiluminiscence (GE Healthcare, Madrid). Equal loading was confirmed by using an anti-actin antibody obtained from Sigma. Membranes were exposed to ECL film (GE Healthcare) and films analyzed using a laser LKB 2202 densitometer (GE Healthcare).

Statistical analysis
Data were analyzed by using either a two-tailed, unpaired Student's t-test or an unpaired, nonparametric Mann–Whitney U-test using Instat 3.02 for Windows software (GraphPad, San Diego, CA, USA). Values are presented as mean±SD.


    ACKNOWLEDGEMENTS
 
This research was supported by grants CICYT (SAF2004-08173-C03-02) and FISS 01/0202; Redes DGA (A-26) and FISS de investigación cooperativa C03/01, Fundación Española del Corazón and R.C., S.A., M.A.N. and M.A.G. were recipient of DGA, FEGA-FEOGA and PROMEP fellowships. We thank Jesús Navarro, Angel Beltrán, Jesús Cazo, Carmen Navarro and Clara Tapia from Unidad Mixta de Investigación for their invaluable help in maintaining animals and Rosario Puyó for her technical assistance. We thank Dr García de Jalón for helpful suggestions.

Conflict of Interest statement. The authors declare no conflict of interest.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Ueland P.M., Nygard O., Vollset S.E., Refsum H. (2001) The Hordaland Homocysteine Studies. Lipids 36:S33–S39.[Medline]

  2. Ray J.G. and Laskin C.A. (1999) Folic acid and homocyst(e)ine metabolic defects and the risk of placental abruption, pre-eclampsia and spontaneous pregnancy loss: a systematic review. Placenta 20:519–529.[CrossRef][Web of Science][Medline]

  3. Wang J., Trudinger B.J., Duarte N., Wilcken D.E., Wang X.L. (2000) Elevated circulating homocyst(e)ine levels in placental vascular disease and associated pre-eclampsia. Br. J. Obst. Gyn. 107:935–938.

  4. Nelen W.L. (2001) Hyperhomocysteinaemia and human reproduction. Clin. Chem. Lab. Med. 39:758–763.[CrossRef][Web of Science][Medline]

  5. Daly S., Cotter A., Molloy A.E., Scott J. (2005) Homocysteine and folic acid: implications for pregnancy. Semin. Vasc. Med. 5:190–200.[CrossRef][Medline]

  6. Selhub J. (1999) Homocysteine metabolism. Annu. Rev. Nutr. 19:217–246.[CrossRef][Web of Science][Medline]

  7. VanAerts L.A., Poirot C.M., Herberts C.A., Blom H.J., De Abreu R.A., Trijbels J.M., Eskes T.K., Peereboom-Stegeman J.H., Noordhoek J. (1995) Development of methionine synthase, cystathionine-beta-synthase and S-adenosyl-homocysteine hydrolase during gestation in rats. J. Reprod. Fertil. 103:227–232.[Abstract/Free Full Text]

  8. Thompson H.R., Jones G.M., Narkewicz M.R. (2001) Ontogeny of hepatic enzymes involved in serine- and folate-dependent one-carbon metabolism in rabbits. Am. J. Physiol. Gastrointest. Liver Physiol. 280:G873–G878.[Abstract/Free Full Text]

  9. Watanabe M., Osada J., Aratani Y., Kluckman K., Reddick R., Malinow M.R., Maeda N. (1995) Mice deficient in cystathionine beta-synthase: animal models for mild and severe homocyst(e)inemia. Proc. Natl Acad. Sci. USA 92:1585–1589.[Abstract/Free Full Text]

  10. Elvin J.A. and Matzuk M.M. (1998) Mouse models of ovarian failure. Rev. Reprod. 3:183–195.[Abstract]

  11. Paria B.C., Reese J., Das S.K., Dey S.K. (2002) Deciphering the cross-talk of implantation: advances and challenges. Science 296:2185–2188.[Abstract/Free Full Text]

  12. Nelson J.F., Felicio L.S., Randall P.K., Sims C., Finch C.E. (1982) A longitudinal study of estrous cyclicity in aging C57BL/6J mice: I. Cycle frequency, length and vaginal cytology. Biol. Reprod. 27:327–339.[Abstract]

