Skip Navigation


Human Molecular Genetics Advance Access originally published online on January 13, 2006
Human Molecular Genetics 2006 15(5):679-689; doi:10.1093/hmg/ddi482
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
15/5/679    most recent
ddi482v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Varon, R.
Right arrow Articles by Maraschio, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Varon, R.
Right arrow Articles by Maraschio, P.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Mild Nijmegen breakage syndrome phenotype due to alternative splicing

Raymonda Varon1,*,{dagger}, Véronique Dutrannoy1, Georg Weikert1, Caterina Tanzarella2, Antonio Antoccia2, Lars Stöckl1, Emanuela Spadoni3, Lars-Arne Krüger1, Alessandra di Masi2, Karl Sperling1, Martin Digweed1,{dagger} and Paola Maraschio3,4

1Institute of Human Genetics, Charité Berlin, Germany, 2Department of Biology, University ‘Roma Tre’, Rome, Italy, 3Institute of Medical Genetics and 4IRCCS San Matteo, Pavia, Italy

* To whom correspondence should be addressed at: Institute of Human Genetics, Charité, Humboldt University, Augustenburger Platz 1, 13353 Berlin, Germany. Tel: +49 30450566328; Fax: +49 30450566904; Email: raymonda.varon-mateeva{at}charite.de

Received November 21, 2005; Accepted January 11, 2006


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 WEB RESOURCES
 REFERENCES
 
Hypomorphic mutations of the NBS1 gene are responsible for Nijmegen breakage syndrome (NBS), characterized by microcephaly, chromosomal instability, radiosensitivity, immunodeficiency and high cancer predisposition. Over 90% of NBS patients are homozygous for the 657{Delta}5 mutation and are of Slavic origin; however, 10 further truncating mutations have been identified in patients of other ethnical origin. Partially functional proteins produced by alternative initiation of translation, and possibly diminishing the severity of the NBS phenotype, have been described for several NBS1 mutations. Here, we report a 53-year-old NBS patient, homozygous for the NBS1 mutation, 742insGG, in exon 7 and who presents with a particularly mild phenotype. In an attempt to find a potential molecular explanation for the mild phenotype observed, we carried out a conventional semi-quantitative and quantitative RT–PCR analyses which revealed two transcripts of almost equal amounts in the patient and her parents—the expected full-length transcript carrying the 742insGG mutation and a second transcript with deleted exons 6 and 7. The transcript was also observed in controls and other NBS patients, however, at quantities more than 100-fold lower than that in the patient described here. Because the skipping of exons 6 and 7 results in an internal in-frame deletion, which eliminates the truncating GG-insertion, we propose that this transcript may code for a partially functional protein of ~70 kDa that could be responsible for the unusually mild NBS phenotype observed in this patient. Indeed, complementation analysis of null-mutant mouse cells indicates that the alternatively spliced mRNA codes for a protein with significant functional capacity.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 WEB RESOURCES
 REFERENCES
 
Nijmegen breakage syndrome (NBS) (MIM 251260 [OMIM] ) is a rare autosomal recessive disorder, characterized by microcephaly, facial dysmorphism, growth retardation, immunodeficiency, hypersensitivity to ionizing radiation (IR) and a highly increased risk for lymphoreticular malignancy (1Go). The gene mutated in NBS has been identified and it was shown that the gene product, nibrin, forms a complex with MRE11 and RAD50, which is involved in the repair of DNA double-strand breaks, cell cycle control, telomere maintenance and recombination (2Go–4Go). The vast majority of NBS patients are of Slavic origin and share the founder NBS1 mutation, 657{Delta}5 (2Go). A further 10 truncating NBS1 mutations have been identified in patients of different ethnic origin (2Go,5Go–7Go).

Originally, the 657{Delta}5 mutation was regarded as a null mutation; however, it was shown that it is actually a hypomorphic mutation and that a truncated protein is produced, at least in patient's lymphoblastoid cells (8Go). Similar alternative translation products have been shown for two further NBS1 mutations, namely, 834{Delta}4 and 900{Delta}25 (8Go,9Go), thus providing further confirmation that NBS results from hypomorphic mutations, which are compatible with cell viability. The relatively mild clinical course of patients with NBS contrasts strongly to the lethality of null-mutation of the murine NBS1 functional analogue (10Go,11Go).

Here, we report on an Italian NBS patient who is 53 years old and homozygous for the 743insGG truncating NBS1 mutation in exon 7. This mutation leads to a premature stop codon five amino acids downstream (12Go). The patient presents an unusually mild clinical course. It has been previously shown for a number of genes containing premature nonsense codons that they express alternatively spliced mRNA through in-frame skipping of the exon harbouring the stop codon and so moderating the phenotypic severity of the disease (13Go–16Go). In an attempt to find a potential molecular explanation for the extremely mild phenotype in our patient with the 742insGG NBS1 mutation, we performed analyses on cDNA and found an alternatively spliced transcript in which exons 6 and 7 have been skipped.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 WEB RESOURCES
 REFERENCES
 
RT–PCR evidence of alternative NBS1 splicing in cultured fibroblasts and lymphoblastoid cell lines
RT–PCR was carried out with three sets of primers which cover the whole coding sequence of the NBS1 gene. More than one transcript was visible on agarose gels in all analysed samples from the PCRs carried out with primers located in exons 1 and 6 (data not shown). Interestingly, two transcripts could be detected in patient R.R. and her parents for the fragment spanning exons 5–10. In both lymphoblastoid cell lines (LCLs) and fibroblasts, the expected 579 bp product harbouring the mutation in exon 7 (Fig. 1A) was observed, together with a second product of 267 bp. The shorter PCR product was present neither in the control sample nor in the cDNA from NBS patients with 657{Delta}5 and 900{Delta}25 mutations.


Figure 4821
View larger version (25K):
[in this window]
[in a new window]
  		Figure 1. NBS1 gene analysis. (A) RT–PCR evidence of alternative NBS1 splicing. RT–PCR was carried out with primers located in NBS1 exons 5 and 10. Two transcripts were identified in the 742insGG patient and her parents, both in native fibroblasts (left) and in LCLs (right), the expected transcript of 579 bp containing the 742insGG mutation and a second transcript of 267 bp. The latter transcript was not observed in the controls or in NBS patients with other mutations. Fibroblasts (left): lane 1, 1 kb size ladder; lane 2, patient R.R.; lane 3, father of R.R.; lane 4, mother of R.R. and lane 5, control fibroblasts. LCLs (right): lane 1, 1 kb size ladder; lane 2, patient R.R.; lane 3, NBS patient homozygous for the 900{Delta}25 NBS1 mutation and lane 4, control LCLs. (B) Sequence analysis of NBS1. Segments of genomic sequence from exon 7 in a control, the patient R.R. showing the 742–743insGG mutation and cDNA sequence of patient R.R. showing the complete deletion of exons 6 and 7. (C) The domain structure of NBS1 and its protein product, nibrin. The intron/exon structure and the 11 known NBS1 mutations are indicated on the cDNA. The 742–743insGG mutation is underlined. The full-length nibrin protein and the two putative protein fragments arising from the 742–743insGG mutation are shown—the fragment resulting from the {Delta}6{Delta}7 transcript of ~70 kDa and the fragment resulting from an alternative translation initiation of ~52 kDa. The serines phosphorylated by ATM in response to irradiation are indicated as is the site of interaction with MRE11. BRCT, breast cancer 1 carboxy terminal domain; FHA, fork head-associated domain.

