Skip Navigation


Human Molecular Genetics Advance Access originally published online on January 30, 2006
Human Molecular Genetics 2006 15(6):839-851; doi:10.1093/hmg/ddl003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow All Versions of this Article:
15/6/839    most recent
ddl003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Correa-Cerro, L. S.
Right arrow Articles by Porter, F. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Correa-Cerro, L. S.
Right arrow Articles by Porter, F. D.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Published by Oxford University Press 2006

Development and characterization of a hypomorphic Smith–Lemli–Opitz syndrome mouse model and efficacy of simvastatin therapy

Lina S. Correa-Cerro1, Christopher A. Wassif1, Lisa Kratz5, Georgina F. Miller2, Jeeva P. Munasinghe3, Alexander Grinberg4, Steven J. Fliesler6 and Forbes D. Porter1,*

1Unit on Molecular Dysmorphology, Heritable Disorders Branch, National Institute of Child Health and Human Development, 2Veterinary Resources Program, 3Mouse Imaging Facility and 4Laboratory of Mammalian Genes and Development, National Institutes of Health, DHHS, Bethesda, MD USA, 5The Johns Hopkins University, Kennedy Krieger Institute, Baltimore, MD, USA and 6St Louis University Eye Institute, and Department of Pharmacological and Physiological Science, St Louis University School of Medicine, St Louis, MO, USA

* To whom correspondence should be addressed at: Heritable Disorders Branch, National Institute of Child Health and Human Development, National Institutes of Health, Boulevard 10, Room 9D42, 10 Center Dr., Bethesda, MD 20892, USA. Tel: +1 3014354432; Fax: +1 3014805791; Email: fdporter{at}mail.nih.gov

Received December 20, 2005; Accepted January 23, 2006


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Smith–Lemli–Opitz syndrome (SLOS) is a genetic syndrome caused by mutations in the 3ß-hydroxysterol {Delta}7-reductase gene (DHCR7). SLOS patients have decreased cholesterol and increased 7-dehydrocholesterol (7-DHC) levels. Dietary cholesterol supplementation improves systemic biochemical abnormalities; however, because of the blood–brain barrier, the central nervous system (CNS) is not treated. Simvastatin therapy has been proposed as a means to treat the CNS. Mice homozygous for a null disruption of Dhcr7, Dhcr7{Delta}3–5/{Delta}3–5, die soon after birth, thus they cannot be used to study postnatal development or therapy. To circumvent this problem, we produced a hypomorphic SLOS mouse model by introducing a mutation corresponding to DHCR7T93M. Both Dhcr7T93M/T93M and Dhcr7{Delta}3–5/T93M mice are viable. Phenotypic findings in Dhcr7T93M/{Delta}3–5 mice include CNS ventricular dilatation and two to three syndactyly. Biochemically, both Dhcr7T93M/T93M and Dhcr7T93M/{Delta}3–5 mice have elevated tissue 7-DHC levels; however, the biochemical defect improved with age. This has not been observed in human patients, and is due to elevated Dhcr7 expression in mouse tissues. Dietary cholesterol therapy improved sterol profiles in peripheral, but not CNS tissues. However, treatment of Dhcr7T93M/{Delta}3–5 mice with simvastatin decreased 7-DHC levels in both peripheral and brain tissues. Expression of Dhcr7 increased in Dhcr7T93M/{Delta}3–5 tissues after simvastatin therapy, consistent with the hypothesis that simvastatin therapy improves the biochemical phenotype by increasing the expression of a Dhcr7 allele with residual enzymatic activity. We conclude that simvastatin treatment is efficacious in improving the SLOS-associated sterol abnormality found in the brain, and thus has the potential to be an effective therapeutic intervention for behavioral and learning problems associated with SLOS.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Smith–Lemli–Opitz syndrome (SLOS) is an autosomal recessive, multiple malformation, mental retardation syndrome with an estimated incidence of 1/10 000 to 1/60 000 (1Go), first delineated in 1964 (2Go). Clinical manifestations include dysmorphic facial features, mental retardation and limb defects including cutaneous two to three toe syndactyly (3Go,4Go). In 1993, SLOS was shown to be due to an inborn error of cholesterol synthesis (5Go,6Go), and in 1998, mutations of the 3ß-hydroxysterol {Delta}7-reductase gene (DHCR7) were shown to cause SLOS (7Go–9Go). In the last step of cholesterol biosynthesis, DHCR7 reduces 7-dehydrocholesterol (7-DHC) to yield cholesterol. SLOS patients have increased 7-DHC and typically decreased serum and tissue cholesterol levels. Over 100 DHCR7 mutations have been identified in SLOS patients (10Go).

Biochemical improvement has been reported in SLOS patients treated with dietary cholesterol supplementation (11Go–16Go). Anecdotal reports have described multiple benefits of dietary cholesterol supplementation including improved growth, decreased irritability, increased sociability, decreased self-injurious behavior, decreased tactile defensiveness, fewer infections, improved muscle tone, reduced photosensitivity and decreased autistic findings [reviewed in (1Go)]. Although dietary cholesterol supplementation improves the biochemical abnormality in SLOS, it does not normalize 7-DHC levels (16Go). Dietary cholesterol also does not cross the blood–brain barrier (17Go,18Go), and treatment of SLOS patients with dietary cholesterol supplementation does not improve developmental scores (19Go).

Simvastatin therapy has been proposed to both reduce 7-DHC levels and treat the central nervous system (CNS) (20Go,21Go) in SLOS patients. Simvastatin inhibits 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase, the rate-limiting step in cholesterol biosynthesis, and also crosses the blood–brain barrier (22Go). In a two-patient trial (20Go), prolonged simvastatin therapy improved both serum and cerebral spinal fluid DHC/cholesterol ratios. As predicted, DHC levels decreased; however, a paradoxical increase in cholesterol levels was also reported. We have hypothesized that the paradoxical increase in cholesterol levels results from increased expression of a DHCR7 allele that encodes a mutant enzyme with residual enzymatic function, which is supported by in vitro experiments using SLOS fibroblasts (23Go).

