Skip Navigation


Human Molecular Genetics Advance Access originally published online on December 20, 2005
Human Molecular Genetics 2006 15(3):387-391; doi:10.1093/hmg/ddi455
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow All Versions of this Article:
15/3/387    most recent
ddi455v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Ahituv, N.
Right arrow Articles by McPherson, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ahituv, N.
Right arrow Articles by McPherson, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press. All rights reserved.
For Permissions, please email: journals.permissions@oxfordjournals.org

A PYY Q62P variant linked to human obesity

Nadav Ahituv1,2,{dagger}, Nihan Kavaslar3,{dagger}, Wendy Schackwitz1,2, Anna Ustaszewska2, John Michael Collier2, Sybil Hébert3, Heather Doelle3, Robert Dent3, Len A. Pennacchio1,2,* and Ruth McPherson3

1Genomics Division, One Cyclotron Road, MS 84-171, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 USA, 2U.S. Department of Energy Joint Genome Institute, Walnut Creek, CA 94598, USA and 3Division of Cardiology and Lipoprotein and Atherosclerosis Research Group, University of Ottawa Heart Institute, Ottawa, Canada K1Y 4W7

* To whom correspondence should be addressed. Tel: +1 5104867498; Fax: +1 5104864229; Email: lapennacchio{at}lbl.gov

Received September 21, 2005; Accepted December 9, 2005


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Peptide YY (PYY) has been implicated in the control of food intake through functional studies in rodents and humans. To investigate whether genetic alterations within this gene result in abnormal weight in humans, we sequenced its coding exons and splice sites in a large cohort of extremely obese [n=379; average body mass index (BMI), 49.0 kg/m2] and lean (n=378; average BMI, 19.5 kg/m2) individuals. In total, three rare non-synonymous variants were identified, only one of which, PYY Q62P, exhibited familial segregation with body mass. Through serendipity, previous studies based on cell culture revealed this precise variant to have altered receptor-binding selectivity in vitro. We further show, using mouse peptide injection experiments, that while the wild-type PYY peptide reduces food intake, the mutant PYY 62P had an insignificant effect in reducing food intake in vivo. Taken together, these results are the first to support that rare sequence variants within PYY can influence human susceptibility to obesity.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
The most convincing evidence for a genetic component for obesity comes from twin and adoption studies supporting that the genetic transmission of obesity is at least as important as the non-genetic factors (1Go). Using genetic approaches, a number of candidate genes for obesity have been identified and the importance of several of these genes was ascertained through genetically engineered mice (2Go). Overall, genes that may contribute to obesity susceptibility can be considered in three broad areas. These include genes that (i) regulate food intake (3Go); (ii) participate in adipogenesis (4Go); and (iii) influence energy expenditure including mitochondrial proton leak and adaptive thermogenesis (5Go).

In the category of food intake regulation, functional studies both in humans and rodents indicate a potentially important role for peptide YY (PYY) in decreasing food intake (6Go–8Go). Following food intake and in proportion to meal size, PYY is secreted into the blood stream from L-cells in the gastrointestinal tract in two forms, PYY1–36 and PYY3–36 (9Go), and binds to neuropeptide receptors within the brain to reduce food intake. PYY3–36 was previously shown to bind in vitro with highest affinity to the neuropeptide Y receptor Y2 (NPY2R) (10Go), an observation that was further established in vivo using Npy2r-deficient mice, in which peripheral administration of PYY3–36 failed to reduce food intake (7Go). In rodents, intravenous administration of PYY3–36 led to a reduction in food intake (6Go,7Go,11Go) and in both obese and lean human subjects, PYY3–36 infusion markedly decreased food intake (8Go). Combined, these studies support an important physiological role for PYY in the regulation of feeding behavior.