 
To define exactly the nature of the alternatively spliced transcripts observed, all RT–PCR products were cloned and analysed by sequencing. The sequencing analysis of the products spanning exons 5–10 identified an aberrantly spliced transcript with exons 6 and 7 deleted in the 742insGG patient and her parents (Fig. 1B). Figure 1C shows the exon structure of NBS1, the domains of its full-length protein product, nibrin, and the putative protein fragment arising from an mRNA with a deletion of exons 6 and 7. This transcript, which maintains the open-reading frame, was not seen in more than 10 control human tissues analysed (data not shown).

Nine further splice variants were identified in cells from the patient R.R. and her parents, from controls and from the patients with 657{Delta}5 and 900{Delta}25 mutations. The exact descriptions of these variants are given in Figure 2. Two of these transcripts have already been described, namely, the 50 bp alternative exon insertion of intron 2 leading to a premature termination codon (17Go,18Go) and the in-frame skipping of exon 13 (17Go,19Go). All other variants are reported here for the first time. We have focused our attention on the transcript with skipped exons 6 and 7 found only in patient R.R. with the 742insGG mutation, because all other transcripts were present at very low levels and were detectable only when the PCR products were cloned or when amplified with special boundary primers.


Figure 4822
View larger version (33K):
[in this window]
[in a new window]
  		Figure 2. NBS1 splice variants. Schematic representation of the 10 different NBS1 splice variants found in this study. Each exon is shown in a different colour. The stop codon is denoted on each transcript. Transcripts 1, 2, 4, 5 and 10 have preserved open-reading frame, whereas the alternative splicing seen in transcripts 3, 6, 7, 8 and 9 leads to premature stop codon. For transcripts 8, 9 and 10, an insertion of 50, 58 and 111 bp from introns 2, 9 and 14, respectively, were observed. For transcripts 6 and 7, different internal splice sites for exons 7 and 13 have been utilized resulting in premature stop codons.

 
To further clarify the presence of the {Delta}6{Delta}7 transcript in our patient, we carried out a semi-quantitative fragment analysis. We found that the {Delta}6{Delta}7 transcript was present not only in the patient homozygous for the 742insGG mutation and her parents, but also as a minor product in RNA from controls and patients homozygous for the 657{Delta}5 NBS1 mutation (Fig. 3). At the same time, the amount of normally spliced transcript was clearly less abundant in the 742insGG patient and her father (mother not shown) when compared with the control and the 657{Delta}5 patient.


Figure 4823
View larger version (53K):
[in this window]
[in a new window]
  		Figure 3. Semi-quantitative fragment analysis. Semi-quantitative fragment analysis with an FAM-labelled primer was carried out to determine the amount of normally and aberrantly spliced transcripts. It showed that the {Delta}6{Delta}7 transcript was present not only in the patient homozygous for the 742insGG mutation and her father heterozygous for the same mutation, but also as a minor product in RNA from controls and patients homozygous for the 657{Delta}5 NBS1 mutation (compare the peaks marked with 1). At the same time, the amount of normally spliced transcript was clearly less abundant in the 742insGG patient and her father when compared with the control and the 657{Delta}5 patient (compare the peaks marked with 2).

 
To exactly quantify the amount of the normally and the aberrantly spliced transcripts in the 742insGG patient, her parents and in the control samples, a real-time PCR with specific TaqMan probes for each transcript was carried out. The threshold cycle values obtained for the cDNA samples were plotted against standard curves. The analysis confirmed the presence of the {Delta}6{Delta}7 transcript in the control samples, but in amounts 100-fold less than that in the 742insGG patient and her parents (Fig. 4).


Figure 4824
View larger version (22K):
[in this window]
[in a new window]
  		Figure 4. Real-time PCR. In the real-time PCR experiments, we compared the amounts of the normally versus aberrantly spliced NBS1 transcripts in the patient R.R., her parents and control fibroblasts and LCLs. The PCR was carried out with specific TaqMan probes for each transcript. All samples were analysed in duplicate. A standard curve was plotted for each primer-probe set with Ct values obtained from the amplification of known quantities (1010–101 copy numbers/µl) of the cloned normal and {Delta}6{Delta}7 fragments. The copy number of each sample was determined by plotting the Ct value versus the log of the copy numbers included in each standard curve. Green columns, normally spliced transcript; red, {Delta}6{Delta}7 transcript.

 
We next performed an immunoprecipitation (IP) analysis to compare nibrin in LCLs and fibroblasts from patient R.R. and her parents with the corresponding control cell line and homozygote for the 657{Delta}5 mutation. As expected, the patient homozygous for the 742insGG mutation had no full-length nibrin protein; there was, however, a substantial amount of a smaller, specific protein of ~70 kDa, comparable to the 70 kDa fragment also found in patients homozygous for the major NBS1 mutation 657{Delta}5 (8Go,9Go). The 70 kDa protein was also present, in smaller amounts, in cells from both parents, together with the full-length p95 nibrin (Fig. 5).


Figure 4825
View larger version (32K):
[in this window]
[in a new window]
  		Figure 5. Truncated nibrin protein in patient cells. The immunoblot shows the analysis of MRE11/nibrin immunoprecipitates from control LCLs, patient LCLs, homozygous for the NBS1 657{Delta}5 mutation and from fibroblasts of the patient R.R., homozygous for NBS1-insGG, and her heterozygous parents.

 
Radiation-induced focus formation
The trimeric complex, RAD50, MRE11, nibrin, relocalizes from a diffuse nuclear distribution to discrete protein accumulations (foci) after exposure to ionizing irradiation. Cells from NBS patients with the founder mutation, 657{Delta}5, fail to show this relocalization, indicating a major role for nibrin in this mechanism. Indeed, the complex is not even specifically nuclear in NBS patient cells, but is also found throughout the cytoplasm (3Go). The situation is exactly the same in fibroblasts from the patient R.R. Immunostaining with an antibody directed against MRE11 in unirradiated cells and cells treated with 12 Gy 8 h before fixation indicated the same cytoplasmic distribution for the complex. In contrast, in control cells, typical nuclear MRE11 foci were detected after irradiation (Fig. 6).


Figure 4826
View larger version (33K):
[in this window]
[in a new window]
  		Figure 6. MRE11-foci formation in patient cells. Primary fibroblasts from patient R.R. with NBS1insGG/insGG and her mother with NBS1+/insG were irradiated with 12 Gy and fixed 8 h later. Cells were immunostained with rabbit anti-MRE11 and Cy2-conjugated goat anti-rabbit Ig. Representative cells are shown.