We have been interested in developing a viable SLOS mouse model, both to study alterations of postnatal neurological development because of disrupted sterol synthesis and to evaluate the efficacy of therapeutic interventions. Mice homozygous for a null disruption of Dhcr7 (Dhcr7{Delta}3–5/{Delta}3–5) die soon after birth (24Go,25Go), thus this mouse model cannot be used to study postnatal development or therapies. In order to circumvent this problem, we developed a hypomorphic SLOS mouse model in which we introduced a mutation equivalent to the human T93M (c.278C>T) missense mutation. The T93M mutation is the most common missense mutation described in SLOS patients, and the T93M genotype is typically associated with a mild to classical clinical phenotype (10Go). Herein, we report the development and characterization of a viable, hypomorphic SLOS mouse model, and demonstrate its utility in assessing therapeutic interventions with potential clinical relevance to SLOS patient management.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Generation of a Dhcr7T93M hypomorphic mutant allele
We used site-directed mutagenesis to introduce a dinucleotide change (CA to TG) at nucleotides c.266–267 and a single nucleotide change (C to G) at nucleotide c.279 in the fourth exon of Dhcr7. The dinucleotide mutation alters mouse Dhcr7 codon 89 from ACA (Thr) to ATG (Met). The single nucleotide change at position c.279 is a silent polymorphism that creates an FspI restriction endonuclease site. The FspI restriction endonuclease site was introduced to facilitate genotyping. The T89 codon in murine Dhcr7 is homologous to the T93 codon in human DHCR7. As there is already an extensive literature referring to the human T93M allele, to facilitate comparison with the human mutation, we will use the designation Dhcr7T93M for this mutant allele. Using targeted homologous recombination in mouse embryonic stem cells, we introduced the Dhcr7T93M mutation into the endogenous Dhcr7 gene (Fig. 1A). We confirmed homologous recombination between the targeting vector and the endogenous allele in an embryonic stem cell line (pcon9) using allele-specific PCR amplification of both the 5' and 3' flanks (data not shown). We used this targeted embryonic stem cell line to produce germline-transmitting chimeric mice.


Figure 0031
View larger version (51K):
[in this window]
[in a new window]
 
Figure 1. Targeted insertion of the T93M mutation into Dhcr7 and phenotypic findings. (A) Schematic representation of the Dhcr7 genomic structure (NCBI GenBank accession no. NC_000073), targeting vector, and the resulting Dhcr7T93M allele. Filled boxes labeled with roman numerals represent coding exons. RI, EcoRI; BHI, BamHI. The relative position and orientation of PCR primers used for identifying properly targeted ES cell clones are labeled A–D. (B) Sequencing chromatograph demonstrating the presence of the T93M mutation (ATG) and the FspI restriction site (TGCGCA) in a Dhcr7T93M/T93M mouse. (C) Genotyping of 4-week-old mice from a Dhcr7T93M/+ intercross by PCR–restriction fragment length polymorphism (PCR–RFLP) analysis. FspI digestion of the PCR products yields a 330 bp fragment for the Dhcr7+ allele and a 170 bp/160 bp doublet for the Dhcr7T93M allele. The 170 bp and 160 bp fragments are not resolved on this gel. (D) No significant post-natal survival differences were observed between mutant and control mice. (E and F) Dhcr7T93M/{Delta}3–5 mice tend to be smaller and weigh less than control mice. (G) Syndactyly of the second and third toes was frequently observed in Dhcr7T93M/{Delta}3–5 mice (right photograph). We have not observed this malformation in control, heterozygous (left photograph), or Dhcr7T93M/T93M mice. (H) Ventricular dilatation was frequently observed in both Dhcr7T93M/{Delta}3–5 and Dhcr7T93M/T93M mice. Coronal sections demonstrate enlargement of both the lateral and third ventricles.

 
Consistent with an autosomal recessive disorder, heterozygous Dhcr7T93M/+ mice were phenotypically normal, thus they were intercrossed and mated with Dhcr7{Delta}3–5/+ mice to obtain Dhcr7T93M/T93M and Dhcr7{Delta}3–5/T93M mice, respectively. The Dhcr7{Delta}3–5 allele is a null allele that we previously developed and characterized (24Go). We also identified an embryonic stem cell clone without the Dhcr7T93M mutation, but with insertion of the loxP-Neo cassette. This control allele (Dhcr7neo) resulted from homologous recombination between the targeting vector and the endogenous allele where the 5'-flank crossover event occurred between the loxP-Neo cassette and the Dhcr7T93M mutation. As the loxP-Neo insertion produced no phenotypic or biochemical abnormalities, we did not excise the loxP-Neo insertion from the Dhcr7T93M allele. Sequencing of genomic DNA from a Dhcr7T93M/T93M mouse confirmed both the successful introduction of the TG dinucleotide mutation, and the introduction of the c.279 to create a silent FspI restriction site polymorphism (Fig. 1B). We used the FspI polymorphism to facilitate genotyping (Fig. 1C).

Phenotypic characterization
Both homozygous mutant (Dhcr7T93M/T93M) and compound heterozygous mutant mice Dhcr7T93M/{Delta}3–5 were viable and fertile. Dhcr7T93M/+ mice were intercrossed and an appropriate number of Dhcr7T93M/T93M mice were identified after weaning (60/247, 24%). However, a skewing of the expected Mendelian ratio was observed when we crossed Dhcr7T93M/T93M and Dhcr7+/{Delta}3–5 mice. Of 325 weaned mice from this cross, 147 (63%) were Dhcr7T93M/+ and 88 (37%) were Dhcr7T93M/{Delta}3–5 (P<0.01, Fisher's Exact Test). This discrepancy was also observed in newborns and at E13.5. Of 30 embryos, 23 (77%) were Dhcr7T93M/+ and seven (23%) were Dhcr7T93M/{Delta}3–5. Thus, approximately a quarter of Dhcr7T93M/{Delta}3–5 embryos appear to be lost early during embryonic development. We suspect that this is due to a maternal effect in Dhcr7T93M/T93M mice. Placental abnormalities have been described in other mouse models of inborn errors of cholesterol synthesis (26Go). Postnatal survival of Dhcr7T93M/T93M and Dhcr7T93M/{Delta}3–5 mice was similar to that of control mice (Fig. 1D). Dhcr7T93M/{Delta}3–5 mice tended to be slightly smaller than control mice (Fig. 1E and F). Dhcr7T93M/T93M mice appeared phenotypically normal. Sixty-four percent (18/28) of Dhcr7T93M/{Delta}3–5 mice had second and third toe syndactyly of at least one limb and this physical finding was present in 40% of all limbs (Fig. 1G). X-ray analysis showed no osseous syndactyly (data not shown). Cutaneous syndactyly of the second and third toes is the most common reported physical finding in SLOS patients (3Go).

Pathological evaluation of 3, 5 and 10-month old Dhcr7T93M/T93M and Dhcr7T93M/{Delta}3–5 mice was only notable for CNS ventricular dilatation. A description of the organ systems evaluated and laboratory testing that was performed is provided as Supplementary Material. Pathological evaluation demonstrated dilatation of the lateral and third ventricles in 6/9 (67%) Dhcr7T93M/T93M and 12/16 (75%) Dhcr7T93M/{Delta}3–5 mice (Fig. 1H). Very mild ventricular dilatation was observed in only one of 17 Dhcr7+/+ control mice (Dhcr7T93M/T93M or Dhcr7T93M/{Delta}3–5 versus Dhcr7+/+: P<0.005 or P<0.0005, respectively, Fisher's exact test). Ventricular dilatation was noted as early as 3 months of age in one-third of Dhcr7T93M/{Delta}3–5 mice.