In humans, little is known of the effects of genetic variation in PYY on susceptibility to obesity. In one limited study, DNA sequence analysis of PYY and its receptor, NPY2R, in 83 extremely obese Pima Indians suggested that certain common variants may be associated with severe obesity in males (12Go). However, in a separate study performed in 101 individuals with severe early onset obesity, no association was found between common or rare nucleotide variants in PYY and obesity (13Go). To directly address the effects of variations in the coding sequences of PYY on human body weight, we sequenced a large cohort of subjects at the two extremes of BMI.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
We sequenced the human PYY (NCBI accession no. NM_004160) coding exons and their splice sites in 379 obese and 378 lean individuals with a mean BMI of 49.0 and 19.5 kg/m2, respectively. Sequence analysis revealed no significant frequency differences between two of the three common variant (>1% allele frequency) genotypes in the obese versus lean population (Table 1). For R72T, we observed a marginally significant (P-value=0.02; {chi}2 test) genotype frequency difference between our two cohorts, though this variant has been previously reported to lack association with BMI when tested in 952 Caucasians (13Go), which are of similar ethnicity as our population. In addition, three rare (<1% allele frequency) non-synonymous variants unique to either the obese or lean population were discovered (Table 1). Two variants, P9H and Q62P, were identified in two isolated obese individuals, whereas a nonsense variant, Y49*, was found in a single lean individual.


View this table:
[in this window]
[in a new window]
 
Table 1. PYY variants identified through resequencing
 
Based on the severe nature of the Y49* nonsense substitution, we assessed this variant for segregation in the proband's available extended pedigree. However, we found no relationship between this variant and BMI (Supplementary Material Fig. S1). Nevertheless, we further examined the subjects bearing the PYY stop mutation to determine if such a heterozygous nonsense change effects circulating PYY3–36 plasma levels. Fasting and post-prandial plasma PYY concentrations were measured by immunoassay (Supplementary methods) for carriers (n=5) and non-carriers (n=5) closely matched for age, sex and BMI. These studies demonstrated significantly lower mean PYY3–36 concentrations for carriers versus controls in the fasting state and a strong trend at the 90-min post-prandial time-point (Table 2). Detailed analysis of cognitive dietary restraint, disinhibition and hunger (Three Factor Eating Questionnaire) as well as subjective phenomena related to appetite pre-and post-meal (Visual Analogue Scores) did not reveal significant differences between carriers and non-carriers of this variant (Supplementary Material Tables S1–S4 and Supplementary methods) (14Go). These data suggest that subtle differences in plasma PYY3–36 concentrations do not have a major effect on appetite or eating behavior and that haplo-insufficiency of PYY is not associated with a BMI phenotype.


Figure 4551
View larger version (39K):
[in this window]
[in a new window]
 
Figure 1. PYY Q62P. (A) Familial segregation of PYY Q62P (the arrow indicates the individual sequenced in the cohort). Black-shaded individuals in the pedigree are carriers of the 62P variant, while the lone gray-shaded individual is inferred to be an obligate carrier. (B) Clustal-W (24Go) and boxshade protein alignment analysis of the secreted PYY paralogs, human NPY and PPY. Amino acids PYY Q62/Q34 and PPY P63/P36 are marked with black arrows.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Fasting and post-prandial PYY3-36 concentrations in PYY Y49* carriers versus matched controls
 
Familial segregation analysis of the obese variants showed no significant correlation between variant P9H and BMI in the small kindred that was available for genotyping (Supplementary Material Fig. S1B). On the other hand, PYY Q62P was found in four individuals in an extended family (Fig. 1A), and these had an average BMI adjusted for age and sex at the 87th percentile (including a 4-year-old child with congenital heart disease, which may restrict an obesity phenotype) compared with an average BMI at the 52nd percentile for five non-carriers (P=0.0158, two-tailed t-test with Welch correction). In terms of an obesity phenotype, the Q62P proband was hypertensive but normolipidaemic as well as euglycaemic, and in comparison with other age, sex and BMI-matched subjects, lost weight quickly on a 900 kcal liquid formula diet, implying that his obese state was secondary to hyperphagia rather than low energy expenditure. These data were suggestive of a possible role for PYY Q62P in influencing obesity susceptibility and encouraged further functional studies on its protein product.