 
Induced chromosomal aberrations
The chromosomal instability of patient's lymphoblastoid cells was analysed after irradiating her cells, a control cell line and a cell line of an NBS patient homozygous for the 657{Delta}5 mutation with 15 and 30 cGy. The radiosensitivity was determined by analysing the number of breaks per cell in 100 metaphases per irradiation dose. Patient R.R. showed elevated chromosome breaks after irradiation similar to the patient with the 657{Delta}5 mutation (Fig. 7).


Figure 4827
View larger version (24K):
[in this window]
[in a new window]
  		Figure 7. Chromosome aberrations in patient cells. LCLs from a normal individual, patient R.R. and classical NBS patient with the 657{Delta}5 mutation were irradiated and harvested 3 h later for analysis of radiation-induced chromatid-type aberrations.

 
Complementation analysis
Mouse cells with null mutations in the NBS1 homologue, Nbn, do not survive in vitro, indicating the essential role of nibrin, even in the absence of exogenous DNA damage (20Go). As shown in Figure 8, transduction of conditional null mutant mouse cells with wild-type human NBS1 cDNA, prior to cre-mediated deletion, rescues them from proliferation arrest and/or apoptosis in vitro. Transduction with cDNA carrying the insGG mutation does not rescue the null mutant cells and only 12% survive after 40 generations. This is comparable to the effect of transduction with an empty retroviral vector (11%) (20Go). Transduction with an artificial cDNA, lacking the sequence coded by exons 6 and 7, partially rescues the cells, with 50% surviving for 40 generations. This is even better than when cDNA carrying the 657{Delta}5 mutation is transferred (42%) (20Go). The experiment was repeated and gave essentially identical results. These data support the suggestion that an alternatively spliced NBS1 mRNA, lacking sequences from exons 6 and 7, produces a nibrin protein with a significant functional capacity.


Figure 4828
View larger version (20K):
[in this window]
[in a new window]
  		Figure 8. Rescue of Nbn null mutant murine cells by human nibrin cDNAs. (A) RT–PCR confirmation of human nibrin mRNA expression in murine fibroblasts transduced with vectors containing NBS1-insGG or NBS1-{Delta}6{Delta}7 cDNAs. NBS1 primers were located in exons 5 and 10 and produce PCR products of 579 bp from full-length nibrin mRNA and of 267 bp from a transcript lacking the sequence coded by exons 6 and 7. RNA was isolated from the murine transductants indicated and PCR conducted with and without reverse transcription, as shown. GAPDH was amplified as a control and yields a product of 535 bp. (B) Survival of Nbn null-mutant murine cells after transduction with human NBS1 cDNAs. Cells were treated in vitro with cre recombinase fusion protein to induce homozygosity for Nbn null mutations, Nbnins6/{Delta}6. The proportion of these null-mutant cells remaining in the population was measured over 40 generations by real-time PCR on DNA extracted at subculturing. Filled square, cells transduced with wild-type NBS1 cDNA; filled triangle, cells transduced with NBS1-insGG cDNA; filled circle, cells transduced with NBS1-{Delta}6{Delta}7 cDNA, prior to cre treatment.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 WEB RESOURCES
 REFERENCES
 
NBS results from hypomorphic truncating mutations of the NBS1 gene. For three NBS1 mutations, a truncated protein, at least in patient's lymphoblastoid cells, has been described. This fact could explain the survival of homozygotes with NBS1 mutations in comparison to null mutation in mice (8Go–11Go). The NBS patient described here is homozygous for the NBS1 mutation, 742insGG, in exon 7 (12Go) and presents with an unusually mild phenotype. She is now 53 years old and has had no clinical problems apart from the primary amenorrhoea. Interestingly, R.R. has no immunodeficiency and has not suffered from frequent infections. Her very mild reduction in IgG2 and IgG4 isotypes has never had any clinical significance and probably represents a remnant of the classical NBS immunodeficiency. To the best of our knowledge, she is the oldest living NBS patient.

Patient R.R. was born to consanguineous parents and had a younger sister who also had primary amenorrhoea, who, however, died at the age of 20 due to a malignant lymphoma; she was most probably also affected by NBS (21Go). Unlike most NBS patients treated with radiotherapy, she showed no dramatic reaction to this treatment. Why the younger sister developed the typical NBS malignancy in contrast to her sister, who is still in very good health at 53, is not clear. Presumably other genetic and/or environmental factors have influenced the course of the disease. In this connection, it is worth noting, however, that the father of R.R., who is a carrier of the 742insGG mutation, has recently developed two different malignancies, prostate cancer and breast cancer.

Like all other known NBS1 mutations leading to the NBS disorder, the mutation 742insGG found in the patient described here is a truncating mutation, and no full-length nibrin is detected in patient's cells (Fig. 5). In an attempt to find an explanation for the patient's mild phenotype, we performed analyses on cDNA for mRNA splicing events. Unexpectedly, a conventional RT–PCR revealed two mRNA products specifically in the patient and her parents, the expected full-length transcript carrying the mutation 742insGG and an additional abundant transcript with an in-frame deletion of exons 6 and 7. At the boundary between exons 5 and 8, the amino acid serine was changed to arginine. The alternative transcript was observed both in transformed lymphoblasts and in native fibroblast cells derived from the patient and her parents, thus excluding the possibility that the {Delta}6{Delta}7 transcript is an artefact due to the Epstien–Barr virus (EBV) immortalization of the LCLs.

Using semi-quantitative fragment analysis and real-time PCR, we were able to show that the {Delta}6{Delta}7 transcript was also present in controls and in patients with the 657{Delta}5 NBS1 mutation, but at a level 100-fold lower (Figs 3 and 4). Similarly, the amount of full-length mRNA in cells from the patient R.R. was reduced 10-fold in comparison to the controls. The use of specific boundary primers confirmed the presence of {Delta}6{Delta}7 transcript in the control cells and in patients with other NBS1 mutations, suggesting that the {Delta}6{Delta}7 transcript represents a minor, constitutively expressed alternative splice variant, the detection of which in the control samples is dependent on the sensitivities of the methods used. A similar situation has been reported for the COL17A1 gene, where a transcript with an in-frame deletion of exon 33, caused by the nonsense mutation, R975X, was also seen in normal cultured keratinocytes under special PCR conditions (22Go).

The preserved reading frame of the {Delta}6{Delta}7 transcript suggests that it may code for a partially functional protein of ~70 kDa that could be responsible for the very mild phenotype of the patient. Indeed, IP analysis showed a protein of 70 kDa in the patient and her parents, similar to the alternatively translated protein found in lymphoblastoid cells but not in fibroblasts of patients with the 657{Delta}5 NBS1 mutation (8Go,9Go). However, the 70 kDa protein found in cells from patient R.R. and her parents clearly has an independent origin, as it is observed in patient fibroblasts (Fig. 5). As mentioned above, alternative translation initiation has also been shown for the NBS1 mutation 834{Delta}4 (8Go,9Go), also located in exon 7, 105 bp downstream of the 742insGG mutation and for the 900{Delta}25 mutation (9Go) in exon 8, producing proteins of 60 and 55 kDa, respectively.