Ventricular dilatation was confirmed by magnetic resonance imaging (MRI) (Fig. 2A), and partial agenesis of the corpus callosum was a rare finding (Fig. 2B). Three-dimensional reconstruction of the MRI images showed that brain parenchymal volume was significantly (P<0.05) reduced in Dhcr7T93M/{Delta}3–5 mice between 2 and 12 months of age when compared with control mice (Fig. 2C). This difference was proportional to the reduction in body weight, and consistent as the animals aged. No structural abnormalities were identified that would obstruct CSF flow and there appeared to be no loss of parenchymal brain matter to explain the increased ventricular size. This defect is thus consistent with communicating hydrocephalus. In order to determine if an abnormal sterol composition of the brain would affect macromolecular interactions with water, we measured the apparent diffusion coefficient (ADC) in the cortex, cerebrum, corpus callosum, thalamus and optic nerve. ADC is an imaging modality that is sensitive to changes in the macromolecular environment, and we were interested in determining whether substitution of 7-DHC for cholesterol would alter cellular membranes sufficiently to be detected by this technique; however, we found that the ADC was similar in control and mutant mice at 2, 4 and 9-months of age (Fig. 2D).


Figure 0032
View larger version (51K):
[in this window]
[in a new window]
 
Figure 2. MRI analysis. (A) Axial MRI study demonstrating lateral ventricle dilatation in a 4-month-old Dhcr7T93M/{Delta}3–5 mouse. (B) Partial agenesis of the corpus callosum was a rare phenotypic finding. The corpus callosum is the dark band delineated by arrows in this coronal view, and this structure is discontinuous in the Dhcr7T93M/{Delta}3–5 mouse. (C) Parenchymal brain volumes were significantly (P<0.05) reduced in Dhcr7T93M/{Delta}3–5 mice when compared with Dhcr7T93M/+ mice. The reduction in parenchymal brain volume was proportional to the reduction in weight. (D) The average ADC was measured for cortex (peripheral circles), cerebrum (whole brain, peripheral line), corpus callosum (indicated by the arrowheads), thalamus (medial circles) and optic nerve (right). No significant differences were observed comparing ADC values obtained from either mutant or control mice.

 
Biochemical characterization
We measured sterol content of tissues from one-day-old Dhcr7+/+, Dhcr7T93M/T93M, Dhcr7T93M/{Delta}3–5 and Dhcr7{Delta}3–5/{Delta}3–5 pups using gas chromatography/mass spectrometry (GC/MS). DHC (DHC; 7-DHC plus 8-DHC) levels were significantly increased in both CNS (Fig. 3A) and peripheral (Fig. 3B) tissues consistent with the genotypic series Dhcr7+/+ << Dhcr7T93M/T93M<Dhcr7T93M/{Delta}3–5{approx}Dhcr7{Delta}3–5/{Delta}3–5. Cholesterol levels were significantly decreased, compared with controls, in both the CNS and peripheral tissues isolated from one-day-old Dhcr7T93M/{Delta}3–5 and Dhcr7{Delta}3–5/{Delta}3–5 pups (Fig. 3C). We also analyzed sterol content of tissues from 6-week-old mice. Tissue DHC levels were significantly increased in both Dhcr7T93M/T93M and Dhcr7T93M/{Delta}3–5 mice when compared with Dhcr7+/+ mice (Fig. 3D and E), and DHC levels were higher in Dhcr7T93M/{Delta}3–5 tissue when compared with Dhcr7T93M/T93M tissues. Unexpectedly, in both kidney and liver tissue, DHC levels decreased significantly between one-day-old mice and 6-week-old mice (Fig. 3B and E). In liver tissue from Dhcr7T93M/{Delta}3–5 mice, DHC levels decreased almost 10-fold from 494.0±113.0 µg/g tissue at 1-day of age to 51.4±21.4 µg/g tissue at 6 weeks of age (P<0.0005). In kidney tissue, from Dhcr7T93M/{Delta}3–5 mice, DHC levels decreased 2.4-fold from 437.4±187.7 µg/g tissue at 1-day of age to 180.5±36.4 µg/g tissue at 6 weeks of age (P<0.05). DHC levels remained elevated in brain tissue at 6 weeks of age (Fig. 3A and D). Cholesterol levels normalized by 6 weeks of age in both peripheral and CNS tissues from both Dhcr7T93M/T93M and Dhcr7T93M/{Delta}3–5 mice (Fig. 3F).


Figure 0033
View larger version (35K):
[in this window]
[in a new window]
 
Figure 3. Sterol analysis. Cholesterol and DHC (DHC, 7-DHC+8-DHC) levels were measured by GC/MS in brain cortex, cerebellar/midbrain, liver and kidney tissue from Dhcr7+/+, Dhcr7T93M/T93M, Dhcr7T93M/{Delta}3–5and Dhcr7{Delta}3–5/{Delta}3–5 mice. (A–C) DHC and cholesterol levels in tissues isolated from 1-day-old pups (*P<0.01, **P<0.05). (D–F) DHC and cholesterol levels in tissues isolated from 6-week-old mice. In Dhcr7T93M/{Delta}3–5 mice, independent of any therapeutic intervention, DHC levels decreased with age in both peripheral tissues such as liver (G) and CNS tissues such as brain cortex (H). For these studies, the mice were fed mouse chow containing no cholesterol.

 
To characterize this unexpected biochemical correction in DHC levels, we analyzed sterol content of tissues from Dhcr7T93M/{Delta}3–5 mice from 1 day, 2 weeks, 6 weeks, 8 months and 12-month-old animals. In liver tissue, we observed a significant (P<0.001) decrease in DHC levels by 2 weeks of age (Fig. 3G). Given that mouse milk contains cholesterol, this reduction could be due to dietary cholesterol supplementation; however, decreased DHC levels persisted out to 1-year of age on a cholesterol-free diet (Fig. 3G). DHC levels in brain cortex also significantly decreased after 6 weeks of age (Fig. 3H). This age-related decrease in DHC levels has not been observed in human SLOS patients.

We investigated several possible explanations for this biochemical correction. The T93M mutation is located in the N-terminal domain of DHCR7. We previously showed that deletion of the first 58 amino acids of DHCR7 still yields a functional enzyme (7Go), and fewer mutations are reported in the N-terminal domain of DHCR7 (10Go). We thus considered the possibility that a functional protein, not containing the T93M mutation, could be produced. Although a number of alternatively spliced transcripts of Dhcr7 have been reported (27Go), none of the alternatively spliced transcripts would be predicted to give rise to a functional protein excluding the T93M mutation. To confirm this, we identified and sequenced the previously reported alternative transcripts (AS-1, AS-2) in Dhcr7T93M/{Delta}3–5 liver and cortex samples using RT–PCR followed by nested PCR. None of these transcripts contained an open reading frame that could express a functional protein without the T93M mutation (data not shown).