Serendipitously, the exact Q62P amino acid change had been previously studied in vitro (15Go). PYY amino acid position Q62, which represents Q34 in the secreted form of PYY, is extremely evolutionarily conserved both in PYY and NPY paralogs, whereas in PPY this residue is substituted by a proline (Fig. 1B). This observation of a paralogous protein amino acid change led several groups to conduct experiments on the effect of substituting PYY1–36 Q34 to a proline (10Go). Using nuclear magnetic resonance (NMR) and circular dichroism spectroscopy (CD spectra) studies as well as numerous cell culture assays, a profound functional consequence of this change, resulting in an altered binding affinity and specificity to several NPY receptors, was documented (10Go). Combined, our limited family segregation data and these previously established in vitro properties of PYY Q62P led us to test the effects of this variant on food intake in vivo.

Based on previous publications, implicating PYY3–36 as the major PYY peptide to reduce food intake in rodents (6Go), we generated a mutant PYY3–36 P34 peptide and sought to determine its effects on food intake in mice. Following a previously described protocol (11Go), we injected wild-type (Q34) and mutant (P34) PYY peptide into mice after a 24-h fast. We found that 6 h post-injection, the wild-type peptide significantly decreased food intake when compared with saline control as previously described (11Go). In contrast, the mutant peptide had no significant effect on food consumption when compared with saline control (P=0.26, one-way ANOVA) (Fig. 2). In addition, we co-injected both the wild-type and mutant peptide and observed a consequence similar to mutant P34 alone (Fig. 2). This abolishment of wild-type peptide feeding inhibition in the co-injection experiments suggests that P34 has a gain of function mechanism of action thereby overcoming the wild-type peptide effect. Together, these results support a functional role for the PYY Q62P variant on the regulation of food intake.


Figure 4552
View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. A bar chart showing the mean food intake in mice 6 h post-peptide injection. Error bars depict the standard error. ‘N’ below the chart indicates the number of mice, followed by the mean food intake after 6 h and the standard error in each experiment. **P<0.01; *P<0.05 versus wild-type PYY3–36, one-way ANOVA.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
PYY has been functionally implicated in the control of food intake primarily through rodent-based studies. Here, we explored the potential genetic contribution of this gene to human body weight through DNA resequencing in two extreme populations followed by familial and functional investigation. Based on our relatively large sample size, and previous reports (12Go,13Go), it appears that rare non-synonymous changes in this gene in the obese population are infrequent and their contribution to widespread weight differences in humans is likely to be minor. In addition, while our analysis was not designed as an exhaustive genetic association study between common variants in the PYY genomic region and BMI, we found three common variants, one of which showed marginal frequency differences between the obese and lean groups (Table 1). Whether other common non-coding variants in the extended genomic region may more strongly impact on human BMI remains to be further explored. Nevertheless, the finding of PYY Q62P variant and the demonstration of its functional importance suggest that a small subset of variants in PYY might be detrimental and potentially important in the etiology of weight differences.

Mechanistically, we can speculate on how the 62P variant might lead to a change in PYY function. Previous in vitro studies carried out using a mutant PYY1–36 P34 peptide demonstrated that this residue is of importance in terms of the binding specificity to other NPY receptors, specifically NPY1R (16Go,17Go), NPY4R (18Go) and NPY5R (19Go). As NPY2R ligand binding is predicted to result in appetite suppression, and NPY1R and NPY5R [also possibly NPY4R (20Go)] in appetite induction [reviewed in (21Go)], it is possible that the P62 variant shifts PYY function in vivo. This could be either through P62 activation of NPY1R and NPY5R (and/or NPY4R) and/or its competitive blockage of their natural peptide ligands, thus leading to a gain of function effect. We should point out that since our functional analysis was done in mice and not in humans, and previous receptor-binding assays were carried out in vitro, our functional data can only be suggestive regarding the causative nature of this variant in human obesity.