If we assume that the 70 kDa fragment identified in our patient's cells is also a result of alternative translation, a suitable initiation codon should be identifiable. Careful analysis of the sequence, surrounding the 742insGG mutation, revealed a potential downstream ATG codon which would predict a protein of 461 aminoacids and 51 kDa, not 70 kDa. Utilization of the upstream alternative start codon of the 657{Delta}5 allele would result in truncation after just 30 amino acids.

A more plausible explanation for the origin of the 70 kDa protein detected is that it results from the {Delta}6{Delta}7 transcript. This suggestion is strongly supported by the fact that the 70 kDa protein fragment is seen not only in LCLs but also in native fibroblasts derived from patient R.R.; the truncated protein associated with alternative translation initiation before the 657{Delta}5 mutation is not observed in primary fibroblasts (8Go). In this case, the {Delta}6{Delta}7 protein would have a preserved C-terminus, involved in the binding of nibrin to MRE11, a prerequisite for the formation of the trimeric repair complex (23Go,24Go). In contrast to the truncated protein resulting from the 657{Delta}5 allele, however, the {Delta}6{Delta}7 fragment would also have a preserved N-terminus with both the FHA and BRCT domains, important for the protein's interaction with other components of the DNA repair machinery (25Go).

It could be argued, therefore, that the {Delta}6{Delta}7 protein might uphold nibrin's cellular functions even better than the product of the 657{Delta}5 allele.

Additionally, the {Delta}6{Delta}7 fragment would have the most important serine residues which are phosphorylated by ATM in the early response to IR (26Go–28Go). However, even with preserved N-terminal domains and ATM-phosphorylation sites, the patient's cells failed to form radiation-induced MRE11 foci and exhibited radiation-induced chromosomal breakage typical for NBS (Figs 6 and 7). In addition, the lymphoblastoid cells of patient R.R. showed the same radiation-induced cell cycle perturbations, G2-phase accumulation and G1/G2 ratio, as LCLs with the 657{Delta}5 mutation (data not shown).

Since the 742insGG mutation leads seemingly to a milder phenotype, presumably other aspects of nibrin's function, independent of the cellular response to IR and not addressed by the assays employed here, are more faithfully maintained. We recently described a null-mutant mouse model (20Go) which allows evaluation of nibrin mutations with respect to general cellular viability, a possibly more appropriate endpoint. Indeed, we were able to show here that mouse cells with null mutations in the NBS1 homologue, Nbn, which do not survive in vitro are partially rescued by transduction with an artificial cDNA, lacking the sequence coded by exons 6 and 7 (Fig. 8). The level of correction is even better than when the cDNA carrying the 657{Delta}5 is transferred (20Go). A cDNA containing the GG insertion does not rescue these cells from cell death. These data support the suggestion that an alternatively spliced NBS1 {Delta}6{Delta}7 transcript indeed produces a partially functional protein.

Exon skipping is not a rare event and is usually caused by changes in the consensus sequences at splice sites or in branch-point regions. However, the splicing process can also be affected by sequences located outside of these regions. For a number of human inherited diseases, it has been reported that nonsense mutations, located outside these consensus sequences, can lead to in-frame skipping of the nonsense mutation-containing exon, a phenomenon called nonsense-mediated alternative splicing (NAS) (13Go–15Go,29Go,30Go). The resulting truncated protein is thus often responsible for a milder phenotype than expected for premature termination of translation (15Go,29Go).

Similar to our findings, unusually mild phenotypes have been recently reported in patients with AMP deaminase deficiency and non-Herlitz junctional epidermolysis bullosa due to NAS (22Go,31Go). The exact mechanism leading to NAS is unknown. Some reports explain NAS with the fact that premature stop codons normally result in reduced mRNA levels due to nonsense-mediated mRNA decay. A reduction of normally spliced transcripts leads to an increase in the relative abundance of alternatively spliced transcripts in which mutant exons are skipped and the reading frame re-established (13Go,32Go,33Go).

This explanation assumes a passive phenomenon, in our study; however, we have used real-time PCR to show that the {Delta}6{Delta}7 transcript is actually 100-fold more abundant in the patient's cells when compared with the controls, independent of relative abundance within the patient's cells. Compatible with such findings is the hypothesis whereby NAS involves an active nuclear reading-frame scanning mechanism prior to RNA splicing (34Go–36Go). In addition it was shown that purine-rich exon sequences play an essential role in splicing and functioning as cis-acting exon splicing enhancers (ESE) (37Go–41Go). Such sequences, which represent weaker splicing elements than the constitutive splice sites or branch points serve as recognition motifs for serine–arginine proteins that are required to promote exon definition and, consequently, splicing (42Go–45Go). Very recently, the role of another, negative regulatory element involved in mRNA splicing, namely, the exonic splicing silencer (ESS), has been described (46Go). ESSs interact specifically with heterogeneous nuclear ribonucleoproteins and so could play a critical role in repressing the use of pseudo-exons and controlling the efficiency of alternative exon inclusion (47Go). However, so far, there are only a few examples in the literature of the involvement of ESSs in splicing inhibition (46Go,48Go,49Go).

In contrast to ESS elements, the ESEs sequences have been studied more thoroughly and it has been shown that nonsense mutations that occur in such sequences could abrogate the activity of an ESE and lead to exon skipping. Indeed, almost all nonsense mutations associated with exon skipping occur in purine-rich sequences (38Go,50Go,51Go). In all these cases, the splicing of the mutated exon results in an in-frame deleted transcript and a protein with partially preserved functions. The 742insGG mutation is also located in a purine-rich sequence, similar to others reported to function as ESEs (50Go,52Go).

To test whether the 742insGG mutation disrupts a putative ESE site in exon 7 of the NBS1 gene, we analysed the wild-type and mutant exon sequence with the ESE-prediction program RESCUE-ESE http://genes.mit.edu/burgelab/ rescue-ese, which allows the identification of putative ESE sequences (53Go,54Go). This analysis indicated that the 742insGG mutation lies immediately adjacent to a putative ESE sequence, AAGCTA, predicted by the RESCUE-ESE program. Although, the insertion GG does not directly disrupt the ESE sequence, its proximity might interfere with, and reduce, its splicing activity. The 742insGG mutation adds two further guanine nucleotides to the four already present. It has been previously shown that the presence of poly-guanine at a putative ESE leads to loss of splicing-enhancer activity (41Go). This could explain the presence of a minor constitutive {Delta}6{Delta}7 transcript in the control RNA samples, with four guanines, and an increase in {Delta}6{Delta}7 transcript amount in RNA samples with six guanines from the patient R.R. and her parents.

Interestingly, most of the reported nonsense-mediated exon-skipping events eliminate only the single exon harbouring the truncating mutation (13Go,14Go,16Go). In our case, the skipping of only exon 7 of the NBS1 gene would result in a frameshift and protein truncation. The NBS1 transcript can only remain in-frame if both exons 6 and 7 are deleted. This fact supports our suggestion that the presence of the alternatively spliced transcript is the result of an active mechanism in which the re-establishment of the reading frame requires elimination of two exons.