We next confirmed that the mouse Dhcr7T93M protein had reduced enzymatic activity similar to the human DHCR7T93M protein. Using deuterium oxide labeling, we found that fractional cholesterol synthesis in mouse embryonic fibroblasts was reduced to 87% and 30% of control levels in Dhcr7T93M/T93M and Dhcr7T93M/{Delta}3–5 fibroblasts, respectively (Fig. 4A). Using this same assay, we previously showed that DHCR7T93M/null human skin fibroblast lines had fractional cholesterol synthesis of 24±6% (n=7, range 16–31%) (23Go). Thus, residual cholesterol synthesis in the equivalent embryonic mouse fibroblast line, Dhcr7T93M/{Delta}3–5, was not significantly different from that observed in human skin fibroblasts with the equivalent genotype. We also measured the conversion of deuterium-labeled lathosterol ([1,2,5{alpha},6{alpha}-2H] 5{alpha}-cholest-7-en-3ß-ol) to cholesterol in liver homogenates from Dhcr7+/+ and Dhcr7T93M/{Delta}3–5 mice. Conversion of lathosterol to cholesterol requires the sequential action of lathosterol 5-desaturase (Sc5d) and Dhcr7. Conversion of deuterium-labeled lathosterol to deuterium-labeled cholesterol was measured in liver S10 homogenates (the 10 000g supernatant fraction) from 8-week-old Dhcr7+/+ and Dhcr7T93M/{Delta}3–5 mice. Conversion of lathosterol to cholesterol was decreased to 31% of control levels in S10 homogenates from Dhcr7T93M/{Delta}3–5 livers (Fig. 4B). On the basis of these results, the murine Dhcr7T93M protein has reduced enzymatic activity comparable with the human DHCR7T93M protein.


Figure 0034
View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. Residual cholesterol synthesis and Dhcr7 activity. (A) Cholesterol synthesis is reduced to 87% and 30% of control levels in Dhcr7T93M/T93M and Dhcr7T93M/{Delta}3–5 embryonic fibroblasts, respectively. (B) Conversion of lathosterol to cholesterol was measured in liver S10 homogenates. Conversion of lathosterol to cholesterol requires the sequential action of Sc5d and Dhcr7. Cholesterol synthesis in S10 homogenates prepared from Dhcr7T93M/{Delta}3–5 livers was 33% of that observed in S10 homogenates prepared from Dhcr7+/+ livers (P<0.02).

 
We next analyzed Dhcr7 expression in mouse tissues to determine if persistent expression of a hypomorphic allele might explain the observed biochemical correction. In liver tissue, relative Dhcr7 expression markedly increases in 2-month-old mice and remains elevated in liver from 1-year-old mice (Fig. 5A). In contrast, relative to the expression level in brain tissue from 1-day-old mice, Dhcr7 expression decreases in both control and mutant tissue. The lower relative expression level in brain tissue is consistent with the slower biochemical correction observed in this tissue. We then determined, using absolute quantitative PCR, DHCR7 transcript levels in series of human brain cortex samples and compared this with the expression of Dhcr7 in 1-year-old mouse brain cortex. Expression of Dhcr7 was increased approximately 100-fold in mouse brain cortex when compared with expression of DHCR7 in human brain cortex (Fig. 5C). As we could not control for effects of dietary cholesterol intake prior to death, we did not perform a similar experiment using human liver tissue. However, by relative quantitative PCR, Dhcr7 expression is higher in mouse liver when compared with mouse brain cortex (data not shown).


Figure 0035
View larger version (22K):
[in this window]
[in a new window]
 
Figure 5. Dhcr7 expression. (A) Quantification of age-dependent Dhcr7 expression in mouse liver tissue. Dhcr7 expression is expressed relative to level found in 1-day-old control animals. Dhcr7 expression increases significantly in both controls (open columns) and Dhcr7T93M/{Delta}3–5 mutant (filled boxes). The Dhcr7{Delta}3–5 allele does not produce a transcript that is identified in this assay (data not shown), thus the decreased level of expression in the Dhcr7T93M/{Delta}3–5 livers when compared with control levels is expected. (B) Quantification of age-dependent Dhcr7 expression in mouse brain cortex tissue. Dhcr7 expression is expressed relative to level found in 1-day-old control animals. In the brain, Dhcr7 expression, decreases with increased age. This is consistent with the slower rate of biochemical correction observed in this tissue when compared with liver tissue. (C) Absolute quantification of DHCR7 transcripts in human brain cortex and Dhcr7 transcripts in mouse brain cortex. Dhcr7 expression in the 12-month mouse cortex (gray column) is approximately a 100-fold greater than DHCR7 expression in human cortex (black columns) at various ages (21–39 weeks EGA, n=3; 3–5 months, n=2; 1–2 years, n=2; 15–21 years, n=3).

 
Dietary cholesterol supplementation
Dietary cholesterol supplementation has become a standard therapy for SLOS patients. We evaluated dietary cholesterol supplementation by comparing mice on a diet containing no cholesterol and a diet containing 1.25%, by weight, cholesterol. The cholesterol-supplemented diet was introduced at 2-months of age and the mice were followed until 8-months of age. Survival was similar in cholesterol-treated and -untreated Dhcr7T93M/{Delta}3–5 mice (Fig. 6A), and weight gain, between 2- and 6-months of age, was similar in both groups (Fig. 6B). After 6-months of age, the cholesterol-treated animals became obese. Pathological analysis demonstrated no significant differences except for the development of a fatty liver in the cholesterol-treated group. Control animals that fed the cholesterol-supplemented diet also became obese and developed a fatty liver.


Figure 0036
View larger version (26K):
[in this window]
[in a new window]
 
Figure 6. Dietary cholesterol supplementation. Dhcr7T93M/{Delta}3–5 mice were fed either regular mouse chow with no cholesterol (open boxes) or cholesterol-supplemented mouse chow (1.25%) (closed boxes). (A) Neither survival (B) nor growth was significantly affected prior to 6 months of age. After 6 months of age, the cholesterol-supplemented mice did demonstrate increased weight gain; however, this effect was also observed in control animals that fed on the cholesterol-supplemented chow. Dietary cholesterol was effective in decreasing DHC levels in peripheral tissues such as kidney (C, *P<0.001) and pancreas (D, *P<0.001) in treated mutant animals (filled columns) versus untreated mutant animals (open columns). (E) Although not significant, in liver tissue, DHC levels were decreased in the treated animals. (F) No difference in DHC levels was observed in brain cortex tissue from untreated or cholesterol-treated animals. Data is presented as mean±SEM and n=4 for each cohort.