Finally, the finding of a nonsense variant, Y49*, in a lean individual and several of his lean to normal weight family members indicates that PYY haplo-insufficiency in humans does not promote obesity. In addition, the observation of decreased levels of fasting and post-prandial plasma PYY3–36 levels in Y49* carriers versus controls support the notion that subtle changes in PYY levels are unlikely to profoundly influence human weight. Taken together, these data suggests that rare genetic changes in PYY may influence isolated cases of human obesity most likely through a gain of function mutation mechanism. Further mutation screening in PYY in large obese cohorts will provide a better estimate of the prevalence of such nucleotide changes and their effects on human body weight.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Subjects
Obese Caucasian subjects were recruited from the patient population of the University of Ottawa Weight Management Clinic and the Heart Institute Lipid Clinic. Criteria for inclusion included a BMI >36 kg/m2 and a history of obesity for at least 10 years of adult life. Exclusion criteria included treatment with oral glucocorticoids, anti-psychotics, lithium or medical conditions including major depression, bipolar affective disorder or psychosis. Lean subjects of the same ethnic background were recruited from the Ottawa community. BMI for obese and lean subjects was categorized according to the population percentiles for age and sex using the Canadian Heart Health Survey data for subjects over the age of 18 years (data on file; Health Canada) and NHANES data for children (22Go). Inclusion criteria for the lean subjects include a BMI less than or equal to the 10th percentile for age and sex, with no prior history of having had a BMI greater than 25th percentile for age and sex for more than a 2-year consecutive period. Exclusion criteria include medical conditions affecting weight gain including hyperthyroidism, anorexia nervosa, bulimia, major depression or malabsorption syndromes. This study was approved by the institutional review boards of the University of Ottawa Heart Institute and the Ottawa Hospital and informed written consent was obtained from all participants. Genomic DNA was extracted from white blood cells by standard methods (23Go) or from saliva samples collected in Oragene Kits (DNA Genotek).

Sequencing and data analysis
Primers were designed to give a maximum product size of 500 bp and a minimum of 40 bp flanking the splice sites using the Exon Locator and eXtractor for Resequencing program (EXLR) (http://mutation.swmed.edu/ex-lax/). An M13 F tag (gttttcccagtcacgacgttgta) and M13R tag (aggaaacagctatgaccat) was added to forward and reverse primers, respectively. Ten nanograms of DNA from each sample was amplified in a 10 µl PCR reaction using AmpliTaq Gold® (Applied Biosystems) and cleaned using Tetra-ethylene glycol (TET) (http://www.jgi.doe.gov/sequencing/protocols/BETcleanup.doc). Sequencing reactions were performed using the M13 primers along with BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) (http://www.jgi.doe.gov/sequencing/protocols/BigDye3.1auto1.0.doc) and cleaned again with TET before separation on a 3730xl DNA Analyzer (ABI). Base calling, quality assessment and assembly were carried out using the Phred, Phrap, Polyphred, Consed software suite (www.phrap.org). All sequence variants identified were verified by manual inspection of the chromatograms and by a second independent sequencing reaction.

Mouse peptide experiments
Two-month old 129/Sv male mice were individually housed in cages for 2 weeks prior to experimentation. Mice were housed in a temperature-controlled room under a 12-h light and dark cycle, given free access to water and fed ad libitum on a standard chow. After the 2-week period, the mice were fasted for 24 h and then injected intraperitoneally with 10 µg per 100 g of body weight PYY3–36, PYY3–36 P34 (both from Bachem), or saline at the onset of the dark cycle (18:00). When both PYY3–36 and PYY3–36 P34 were injected, equal amounts were adjusted and combined so that they would give 10 µg per 100 g of body weight. Food intake was measured at 6, 24 and 48 h following injection by measuring the pre-weighed portions of food dispensed from wire cage tops. Cages were carefully monitored for evidence of food spillage or grinding, which were negligible. Experiments were performed in duplicate with an average of eight mice per study.


    SUPPLEMENTARY MATERIAL
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Supplementary material is available at HMG Online.


    ACKNOWLEDGEMENTS
 
We wish to thank Paulina Lau for performing the PYY immunoassays, the Joint Genome Institute's production sequencing group for technical assistance, members of the Rubin lab for helpful comments on the manuscript, and the many subjects and their families who participated in these studies. Research was conducted at the E.O. Lawrence Berkeley National Laboratory and the Joint Genome Institute performed under Department of Energy Contract DE-AC0378SF00098, University of California (LAP). Subject recruitment was supported, in part, by a grant from GlaxoSmithKline (to RM and RD). Funded in part by a grant from the Heart & Stroke Foundation of Ontario #NA5413 (to RM).