In conclusion, we describe here for the first time a highly expressed, aberrantly spliced transcript of the NBS1 gene, with skipped exons 6 and 7, in an NBS patient with very mild phenotype. The same transcript was also found in control samples and patients with other NBS1 mutations, however, in considerably smaller amounts. Real-time PCR excluded that the {Delta}6{Delta}7 transcript is merely an artefact. IP experiments demonstrated a 70 kDa fragment in the patient's cells. In addition, we were able to show that an artificial cDNA lacking the exons 6 and 7 partially rescues the viability of murine cells with null mutations in the NBS1 homologue, Nbn. Therefore, we propose that the {Delta}6{Delta}7 transcript accounts for the unusually mild phenotype in the patient described here.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
WEB RESOURCES
 REFERENCES
 
Patient description
Patient R.R. was first described in 1986 by Maraschio et al. (21Go). At that time, 33 years old, the patient had been referred for chromosomal analysis because of primary amenorrhoea. The analysis revealed a high incidence of chromosomal aberrations and rearrangements involving chromosomes 7 and 14. Enhanced chromosome and chromatid abnormalities after exposure of patient cells to mitomycin C were also observed. Further follow-up of the patient showed that she had microcephaly, a typical feature of NBS. Interestingly, R.R. has no overt immunodeficiency and is not particularly infection-prone. She has a very mild reduction in Ig isotypes G2 and G4, which has, however, no clinical relevance. The patient's healthy parents are consanguineous and a younger sister, also with primary amenorrhoea and most probably suffering from the same disease, died at the age of 20 due to malignant lymphoma. After diagnosis, she underwent a 3-week cycle of radiotherapy with a maximum skin dose of 30 Gy. Unlike most NBS patients, she suffered no toxic reaction to this treatment. The father of R.R., who is a carrier of the 742insGG mutation, has recently developed two different malignancies, prostate cancer and breast cancer.

The suspected diagnosis of NBS was confirmed 15 years later by detecting that R.R. was homozygous for the NBS1 mutation, 742–743insGG, in exon 7. The patient is now 53 years old and is still in very good health. To the best of our knowledge, R.R. is the oldest known NBS patient.

RT–PCR
After written informed consent, EBV-immortalized LCLs and fibroblast cell lines were established. RNA was extracted from cultured LCLs and fibroblast cells of NBS patients with the mutations 742insGG, 657{Delta}5 and 900{Delta}25, both parents of patient R.R. and controls, according to standard procedures (Trizol). For the first-strand cDNA synthesis, 2 µg RNA of each sample, MMLV reverse transcriptase and random hexamer primers were used. The subsequent RT–PCR reaction used 2 µl of the cDNA product and specific NBS1 primers, covering the whole mRNA in overlapping fragments: exons 1–6, exons 5–10 and exons 8–16 (primer sequences are available on request). The resulting PCR-product(s) were cloned with the TOPO Cloning Kit, sequenced with M13 universal primers and run on the ABI PRIZM 3100 DNA analyzer.

Semi-quantitative fragment analysis
Semi-quantitative PCR-based fragment analysis with an FAM-labelled forward primer was carried out to determine the relative abundance of the wild-type and the aberrant transcript found in patient R.R and her parents. The primers used for this amplification were located in exons 5 and 10 of the NBS1 gene. After amplification, the fluorescence intensity was measured on the ABI PRIZM 3100 DNA analyzer.

Real-time PCR
To exactly quantify the amounts of the normal and alternatively spliced transcripts ({Delta}6{Delta}7) found in cells from the patient R.R. and her parents, specific TaqMan probes were employed: AGGACGGCAGGAAAG AAAACAAATCT (FAM labelled) located in exon 6, thus detecting the normal transcript, and TAGACCTATTCCTGAAGCAGAAATTGGATTGG (ROX labelled) located in exon 8, detecting the {Delta}6{Delta}7 transcript. Real-time PCR was performed with the ABI 7500 Real-Time PCR System. We designed primers between exons 5–6 and 7–6 to amplify the normal transcript, and between exons 5–8 and 9–8 to amplify the {Delta}6{Delta}7 transcript (primer sequences are available on request). All samples were analysed in duplicate. A standard curve was plotted for each primer-probe set with Ct values obtained from the amplification of known quantities of the cloned wild-type and {Delta}6{Delta}7 fragments (1010–101 copy numbers/µl). The copy number of each sample was determined by plotting the Ct-value versus the log of the copy numbers included in each standard curve.

Immunoprecipitation
For the IP analysis, lysates were prepared using standard techniques from the LCLs and fibroblasts indicated. Lysates were incubated for 90 min at 4°C with protein G-coated magnetic beads (Dynabeads) preloaded with equal quantities of polyclonal rabbit antibodies directed against MRE11 and nibrin (Novus Biologicals). After washing, the beads were boiled in gel loading buffer and released proteins were separated on a 4–12% polyacrylamide gel (NuPage) and transferred to a Hybond ECL nitrocellulose membrane. MRE11 was detected using the murine monoclonal antibody, 12D7 (GeneTex), and nibrin with the same polyclonal antibody used for precipitation.

Radiation-induced focus formation
To examine the subcellular localization of the MRE11 complex in cells carrying the NBS1 742insGG mutation, primary fibroblasts were irradiated at 37°C and 8 h later were fixed for 10 min in 4% paraformaldehyde, permeabilized for 5 min at 4°C in 0.5% Triton X-100 and blocked by incubation overnight at 4°C in 2% BSA in phosphate-buffered saline. Slides were then incubated with a primary rabbit antibody directed towards MRE11 (Novus Biologicals) followed by detection with a secondary Cy2-conjugated goat anti rabbit-Ig antibody (Dianova). Cell nuclei were counterstained with 4',6-diamidino-2-2-phenylindole. Digital microscopy was performed with the Zeiss Axiophot microscope equipped with a CCD camera (SensiCam). Fluorescent signals were pseudo-coloured by the AxioVision software.

RESCUE ESE program
We performed searches for putative ESEs in the NBS1 gene for the wild-type sequence and for the sequence containing the 742insGG mutation using the RESCUE-ESE program http://genes.mit.edu/burgelab/rescue-ese.

Induced chromosomal aberrations
Radiosensitivity was evaluated in LCLs from a normal individual, cells established from the R.R. and from a classical NBS patient homozygous for the 657{Delta}5 mutation. Exponentially growing cells were exposed to 15–30 cGy X-rays (Gilardoni apparatus, 70 cGy/min, 250 kV, 6 mA, 0.2 mm Cu filter) and harvested 3 h later, after addition of 5x10–6 M colchicine. Routine air-dried preparations and Giemsa staining were carried out; chromosomal aberrations were scored in 100 metaphases in three separate experiments. Chromatid and chromosome gaps were not included in the total rate.