 
We measured DHC levels in tissues from both cholesterol-treated and -untreated animals. In kidney and pancreatic tissue, dietary cholesterol supplementation significantly reduced DHC levels (Fig. 6C and D) in Dhcr7T93M/{Delta}3–5 mice. In both liver (Fig. 6E) and serum (data not shown) although the mean DHC level was lower in the cholesterol-treated animals, this difference was not significant. Cholesterol levels were significantly increased (P<0.001) in tissue and serum in both control and mutant mice on the cholesterol-supplemented diet (data not shown). Consistent with previous work that has shown that dietary cholesterol does not cross the blood–brain barrier, cholesterol (data not shown) and DHC (Fig. 6F) levels in brain cortex were not affected by dietary cholesterol treatment.

Simvastatin therapy
Simvastatin therapy has been proposed as a treatment of SLOS (21Go,22Go). Simvastatin was chosen because it crosses the blood–brain barrier. We thus treated both Dhcr7+/+ and Dhcr7T93M/{Delta}3–5 mice for 3 weeks with daily subcutaneous injections of simvastatin at either 0 (vehicle only), 1, 10 or 20 mg/kg/day. For these experiments, we used age (2–5 month) and sex matched (female) animals. DHC levels decreased significantly in peripheral tissues such as kidney and liver (Fig. 7A and C) and in brain cortex (Fig. 7E) in Dhcr7T93M/{Delta}3–5 mice treated with 10–20 mg/kg/day of simvastatin. No consistent changes in cholesterol levels were observed (Fig. 7B, D and F).


Figure 0037
View larger version (32K):
[in this window]
[in a new window]
 
Figure 7. Simvastatin treatment. Dhcr7T93M/{Delta}3–5 mice were treated for 3 weeks with 0, 1, 10 or 20 mg/kg/day of simvastatin administered by subcutaneous injection. Tissues were isolated and sterols analyzed by GC/MS. Kidney (A and B) and liver (C and D) DHC levels (A and C) decreased significantly (*P<0.01) with increasing doses of simvastatin; however, cholesterol levels (B and D) remained essentially constant. Brain cortex DHC levels (E) decreased significantly (*P<0.01) with increasing doses of simvastatin and cholesterol levels (F) remained constant. Data is presented as the mean±SEM for three to four mice per group.

 
We previously hypothesized that simvastatin may function to increase the expression of a Dhcr7 allele with residual function (23Go). To test this hypothesis in our mouse model, we measured relative Dhcr7 expression in both liver and brain cortex from Dhcr7T93M/{Delta}3–5 mice treated for 3 weeks with simvastatin. Relative Dhcr7 expression increased significantly in liver tissue from Dhcr7T93M/{Delta}3–5 mice treated with 10 and 20 mg/kg/day of simvastatin (Fig. 8A). Although not as robust, Dhcr7 expression increased significantly in brain cortex tissue from mice treated with 20 mg/kg/day of simvastatin (Fig. 8B). The increase in Dhcr7 expression may be due to coordinated up-regulation of genes whose expressions are modulated by SREBP2 (28Go). Although, we did not observe a change in low-density lipoprotein receptor (Ldlr) expression, we observed increased expression of 3-hydroxy-3-methylglutaryl CoA synthase 1 (Hmgcs1), HMG-CoA reductase (Hmgr), squalene epoxidase (Sqle), 3ß-hydroxysterol-{Delta}8,{Delta}7-isomerase (Ebp, emopamil-binding protein) and 3ß-hydroxysterol-{Delta}24-reductase (Dhcr24) (Fig. 8C).


Figure 0038
View larger version (19K):
[in this window]
[in a new window]
 
Figure 8. Simvastatin treatment induces Dhcr7 expression. Dhcr7 expression was determined in liver (A) and brain cortex (B) of Dhcr7T93M/{Delta}3–5 treated with 0, 1, 10 or 20 mg/kg/day of simvastatin. Although the increase was less in brain cortex, Dhcr7 expression increased significantly in both liver and brain cortex from mice treated with simvastatin for 3 weeks. Data is expressed as mean±SEM values for three to four mice in each group. Expression is presented relative to the level of Dhcr7 expression in vehicle-treated tissues. (C) Expression of other genes regulated by SREBP2 also increased in liver tissue from Dhcr7T93M/{Delta}3–5 mice treated with 20 mg/kg/day of simvastatin (gray columns, n=4) relative to expression levels found in Dhcr7T93M/{Delta}3–5 mice treated with vehicle only (black columns, n=3). 3-Hydroxy-3-methylglutaryl CoA synthase 1 (Hmgcs1), 3-hydroxy-3-methyglutaryl CoA reductase (Hmgr), squalene epoxidase (Sqle), emopamil-binding protein (Ebp), 3ß-hydroxysterol-{Delta}24-reductase (Dhcr24) and low-density lipoprotein receptor (Ldlr).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
This manuscript describes the development, characterization and therapeutic treatment of a hypomorphic SLOS mouse model. Previously, we reported the development and characterization of a SLOS mouse model with a null allele (Dhcr7{Delta}3–5) (24Go). Because Dhcr7{Delta}3–5/{Delta}3–5 pups fail to feed, they die during the first day of life. Hence, that mouse model is not useful for studying postnatal development or the efficacy of therapeutic interventions. To circumvent this problem, we developed a mouse model with a Dhcr7T93M equivalent allele. DHCR7T93M is the most common human missense mutation and in general is associated with a mild to classical SLOS phenotype (10Go). As demonstrated in this manuscript, both Dhcr7T93M/T93M and Dhcr7T93M/{Delta}3–5 mice are viable, fertile and have elevated DHC levels diagnostic of SLOS.

With the exception of ventricular dilatation, Dhcr7T93M/T93M mice appear normal; in contrast, Dhcr7T93M/{Delta}3–5 mice demonstrate mild growth retardation, syndactyly of the second and third toes and postnatal ventricular enlargement. This is consistent with the biochemical finding that DHC levels are higher in tissues from Dhcr7T93M/{Delta}3–5 mice when compared with levels found in Dhcr7T93M/T93M tissues, and consistent with Dhcr7{Delta}3–5 being a null allele. Although, human patients with SLOS frequently have multiple malformations, the paucity of developmental malformation in our hypomorphic SLOS mouse models is not surprising. Malformations in Dhcr7{Delta}3–5/{Delta}3–5 pups are limited to intrauterine growth retardation and a low frequency of cleft palate (24Go,25Go). In contrast, human patients with a null/null genotype have multiple major malformations. The milder murine phenotype is likely due to maternal cholesterol supplies in the yolk sac (29Go). Cutaneous second and third toe syndactyly is the most frequently reported malformation in SLOS patients (3Go). This malformation is also observed in lathosterolosis. Lathosterolosis is an inborn error of cholesterol synthesis caused by mutation of the lathosterol 5-desaturase gene (30Go–32Go). In lathosterolosis, cholesterol levels are low and there is an accumulation of lathosterol instead of 7-DHC. The finding of second and third toe syndactyly in Dhcr7T93M/{Delta}3–5 mice, its presence in very mildly affected SLOS patients, and its presence in lathosterolosis patients suggest that this malformation is extremely sensitive to the perturbation of fetal cholesterol levels. Interestingly, second and third toe syndactyly has not been reported in desmosterolosis patients (33Go), nor has it been observed in Dhcr24 mutant mice (34Go) [unpublished data (CAW and FDP)]. Thus, with respect to the pathophysiology underlying this particular malformation, desmosterol may functionally substitute for cholesterol.