Conflict of Interest statement. None declared.


    FOOTNOTES
 
{dagger} These authors contributed equally to this work. Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 

  1. Friedman, J.M. (2003) A war on obesity, not the obese. Science, 299, 856–858.[Abstract/Free Full Text]

  2. Perusse, L., Rankinen, T., Zuberi, A., Chagnon, Y.C., Weisnagel, S.J., Argyropoulos, G., Walts, B., Snyder, E.E. and Bouchard, C. (2005) The human obesity gene map: the 2004 update. Obes. Res., 13, 381–490.[Web of Science][Medline]

  3. Flier, J.S. (2004) Obesity wars: molecular progress confronts an expanding epidemic. Cell, 116, 337–350.[CrossRef][Web of Science][Medline]

  4. Harp, J.B. (2004) New insights into inhibitors of adipogenesis. Curr. Opin. Lipidol., 15, 303–307.[CrossRef][Web of Science][Medline]

  5. Lowell, B.B. and Spiegelman, B.M. (2000) Towards a molecular understanding of adaptive thermogenesis. Nature, 404, 652–660.[Medline]

  6. Chelikani, P.K., Haver, A.C. and Reidelberger, R.D. (2005) Intravenous infusion of PYY(3–36) potently inhibits food intake in rats. Endocrinology, 146, 879–888.[Abstract/Free Full Text]

  7. Batterham, R.L., Cowley, M.A., Small, C.J., Herzog, H., Cohen, M.A., Dakin, C.L., Wren, A.M., Brynes, A.E., Low, M.J., Ghatei, M.A. et al. (2002) Gut hormone PYY(3-36) physiologically inhibits food intake. Nature, 418, 650–654.[CrossRef][Medline]

  8. Batterham, R.L., Cohen, M.A., Ellis, S.M., Le Roux, C.W., Withers, D.J., Frost, G.S., Ghatei, M.A. and Bloom, S.R. (2003) Inhibition of food intake in obese subjects by peptide YY3-36. N. Engl. J. Med., 349, 941–948.[Abstract/Free Full Text]

  9. Grandt, D., Schimiczek, M., Beglinger, C., Layer, P., Goebell, H., Eysselein, V.E. and Reeve, J.R., Jr. (1994) Two molecular forms of peptide YY (PYY) are abundant in human blood: characterization of a radioimmunoassay recognizing PYY 1-36 and PYY 3-36. Regul. Pept., 51, 151–159.[CrossRef][Web of Science][Medline]

  10. Keire, D.A., Bowers, C.W., Solomon, T.E. and Reeve, J.R., Jr. (2002) Structure and receptor binding of PYY analogs. Peptides, 23, 305–321.[CrossRef][Web of Science][Medline]

  11. Challis, B.G., Pinnock, S.B., Coll, A.P., Carter, R.N., Dickson, S.L. and O'Rahilly, S. (2003) Acute effects of PYY3-36 on food intake and hypothalamic neuropeptide expression in the mouse. Biochem. Biophys. Res. Commun., 311, 915–919.[CrossRef][Web of Science][Medline]

  12. Ma, L., Tataranni, P.A., Hanson, R.L., Infante, A.M., Kobes, S., Bogardus, C. and Baier, L.J. (2005) Variations in peptide YY and Y2 receptor genes are associated with severe obesity in Pima Indian men. Diabetes, 54, 1598–1602.[Abstract/Free Full Text]

  13. Connie Hung, C.C., Pirie, F., Luan, J., Lank, E., Motala, A., Yeo, G.S., Keogh, J.M., Wareham, N.J., O'Rahilly, S. and Farooqi, I.S. (2004) Studies of the peptide YY and neuropeptide Y2 receptor genes in relation to human obesity and obesity-related traits. Diabetes, 53, 2461–2466.[Abstract/Free Full Text]

  14. Stunkard, A.J. and Messick, S. (1985) The three-factor eating questionnaire to measure dietary restraint, disinhibition and hunger. J. Psychosom. Res., 29, 71–83.[CrossRef][Web of Science][Medline]