Plasmids and retroviral gene transfer
The retroviral vector pLXIN-NBS1 has been described previously (55Go) and was kindly provided by Dr Pat Concannon. To construct vectors containing NBS1 cDNA with a GG insertion at position 742/743 and NBS1 cDNA with the sequence from exons 6 and 7 deleted, primers Ex2.F (TGACTGGCGTTGAGTACGTT) and Ex9:R (TGTATCTGCTTGCTCTGATT) were used to amplify the corresponding 1066 and 754 bp cDNA fragments from RNA extracted from the patient's lymphoblastoid cells. PCR products were purified, cut with SnaBI and BclI and ligated into SnaBI/BclI cleaved pLXIN-NBS1. Clones were sequenced to check integrity.

pLXIN-NBS1, pLXIN-NBS1-ins-GG and pLXIN-NBS1-{Delta}6{Delta}7 plasmid DNAs were transfected into Phoenix Eco cells for packaging. Viral supernatants were collected 48 h after transfection, and transduction of Nbnins6/lox6 mouse fibroblast cells was carried out by exposure to viral supernatants at intermediate confluence in six-well plates. Three rounds of transduction were performed in the presence of 7.5 µg/ml protamine (Roche). Two days after the final transduction, G418 was added to the cultures to 400 µg/ml. Stable transductants were isolated 10 days later, expanded and checked for expression of the human nibrin mRNAs by RT–PCR.

Complementation analysis: quantification of Nbn null mutant cells by semi-quantitative real-time PCR analysis of Nbn alleles
This assay has been basically described previously (20Go), although now a new, real-time PCR has been developed for quantification. Briefly, transductant murine Nbnins6/lox6 fibroblasts carrying mutated human NBS1 cDNAs, were treated with 6 µM cre recombinase fusion protein for 5 h in vitro. Thereafter, cells were collected at regular intervals by trypsination and total cells counted. The proportion of homozygous null mutant cells was measured by a real-time PCR on DNA extracted from the cells. Primers Ex6.F (CCCATTGATGAACCAGCTA) and Ex6.R (TAGAATTACCTGCTTGGCAT) and Ex7.F (CGCTTTTTAAAGTGCTTCCT) and Ex7.R (GAAAAGAAGCTCTGTTCCTC) were used to amplify 116 bp of exon 6 and 119 bp of exon 7, respectively. After cre recombinase-mediated deletion, exon 6 is lost from the loxP-flanked Nbn allele, the relative amount of exon 6 PCR products reflects, therefore, directly the proportion of Nbnins6/{Delta}6 and Nbnins6/lox6 cells in the sample. Specific dual label probes for exon 6 (5'-FAM-AGTGTTGATCTGTCAGGGCGACA-Dabcyl-3') and exon 7 (5'-YAK-TCGGCAGTTGCTTTCGGAGGT-Dabcyl-3') were used in the Applied Biosystems 7500 Real-Time PCR System. The following formulas were used for data calculations:

Formula
where CT is the cycle threshold, Reference the untreated Nbnins6/lox6 cells and Sample the Nbnins6/lox6 cells at various time points after treatment with cre recombinase to yield Nbnins6/{Delta}6 cells.

The data are plotted against cell generation calculated from the cell counts made at each harvesting point. The experiment was performed in triplicate and the standard deviation ranged from 0.2 to 12.0.


   WEB RESOURCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 WEB RESOURCES
REFERENCES
 
Accession numbers and URLs for the data presented herein are as follows: NCBI, http://www.ncbi.nlm.nih.gov/; Online Mendelian Inheritance in Man (OMIM), http://www.ncbi.nlm.nih.gov/Omim/; RESCUE-ESE program http://genes.mit.edu/burgelab/rescue-ese.


   ACKNOWLEDGEMENTS
 
We are indebted to family R. for their kind participation in this study. We also thank Susanne Rothe for her excellent technical assistance. This work was supported by grants from the Deutsche Forschungs Gemeinschaft to M.D. and K.S. and partly by ‘Test genetici:dalla ricerca alla clinica’ (ISS-3AP/F3) to A.A. and C.T.

Conflict of Interest statement. None declared.


   FOOTNOTES
 
{dagger} These two authors contributed equally to this study. Back


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 WEB RESOURCES
 REFERENCES
 

  1. TINBSS Group. (2000) Nijmegen breakage syndrome. Arch. Dis. Child., 82, 400–406.[Abstract/Free Full Text]

  2. Varon, R., Vissinga, C., Platzer, M., Cerosaletti, K.M., Chrzanowska, K.H., Saar, K., Beckmann, G., Seemanova, E., Cooper, P.R., Nowak, N.J. et al. (1998) Nibrin, a novel DNA double-strand break repair protein, is mutated in Nijmegen breakage syndrome. Cell, 93, 467–476.[CrossRef][Web of Science][Medline]

  3. Carney, J.P., Maser, R.S., Olivares, H., Davis, E.M., Le Beau, M., Yates, J.R., 3rd, Hays, L., Morgan, W.F. and Petrini, J.H. (1998) The hMre11/hRad50 protein complex and Nijmegen breakage syndrome: linkage of double-strand break repair to the cellular DNA damage response. Cell, 93, 477–486.[CrossRef][Web of Science][Medline]

  4. Ranganathan, V., Heine, W.F., Ciccone, D.N., Rudolph, K.L., Wu, X., Chang, S., Hai, H., Ahearn, I.M., Livingston, D.M., Resnick, I. et al. (2001) Rescue of a telomere length defect of Nijmegen breakage syndrome cells requires NBS and telomerase catalytic subunit. Curr. Biol., 11, 962–966.[CrossRef][Web of Science][Medline]

  5. Maraschio, P., Danesino, C., Antoccia, A., Ricordy, R., Tanzarella, C., Varon, R., Reis, A., Besana, D., Guala, A. and Tiepolo, L. (2001) A novel mutation and novel features in Nijmegen breakage syndrome. J. Med. Genet., 38, 113–117.[Free Full Text]

  6. Resnick, I.B., Kondratenko, I., Togoev, O., Vasserman, N., Shagina, I., Evgrafov, O., Tverskaya, S., Cerosaletti, K.M., Gatti, R.A. and Concannon, P. (2002) Nijmegen breakage syndrome: clinical characteristics and mutation analysis in eight unrelated Russian families. J. Pediatr., 140, 355–361.[CrossRef][Medline]

  7. New, H.V., Cale, C.M., Tischkowitz, M., Jones, A., Telfer, P., Veys, P., D'Andrea, A., Mathew, C.G. and Hann, I. (2005) Nijmegen breakage syndrome diagnosed as Fanconi anaemia. Pediatr. Blood Cancer, 44, 494–499.[CrossRef]

  8. Maser, R.S., Zinkel, R. and Petrini, J.H. (2001) An alternative mode of translation permits production of a variant NBS1 protein from the common Nijmegen breakage syndrome allele. Nat. Genet., 27, 417–421.[CrossRef][Web of Science][Medline]

  9. Tanzanella, C., Antoccia, A., Spadoni, E., di Masi, A., Pecile, V., Demori, E., Varon, R., Marseglia, G.L., Tiepolo, L. and Maraschio, P. (2003) Chromosome instability and nibrin protein variants in NBS heterozygotes. Eur. J. Hum. Genet., 11, 297–303.[CrossRef][Web of Science][Medline]