When studied by MRI, approximately 50% of Dhcr7T93M/{Delta}3–5 mice develop ventricular enlargement by 4-months of age. Cholesterol levels in the CNS of the Dhcr7T93M/{Delta}3–5 mice normalize after birth; however, elevated DHC levels persist. This suggests that the ventricular dilatation results from persistent elevation of DHC levels. This could be due to a direct effect of the abnormal sterol or could be a toxic effect of aberrant steroids, neuroactivesteroids or oxysterols synthesized from DHC (35Go–39Go).

Sterol analysis of tissues from one-day-old pups showed marked elevations of DHC levels consistent with the genotypic series Dhcr7+/+<<Dhcr7T93M/T93M<Dhcr7T93M/{Delta}3–5{approx}Dhcr7{Delta}3–5/{Delta}3–5. Cholesterol levels, but not total sterol levels, were decreased in tissues from 1-day-old Dhcr7T93M/{Delta}3–5 pups. This reduction in cholesterol levels was similar to that seen in Dhcr7{Delta}3–5/{Delta}3–5 tissues. Biochemically, Dhcr7T93M/{Delta}3–5 and Dhcr7{Delta}3–5/{Delta}3–5 mice are similar. Thus, it is not immediately clear why Dhcr7{Delta}3–5/{Delta}3–5 fail to feed and die. It is possible that the sterol abnormality in the brain is not homogeneous and that specific populations of cells may be more severely affected, or that the correction of the sterol defect observed in these mice may occur at different rates in different populations of cells. This might not be appreciated when measuring sterol content of the cortex or midbrain.

We did not anticipate the apparent biochemical correction of the sterol defect in Dhcr7T93M/{Delta}3–5 tissues as the mice aged. Cholesterol levels normalized and, although they remained abnormally elevated, DHC levels decreased. This phenomenon has not been reported in human patients. Biochemical correction occurred rapidly in peripheral tissues and at a slower rate in CNS tissues. Prior to weaning, the pups could obtain cholesterol from their mother's milk; however, after weaning, these mice were maintained on a cholesterol-free diet. Sequencing of alternative transcripts confirmed that no functional protein without the T93M mutation could be synthesized. To establish that the Dhcr7T93M mutation has functional consequences in mice, we measured residual cholesterol synthesis in mouse embryonic fibroblasts and we measured Dhcr7 activity in liver homogenates. Residual cholesterol synthesis in mouse Dhcr7T93M/{Delta}3–5 fibroblasts was similar to that previously found in human skin fibroblasts with the equivalent genotype. Dhcr7T93M enzymatic activity was approximately one-third of normal in liver S10 homogenates. Thus, this difference does not appear to be due to a significant difference between the murine and human DHCR7T93M proteins.

We have previously demonstrated that elevated expression of a Dhcr7 allele with residual enzymatic function increases residual cholesterol synthesis in fibroblasts (23Go). In liver tissue, Dhcr7 expression increased as the animals aged and in brain tissue Dhcr7 expression decreased. This would be consistent with both the time course and magnitude of the correction observed in these two tissues. The slower time course and decreased magnitude of the correction in CNS DHC levels is consistent with the decreased but persistent expression of Dhcr7 in cortex. This still does not explain why this occurs in the hypomorphic mouse models, but not in mildly affected human patients. A similar biochemical correction in patients with residual cholesterol synthesis may not occur, because of differences in cholesterol homeostasis between rodents and humans. Mice have relatively high plasma cholesterol levels that make them resistant to the teratogenic effects of BM 15.766 (40Go). BM 15.766 is a non-competitive inhibitor of DHCR7 (41Go). Mice and rats also are known to be resistant to the hypocholesterolemic effects of HMG-CoA reductase inhibitors (42Go). Endogenous cholesterol synthesis in the mouse is approximately 50 mg/kg/day versus 10 mg/kg/day for humans (43Go). We hypothesize that if Dhcr7 transcripts were elevated in mouse tissue when compared with human tissue, increased expression of a protein with residual function could correct the biochemical defect once cholesterol synthesis rates decreased after growth slowed. Comparative quantification of DHCR7 transcripts in human brain cortex tissue and Dhcr7 transcripts in mouse brain cortex showed an approximately 100-fold elevation in mouse cortex. Unfortunately, antibodies monospecific for DHCR7 or Dhcr7 are not available; hence, we could not perform correlative western blot analysis to assess protein levels. Thus, the higher level of cholesterol synthesis and turnover in the mouse, reflected by persistent and increased Dhcr7 expression in older animals, likely explains the partial biochemical correction that we observed in tissues from Dhcr7T93M/{Delta}3–5.

Although DHC levels decrease as these animals age, they remain significantly elevated over normal. Thus, as long as age is controlled for, this mouse model can be used to evaluate the ability of different therapeutic interventions to reduce DHC levels. Standard therapy for SLOS patients consists of dietary cholesterol supplementation. Cholesterol supplementation can be used to treat problems related to the biochemical disturbance; however, clinical improvements using this therapy are limited by fixed developmental problems and the potential efficacy of dietary cholesterol supplementation is limited by the blood–brain barrier. Although dietary cholesterol does not cross the blood–brain barrier, anecdotal reports suggest improved behavior after initiation of dietary cholesterol therapy [reviewed in (1Go)]. In addition, Tierney et al. (44Go) showed a lower frequency of autistic symptoms in SLOS patients treated with dietary cholesterol supplementation prior to 5 years of age when compared with a group of SLOS patients started on dietary cholesterol supplementation after 5-years of age. A recent study (19Go) concluded that the developmental progress of children with SLOS treated with a high-cholesterol diet is not significantly improved; however, this study did not evaluate behavioral aspects of SLOS. The mechanism of how dietary cholesterol could affect the SLOS behavioral phenotype is not known. One hypothesis has been that an unknown mechanism could allow for dietary cholesterol to cross the blood–brain barrier in a cholesterol deficient state such as SLOS. However, in the present study, sterol analysis by GC/MS of tissues from Dhcr7T93M/{Delta}3–5 mice treated with dietary cholesterol supplementation showed decreased DHC levels in peripheral tissues, but not in brain cortex. Similar results have been obtained using dietary cholesterol supplementation in an AY9944-induced rat model of SLOS (S.J. Fliesler, unpublished data). These findings tend to argue against the hypothesis of an aberrant blood–brain barrier, with respect to cholesterol uptake, in SLOS. A second hypothesis is that the behavioral effect is mediated through an effect on steroids or neuroactive steroids. Both steroids (36Go) and neuroactive steroids (38Go) synthesized from 7-DHC have been identified in SLOS patients. The Dhcr7T93M/{Delta}3–5 mouse model may allow for this hypothesis to be tested. Yet, a third hypothesis is that exogenously supplied cholesterol may affect the CNS in SLOS patients via an indirect mechanism, rather than as a direct effect of sterol uptake by neurons or glia. For example, cholesterol may modulate vascular function (which in turn affects CNS function) by altering lipid raft composition in vascular endothelial cells, thereby affecting the activity of nitric oxide synthase and, hence, vasoactive nitric oxide levels (45Go). Again, this hypothesis is subject to testing using the SLOS mouse model described herein.