  15. Keire, D.A., Mannon, P., Kobayashi, M., Walsh, J.H., Solomon, T.E. and Reeve, J.R., Jr. (2000) Primary structures of PYY, [Pro(34)]PYY, and PYY-(3-36) confer different conformations and receptor selectivity. Am. J. Physiol. Gastrointest. Liver Physiol., 279, G126–G131.[Abstract/Free Full Text]

  16. Dumont, Y., Cadieux, A., Pheng, L.H., Fournier, A., St-Pierre, S. and Quirion, R. (1994) Peptide YY derivatives as selective neuropeptide Y/peptide YY Y1 and Y2 agonists devoid of activity for the Y3 receptor sub-type. Brain Res. Mol. Brain Res., 26, 320–324.[Medline]

  17. Fuhlendorff, J., Gether, U., Aakerlund, L., Langeland-Johansen, N., Thogersen, H., Melberg, S.G., Olsen, U.B., Thastrup, O. and Schwartz, T.W. (1990) [Leu31, Pro34]neuropeptide Y: a specific Y1 receptor agonist. Proc. Natl Acad. Sci. USA, 87, 182–186.[Abstract/Free Full Text]

  18. Yan, H., Yang, J., Marasco, J., Yamaguchi, K., Brenner, S., Collins, F. and Karbon, W. (1996) Cloning and functional expression of cDNAs encoding human and rat pancreatic polypeptide receptors. Proc. Natl Acad. Sci. USA, 93, 4661–4665.[Abstract/Free Full Text]

  19. Gerald, C., Walker, M.W., Criscione, L., Gustafson, E.L., Batzl-Hartmann, C., Smith, K.E., Vaysse, P., Durkin, M.M., Laz, T.M., Linemeyer, D.L. et al. (1996) A receptor subtype involved in neuropeptide-Y-induced food intake. Nature, 382, 168–171.[CrossRef][Medline]

  20. Katsuura, G., Asakawa, A. and Inui, A. (2002) Roles of pancreatic polypeptide in regulation of food intake. Peptides, 23, 323–329.[CrossRef][Web of Science][Medline]

  21. Kalra, S.P. and Kalra, P.S. (2004) NPY and cohorts in regulating appetite, obesity and metabolic syndrome: beneficial effects of gene therapy. Neuropeptides, 38, 201–211.[CrossRef][Web of Science][Medline]

  22. Kuczmarski, R.J., Ogden, C.L., Guo, S.S., Grummer-Strawn, L.M., Flegal, K.M., Mei, Z., Wei, R., Curtin, L.R., Roche, A.F. and Johnson, C.L. (2002) 2000 CDC Growth Charts for the United States: methods and development. Vital Health Stat., 11, 1–190.

  23. Miller, S.A., Dykes, D.D. and Polesky, H.F. (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res., 16, 1215.[Free Full Text]

  24. Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res., 22, 4673–4680.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
P.-a. B. Shih, L. Wang, S. Chiron, G. Wen, C. Nievergelt, M. Mahata, S. Khandrika, F. Rao, M. M. Fung, S. K. Mahata, et al.
Peptide YY (PYY) Gene Polymorphisms in the 3'-Untranslated and Proximal Promoter Regions Regulate Cellular Gene Expression and PYY Secretion and Metabolic Syndrome Traits in Vivo
J. Clin. Endocrinol. Metab., November 1, 2009; 94(11): 4557 - 4566.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. C. Woods and D. A. D'Alessio
Central Control of Body Weight and Appetite
J. Clin. Endocrinol. Metab., November 1, 2008; 93(11_Supplement_1): s37 - s50.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
P. K. Chelikani, A. C. Haver, and R. D. Reidelberger
Intermittent intraperitoneal infusion of peptide YY(3-36) reduces daily food intake and adiposity in obese rats
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2007; 293(1): R39 - R46.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow All Versions of this Article:
15/3/387    most recent
ddi455v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Ahituv, N.
Right arrow Articles by McPherson, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ahituv, N.
Right arrow Articles by McPherson, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?