  10. Dumon-Jones, V., Frappart, P.O., Tong, W.M., Sajithlal, G., Hulla, W., Schmid, G., Herceg, Z., Digweed, M. and Wang, Z.Q. (2003) Nbn heterozygosity renders mice susceptible to tumor formation and ionizing radiation-induced tumorigenesis. Cancer Res., 63, 7263–7269.[Abstract/Free Full Text]

  11. Zhu, J., Petersen, S., Tessarollo, L. and Nussenzweig, A. (2001) Targeted disruption of the Nijmegen breakage syndrome gene NBS1 leads to early embryonic lethality in mice. Curr. Biol., 11, 105–109.[CrossRef][Web of Science][Medline]

  12. Maraschio, P.D., Danescino, C., Varon, R. Tiepolo, L. (2002) Authors' reply. J. Med. Genet., 39, e25.[Free Full Text]

  13. Chen, B., Rigat, B., Curry, C. and Mahuran, D.J. (1999) Structure of the GM2A gene: identification of an exon 2 nonsense mutation and a naturally occurring transcript with an in-frame deletion of exon 2. Am. J. Hum. Genet., 65, 77–87.[Medline]

  14. Sossi, V., Giuli, A., Vitali, T., Tiziano, F., Mirabella, M., Antonelli, A., Neri, G. and Brahe, C. (2001) Premature termination mutations in exon 3 of the SMN1 gene are associated with exon skipping and a relatively mild SMA phenotype. Eur. J. Hum. Genet., 9, 113–120.[CrossRef][Medline]

  15. Vuoristo, M.M., Pappas, J.G., Jansen, V. and Ala-Kokko, L. (2004) A stop codon mutation in COL11A2 induces exon skipping and leads to non-ocular Stickler syndrome. Am. J. Med. Genet. A, 130, 160–164.[CrossRef][Medline]

  16. Colige, A., Nuytinck, L., Hausser, I., van Essen, A.J., Thiry, M., Herens, C., Ades, L.C., Malfait, F., Paepe, A.D., Franck, P. et al. (2004) Novel types of mutation responsible for the dermatosparactic type of Ehlers–Danlos syndrome (type VIIC) and common polymorphisms in the ADAMTS2 gene. J. Invest. Dermatol., 123, 656–663.[CrossRef][Web of Science][Medline]

  17. Tessitore, A., Biordi, L., Flati, V., Toniato, E., Marchetti, P., Ricevuto, E., Ficorella, C., Scotto, L., Giannini, G., Frati, L. et al. (2003) New mutations and protein variants of NBS1 are identified in cancer cell lines. Genes Chromosomes Cancer, 36, 198–204.[CrossRef][Web of Science][Medline]

  18. Takakuwa, T., Luo, W.J., Ham, M.F. and Aozasa, K. (2004) A 50-bp insertion from intron 2 between exons 2 and 3 of NBS1 may be a spliced variant. Genes Chromosomes Cancer, 39, 341–342.[Medline]

  19. Varon, R., Schoch, C., Reis, A., Hiddemann, W.C., Sperling, K. and Schnittger, S. (2003) Mutation analysis of the Nijmegen breakage syndrome gene (NBS1) in nineteen patients with acute myeloid leukemia with complex karyotypes. Leuk. Lymphoma., 44, 1931–1934.[Medline]

  20. Demuth, I., Frappart, P.O., Hildebrand, G., Melchers, A., Lobitz, S., Stockl, L., Varon, R., Herceg, Z., Sperling, K., Wang, Z.Q. et al. (2004) An inducible null mutant murine model of Nijmegen breakage syndrome proves the essential function of NBS1 in chromosomal stability and cell viability. Hum. Mol. Genet., 13, 2385–2397.[Abstract/Free Full Text]

  21. Maraschio, P., Peretti, D., Lambiase, S., Lo Curto, F., Caufin, D., Gargantini, L., Minoli, L. and Zuffardi, O. (1986) A new chromosome instability disorder. Clin. Genet., 30, 353–365.[Medline]

  22. Ruzzi, L., Pas, H., Posteraro, P., Mazzanti, C., Didona, B., Owaribe, K., Meneguzzi, G., Zambruno, G., Castiglia, D. and D'Alessio, M. (2001) A homozygous nonsense mutation in type XVII collagen gene (COL17A1) uncovers an alternatively spliced mRNA accounting for an unusually mild form of non-Herlitz junctional epidermolysis bullosa. J. Invest. Dermatol., 116, 182–187.[CrossRef][Web of Science][Medline]

  23. Tauchi, H., Kobayashi, J., Morishima, K., Matsuura, S., Nakamura, A., Shiraishi, T., Ito, E., Masnada, D., Delia, D. and Komatsu, K. (2001) The forkhead-associated domain of NBS1 is essential for nuclear foci formation after irradiation but not essential for hRAD50[middle dot]hMRE11[middle dot]NBS1 complex DNA repair activity. J. Biol. Chem., 276, 12–15.[Abstract/Free Full Text]

  24. Desai-Mehta, A., Cerosaletti, K.M. and Concannon, P. (2001) Distinct functional domains of nibrin mediate Mre11 binding, focus formation, and nuclear localization. Mol. Cell. Biol., 21, 2184–2191.[Abstract/Free Full Text]

  25. Cerosaletti, K.M. and Concannon, P. (2003) Nibrin forkhead-associated domain and breast cancer C-terminal domain are both required for nuclear focus formation and phosphorylation. J. Biol. Chem., 278, 21944–21951.[Abstract/Free Full Text]

  26. Wu, X., Ranganathan, V., Weisman, D.S., Heine, W.F., Ciccone, D.N., O'Neill, T.B., Crick, K.E., Pierce, K.A., Lane, W.S., Rathbun, G. et al. (2000) ATM phosphorylation of Nijmegen breakage syndrome protein is required in a DNA damage response. Nature, 405, 477–482.[CrossRef][Medline]

  27. Gatei, M., Young, D., Cerosaletti, K.M., Desai-Mehta, A., Spring, K., Kozlov, S., Lavin, M.F., Gatti, R.A., Concannon, P. and Khanna, K. (2000) ATM-dependent phosphorylation of nibrin in response to radiation exposure. Nat. Genet., 25, 115–119.[CrossRef][Web of Science][Medline]

  28. Zhao, S., Weng, Y.C., Yuan, S.S., Lin, Y.T., Hsu, H.C., Lin, S.C., Gerbino, E., Song, M.H., Zdzienicka, M.Z., Gatti, R.A. et al. (2000) Functional link between ataxia-telangiectasia and Nijmegen breakage syndrome gene products. Nature, 405, 473–477.[CrossRef][Medline]

  29. McGrath, J.A., Ashton, G.H., Mellerio, J.E., Salas-Alanis, J.C., Swensson, O., McMillan, J.R. and Eady, R.A. (1999) Moderation of phenotypic severity in dystrophic and junctional forms of epidermolysis bullosa through in-frame skipping of exons containing non-sense or frameshift mutations. J. Invest. Dermatol., 113, 314–321.[CrossRef][Web of Science][Medline]