The major issue with regards to treatment of SLOS patients is whether biochemical correction of the sterol abnormality in the CNS will positively affect the behavioral or learning defects found in this disorder. If the learning and behavioral problems are, at least in part, because of the abnormal sterol composition of the CNS rather than fixed developmental defects, then treatment of the CNS would likely have beneficial effects. Failure of dietary cholesterol therapy to affect CNS sterol composition is a major limitation of this therapeutic approach. Simvastatin does cross the blood–brain barrier, thus it may provide a therapeutic approach to directly affect brain sterol composition.

Thus, we investigated whether simvastatin therapy could improve CNS sterol profiles in Dhcr7T93M/{Delta}3–5 mice. We previously demonstrated, in vitro, that simvastatin treatment increases DHCR7 expression and increases fractional cholesterol synthesis in SLOS fibroblasts (23Go). In the present study, we further tested this hypothesis, in vivo, in our Dhcr7T93M/{Delta}3–5 mouse model. Dhcr7T93M/{Delta}3–5 mice treated with simvastatin for 3 weeks showed significant decreases in DHC levels in both peripheral and CNS tissues. Consistent with the above hypothesis, we were able to demonstrate increased expression of Dhcr7 in response to simvastatin therapy. Increased Dhcr7 expression is likely due to a coordinated upregulation of SREBP2-regulated cholesterol biosynthetic genes in response to simvastatin treatment. This was confirmed by demonstrating concordant increased expression of Hmgcs1, Hmgr, Sqle, Ebp and Dhcr24. Ldlr expression was not altered. This is consistent with previous observations. Ldlr expression has been shown to increase in rats after treatment with lovastatin, pravastatin, fluvastatin and rivastatin; however, Ldlr expression did not increase in animals treated with simvastatin (46Go). Based on our previous in vitro work and the current work using the Dhcr7T93M/{Delta}3–5 mouse model described in this article, it appears that simvastatin increases expression of DHCR7 and can improve the sterol profile in both peripheral and CNS tissues.

Although it is a confounding variable that needs to be controlled for, the observation that the sterol defect in Dhcr7T93M/{Delta}3–5 mice partially corrects over time is an interesting finding. Our data suggests that this biochemical correction is related to persistent expression of a mutant allele with residual function. This further supports the idea that therapeutic interventions designed to increase expression of DHCR7 may be efficacious in the treatment of mild to classical SLOS patients, who have significant residual enzymatic activity.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Vector construction, targeting of embryonic stem cells, generation of chimeric mice and mouse husbandry
Dhcr7T93M/+ mice were generated using homologous recombination in ES cells to introduce a two-nucleotide change into the fourth exon of Dhcr7 to produce a T89M allele (homologous to the human T93M allele). A genomic bacterial artificial chromosome (BAC) was isolated by PCR screening of a mouse 129 BAC library as previously described (24Go). A 1 kb XhoI–XbaI fragment containing exon 4 was isolated and cloned into pBlueScript (Stratagene, La Jolla, CA, USA) to yield pCon-1. The T89M mutation was introduced into Dhcr7 by changing the endogenous ACA codon to ATG using site-directed mutagenesis (Stratagene), and an FspI restriction site was introduced by changing a C to a G 12 bases 3' of the T89M mutation. Primers used for the site-directed mutagenesis were T93M-F: 5' CCTGTGATGGCTAAAGCTGCGCAACTGTATGCC 3' and T93M-R: 5' GGCATACAGTTGCGCAGCTTTAGCCATCACAGG3'. The presence of the c.266–267 CA>TG mutation and the c.279C>G polymorphism were confirmed by DNA sequencing. DNA sequencing was performed on a Beckman Coulter CEQ2000 per manufacturer's protocol.

For targeting vector construction, a 4 kb BamHI–XhoI fragment containing exon 3 was cloned into pCon-1 to obtain pCon-2 to produce the 5'-flank of the targeting vector. The 3'-flank consisted of a 7 kb XbaI–EcoRI genomic fragment as illustrated in Figure 1A. For positive selection, a PGK-neo cassette flanked by loxP sites was introduced into intron 4. A third loxP site was introduced into an XbaI site in intron 7. The loxP sites were introduced in order to obtain a conditional Dhcr7 allele (data not shown). For negative selection, a cassette expressing diphtheria toxin A (DTA) was cloned into a vector SalI site just outside the 5'-flank. All coding regions and loxP sites were sequenced to confirm that no additional mutations were introduced. The targeting vector was linearized using a vector NotI site just outside the 3' flank.

The targeting vector was electroporated into J1 embryonic stem cells, selection for G418-resistant clones and culture conditions were as previously described (24Go). Screening of G418-resistant clones was done by PCR using primers internal to the neomycin resistance gene and external to the targeting construct flank (primer pairs A/B and C/D).

The mutant allele could also be identified by restriction length polymorphism analysis. The mutated region was amplified by PCR using primers pconM2 5' CCAGCATCATTTTCCTGCTGC 3' and pconB 5' GCTTCCTGCTCTGTGTATCTGC 3'. PCR cycling conditions consisted of 5 min at 94°C followed by 30 cycles of 30 s at 94°C, 30 s at 62°C, 30 s at 72°C and a final extension period of 5 min at 72°C. The PCR product was then digested for 1 h at 37°C with FspI (New England Biolabs, Beverly, USA) and fragment sizes were analyzed on 2% agarose gels.

Targeted ES cells were injected into C57/B6 blastocysts to produce chimeric founders. Agouti F1 progeny were genotyped as described above for transmission of the mutant allele. Dhcr7T93M/+ were intercrossed and bred with Dhcr7{Delta}3–5/+ mice to obtain Dhcr7T93M/T93M and Dhcr7T93M/{Delta}3–5 mice, respectively. Genotyping of the Dhcr7{Delta}3–5 allele was preformed using PCR with NeoY 5' GCACGAGACTAGTGAGACGTGC 3' and DHCRS6 5' GGTCACATGGCCATAAAGCTCC 3' and cycling conditions of 5 min at 94°C followed by 30 cycles (30 s at 94°C, 30 s at 66°C, 30 s at 72°C) and then 10 min at 72°C. All PCR reactions were performed on a PTC-200 Peltier Thermal Cycler (M.J. Research, Watertown, USA).