  13. Powers R.W., Gandley R.E., Lykins D.L., Roberts J.M. (2004) Moderate hyperhomocysteinemia decreases endothelial-dependent vasorelaxation in pregnant but not nonpregnant mice. Hypertension 44:327–333.[Abstract/Free Full Text]

  14. Outinen P.A., Sood S.K., Pfeifer S.I., Pamidi S., Podor T.J., Li J., Weitz J.I., Austin R.C. (1999) Homocysteine-induced endoplasmic reticulum stress and growth arrest leads to specific changes in gene expression in human vascular endothelial cells. Blood 94:959–967.[Abstract/Free Full Text]

  15. Werstuck G.H., Lentz S.R., Dayal S., Hossain G.S., Sood S.K., Shi Y.Y., Zhou J., Maeda N., Krisans S.K., Malinow M.R., et al. (2001) Homocysteine-induced endoplasmic reticulum stress causes dysregulation of the cholesterol and triglyceride biosynthetic pathways. J. Clin. Invest. 107:1263–1273.[Web of Science][Medline]

  16. Ratnam S., Maclean K.N., Jacobs R.L., Brosnan M.E., Kraus J.P., Brosnan J.T. (2002) Hormonal regulation of cystathionine beta-synthase expression in liver. J. Biol. Chem. 277:42912–42918.[Abstract/Free Full Text]

  17. Miettinen H.E., Rayburn H., Krieger M. (2001) Abnormal lipoprotein metabolism and reversible female infertility in HDL receptor (SR-BI)-deficient mice. J. Clin. Invest. 108:1717–1722.[CrossRef][Web of Science][Medline]

  18. Demetrius L. (2005) Of mice and men. When it comes to studying ageing and the means to slow it down, mice are not just small humans. EMBO Rep. 6:S39–S44.[CrossRef][Web of Science][Medline]

  19. Lee S.J., Lee D.H., Yoo H.W., Koo S.K., Park E.S., Park J.W., Lim H.G., Jung S.C. (2005) Identification and functional analysis of cystathionine beta-synthase gene mutations in patients with homocystinuria. J. Hum. Genet. 50:648–654.[CrossRef][Web of Science][Medline]

  20. Urreizti R., Asteggiano C., Bermudez M., Cordoba A., Szlago M., Grosso C., de Kremer R.D., Vilarinho L., D'Almeida V., Martinez-Pardo M., et al. (2006) The p.T191M mutation of the CBS gene is highly prevalent among homocystinuric patients from Spain, Portugal and South America. J. Hum. Genet. 51:305–313.[CrossRef][Web of Science][Medline]

  21. Kluijtmans L.A., Young I.S., Boreham C.A., Murray L., McMaster D., McNulty H., Strain J.J., McPartlin J., Scott J.M., Whitehead A.S. (2003) Genetic and nutritional factors contributing to hyperhomocysteinemia in young adults. Blood 101:2483–2488.[Abstract/Free Full Text]

  22. Hogan B., Beddington R., Costantini F., Lacy E. (1994) Manipulating the Mouse Embryo(Cold Spring Harbor Press, Plainview, New York, USA) pp. 130–188.

  23. Manson M. and Kang Y.J. (1994) Principles and Methods of Toxicology(Raven Press, New York, USA) pp. 989–1037.

  24. Calleja L., Paris M.A., Paul A., Vilella E., Joven J., Jimenez A., Beltran G., Uceda M., Maeda N., Osada J. (1999) Low-cholesterol and high-fat diets reduce atherosclerotic lesion development in ApoE-knockout mice. Arterioscler. Thromb. Vasc. Biol. 19:2368–2375.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Physiol. GenomicsHome page
N. Guillen, M. A. Navarro, C. Arnal, E. Noone, J. M. Arbones-Mainar, S. Acin, J. C. Surra, P. Muniesa, H. M. Roche, and J. Osada
Microarray analysis of hepatic gene expression identifies new genes involved in steatotic liver
Physiol Genomics, May 13, 2009; 37(3): 187 - 198.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
R. Kanakkaparambil, R. Singh, D. Li, R. Webb, and K. D. Sinclair
B-Vitamin and Homocysteine Status Determines Ovarian Response to Gonadotropin Treatment in Sheep
Biol Reprod, April 1, 2009; 80(4): 743 - 752.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
15/21/3168    most recent
ddl393v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Guzmán, M. A.
Right arrow Articles by Osada, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guzmán, M. A.
Right arrow Articles by Osada, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?