  30. Caputi, M., Kendzior, R.J., Jr and Beemon, K.L. (2002) A nonsense mutation in the fibrillin-1 gene of a Marfan syndrome patient induces NMD and disrupts an exonic splicing enhancer. Genes Dev., 16, 1754–1759.[Abstract/Free Full Text]

  31. Morisaki, H., Morisaki, T., Newby, L.K. and Holmes, E.W. (1993) Alternative splicing: a mechanism for phenotypic rescue of a common inherited defect. J. Clin. Invest., 91, 2275–2280.[Web of Science][Medline]

  32. Valentine, C.R. and Heflich, R.H. (1997) The association of nonsense mutation with exon-skipping in hprt mRNA of Chinese hamster ovary cells results from an artifact of RT–PCR. RNA, 3, 660–676.[Abstract]

  33. Valentine, C.R. (1998) The association of nonsense codons with exon skipping. Mutat. Res., 411, 87–117.[CrossRef][Web of Science][Medline]

  34. Zatkova, A., Messiaen, L., Vandenbroucke, I., Wieser, R., Fonatsch, C., Krainer, A.R. and Wimmer, K. (2004) Disruption of exonic splicing enhancer elements is the principal cause of exon skipping associated with seven nonsense or missense alleles of NF1. Hum. Mutat., 24, 491–501.[CrossRef][Web of Science][Medline]

  35. Hentze, M.W. and Kulozik, A.E. (1999) A perfect message: RNA surveillance and nonsense-mediated decay. Cell, 96, 307–310.[CrossRef][Web of Science][Medline]

  36. Mendell, J.T. and Dietz, H.C. (2001) When the message goes away: disease-producing mutations that influence mRNA content and performance. Cell, 107, 411–414.[CrossRef][Web of Science][Medline]

  37. Cooper, T.A. and Mattox, W. (1997) The regulation of splice-site selection, and its role in human disease. Am. J. Hum. Genet., 61, 259–266.[Web of Science][Medline]

  38. Shiga, N., Takeshima, Y., Sakamoto, H., Inoue, K., Yokota, Y., Yokoyama, M. and Matsuo, M. (1997) Disruption of the splicing enhancer sequence within exon 27 of the dystrophin gene by a nonsense mutation induces partial skipping of the exon and is responsible for Becker muscular dystrophy. J. Clin. Invest., 100, 2204–2210.[Web of Science][Medline]

  39. Watakabe, A., Sakamoto, H. and Shimura, Y. (1991) Repositioning of an alternative exon sequence of mouse IgM pre-mRNA activates splicing of the preceding intron. Gene Expr., 1, 175–184.[Medline]

  40. Watakabe, A., Tanaka, K. and Shimura, Y. (1993) The role of exon sequences in splice site selection. Genes Dev., 7, 407–418.[Abstract/Free Full Text]

  41. Tanaka, K., Watakabe, A. and Shimura, Y. (1994) Polypurine sequences within a downstream exon function as a splicing enhancer. Mol. Cell. Biol., 14, 1347–1354.[Abstract/Free Full Text]

  42. Valcarcel, J. and Green, M.R. (1996) The SR protein family: pleiotropic functions in pre-mRNA splicing. Trends Biochem. Sci., 21, 296–301.[CrossRef][Web of Science][Medline]

  43. Blencowe, B.J. (2000) Exonic splicing enhancers: mechanism of action, diversity and role in human genetic diseases. Trends Biochem. Sci., 25, 106–110.[CrossRef][Web of Science][Medline]

  44. Graveley, B.R. (2000) Sorting out the complexity of SR protein functions. RNA, 6, 1197–1211.[CrossRef][Web of Science][Medline]

  45. Xu, R., Teng, J. and Cooper, T.A. (1993) The cardiac troponin T alternative exon contains a novel purine-rich positive splicing element. Mol. Cell. Biol., 13, 3660–3674.[Abstract/Free Full Text]

  46. Wang, Z., Rolish, M.E., Yeo, G., Tung, V., Mawson, M. and Burge, C.B. (2004) Systematic identification and analysis of exonic splicing silencers. Cell, 119, 831–845.[CrossRef][Web of Science][Medline]

  47. Fu, X.D. (2004) Towards a splicing code. Cell, 119, 736–738.[CrossRef][Web of Science][Medline]

  48. Hayakawa, M., Sakashita, E., Ueno, E., Tominaga, S., Hamamoto, T., Kagawa, Y. and Endo, H. (2002) Muscle-specific exonic splicing silencer for exon exclusion in human ATP synthase gamma-subunit pre-mRNA. J. Biol. Chem., 277, 6974–6984.[Abstract/Free Full Text]

  49. Rothrock, C.R., House, A.E. and Lynch, K.W. (2005) HnRNP L represses exon splicing via a regulated exonic splicing silencer. EMBO J., 24, 2792–2802.[CrossRef][Web of Science][Medline]

  50. Pie, J., Casals, N., Casale, C.H., Buesa, C., Mascaro, C., Barcelo, A., Rolland, M.O., Zabot, T., Haro, D., Eyskens, F. et al. (1997) A nonsense mutation in the 3-hydroxy-3-methylglutaryl-CoA lyase gene produces exon skipping in two patients of different origin with 3-hydroxy-3-methylglutaryl-CoA lyase deficiency. Biochem. J., 323, 329–335.[Medline]

  51. Di Blasi, C., He, Y., Morandi, L., Cornelio, F., Guicheney, P. and Mora, M. (2001) Mild muscular dystrophy due to a nonsense mutation in the LAMA2 gene resulting in exon skipping. Brain, 124, 698–704.[Abstract/Free Full Text]

  52. Dirksen, W.P., Sun, Q. and Rottman, F.M. (1995) Multiple splicing signals control alternative intron retention of bovine growth hormone pre-mRNA. J. Biol. Chem., 270, 5346–5352.[Abstract/Free Full Text]

  53. Cartegni, L., Wang, J., Zhu, Z., Zhang, M.Q. and Krainer, A.R. (2003) ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res., 31, 3568–3571.[Abstract/Free Full Text]

  54. Fairbrother, W.G., Yeh, R.F., Sharp, P.A. and Burge, C.B. (2002) Predictive identification of exonic splicing enhancers in human genes. Science, 297, 1007–1013.[Abstract/Free Full Text]

  55. Cerosaletti, K.M., Desai-Mehta, A., Yeo, T.C., Kraakman-Van Der Zwet, M., Zdzienicka, M.Z. and Concannon, P. (2000) Retroviral expression of the NBS1 gene in cultured Nijmegen breakage syndrome cells restores normal radiation sensitivity and nuclear focus formation. Mutagenesis, 15, 281–286.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
15/5/679    most recent
ddi482v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Varon, R.
Right arrow Articles by Maraschio, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Varon, R.
Right arrow Articles by Maraschio, P.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?