For timed matings, the identification of a copulatory plug was considered to be E0.5 and embryonic age was confirmed by inspection. Animal work was performed under an NICHD approved animal study protocol.

Biochemical analysis
Sterol analysis was performed using GC/MS as previously described (30Go). Residual cholesterol synthesis in mouse embryonic fibroblasts was measured as previously described (23Go). Unless otherwise stated, all cofactors, reagents and enzymes were from Sigma (St Louis, MO, USA).

Dhcr7 enzymatic activity was measured in the 10 000g supernatant fraction (S10 homogenates) from liver using a linked enzyme assay. S10 homogenates were prepared using the protocol by Bucher and McGarahan (47Go) with some modifications. Prior to euthanasia, mice were fasted overnight. After euthanasia, livers were rapidly harvested, weighed, mechanically minced with a razor blade and then homogenized for 10 s in 2.5 ml of ice-chilled buffer (0.1 M potassium phosphate, pH 7.4, 30 mM nicotinamide, 5 mM MgCl2, 40 µg/ml penicillin-G, and 40 µg/ml streptomycin sulfate) per gram of tissue using a Tissumizer® (model SDT-1810, Tekmar Co., Cincinnati, OH), with a small-diameter shaft (10 mm, o.d.) at half-maximal speed. The mouse liver homogenate was then centrifuged for 30 min at 10 000g at 4°C. The supernatant fraction (S10 homogenate) was collected with a pipette, snap-frozen in liquid nitrogen and stored at –80°C prior to use. For measurement of Dhcr7 activity, 750 µl of the S10 homogenate was incubated for 6 h at 37°C in a buffer containing 1 mM NAD, 1 mM NADP, 3 mM glucose-6-phosphate, 5 mM magnesium-ATP and 0.33 nM [1,2,5{alpha},6{alpha}-2H] 5{alpha}-Cholest-7-en-3ß-ol (deuterium-labeled lathosterol, CDN isotopes, Quebec, Canada) dissolved in DMSO. Reactions were terminated by dilution with 1 ml of ice-chilled 1% (w/v) bovine serum albumin in phosphate-buffered saline (pH 7.4), followed by freezing in liquid nitrogen. Each reaction mixture was then centrifuged for 10 min at 100 000g (Beckman Optima-TL tabletop ultracentrifuge), and the resulting membrane pellet was analyzed for deuterium-labeled cholesterol by GC/MS.

Histological analysis
Tissues were fixed using buffered formalin (Sigma), paraffin-embedded, sectioned and stained with hematoxylin and eosin using standard procedures. Tissue sections were viewed and photographed using a Zeiss Axioscope with a Zeiss Axiocam.

Cell culture
3T3-like mouse embryonic fibroblasts were derived as previously described (48Go). Fibroblasts were grown (37°C, 5% CO2) in Dulbecco's modified Eagle's Medium (DMEM, Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS, Gemini, Calabasas, CA). Cholesterol-deficient culture was performed in McCoy's 5A medium (Invitrogen) supplemented with 7.5% lipoprotein-deficient serum (LPDS). LPDS was prepared using organic extraction as previously described (49Go).

MRI analysis
Mice were anaesthetized with 1.5% isofluorane and placed prone in a stereotaxic holder with brain centered in a 72/25 mm volume transmit/surface receive coil ensemble. Body core temperature was maintained at 37°C with warm air. A pressure transducer was used to monitor respiration. MRI was performed on a 21 cm horizontal bore 7 T scanner operating on a Bruker Avance platform (Bruker Biospin Inc., Billerica, MA, USA). Three mutually perpendicular slice images through the brain were acquired as scout images. Series of 1 mm thick 2-D axial slices were acquired using a fast spin echo (eight echos) sequence to visualize the entire brain. Parameters: repetition time (TR), 3000 ms; echo time (TE), 10 ms; eight averages; 17 slices; in-plane resolution, 78 µm; scan time, ~13 min). Three-dimensional fast spin echo (eight echos) images were acquired encompassing the whole brain (TR/TE=2000/9 ms; two averages; isotropic resolution=156 µm; scan time, ~53 min).

A series of diffusion-weighted images (TR/TE=2000/32.5 ms; {Delta}=20 ms; 3B values between 0 and 1500 s/mm2; two averages; scan time, ~8 min) were acquired and processed to obtain diffusion maps. Diffusion maps were acquired with diffusion gradient along the three principle axes.

Ventricular volumes were calculated from the two-dimensional and three-dimensional images using Paravision Image display software (Bruker Biospin Inc.). All images were transformed into two-dimensional format and the area of the brain or ventricles were evaluated. The slice (two-dimensional) or isotropic slab thickness (three-dimensional) was used to calculate the corresponding volumes. ADC were calculated using codes written in MATLAB (Mathworks Inc., Natick, MA, USA). Using the three orthogonal ADC values, a mean ADC value was calculated for regions of interest (ROI) (cortex, corpus callosum, thalamus and optic nerve). ROI were identified with the aid of atlas (50Go). Data for two imaging levels corresponding to a defined anatomical structure were obtained and for four mice of the same age.

Dietary cholesterol supplementation
Eight-week-old mice were fed either regular mouse chow (no cholesterol) or a 1.25% cholesterol-supplemented chow (Diet D12336 [GenBank] , Research Diets Inc., New Brunswick, NJ, USA) for 5 months. Each cohort contained 12 mice and the mice had free access to both food and water.

Simvastatin treatment
Dhcr7T93M/{Delta}3–5 and Dhcr7+/+ female mice were treated with daily subcutaneous injections of either vehicle (2% DMSO and 0.1% BSA in 1x PBS) or simvastatin (R.J. Chemicals Inc., Pompano Beach, FL, USA) dissolve in the vehicle to give a dose of 1, 10 or 20 mg/kg/day for 21 days. Each cohort consisted of three (vehicle) or four mice (simvastatin treatment). Tissues were isolated after a 12-h fast. Female animals were used because of space limitations.

Relative quantitative PCR
RNA was extracted from brain cortex and liver of Dhcr7T93M/+ and Dhcr7T93M/{Delta}3–5 mice using an RNeasy Mini Kit (Qiagen, Santa Clarita, CA, USA). RNA (100 ng) was reverse-transcribed using a high-capacity cDNA archive kit (Applied Biosystems, Foster City, CA, USA) as per the manufacturer's protocol. Quantitative PCR assays were performed using the Dhcr7, Hmgcs1, Sqle, Ebp, Dhcr24, Hmgr and Ldlr assays on demand from Applied Biosystems. Analysis was performed on an ABI Prism 7000. All assays were validated, performed in triplicate and normalized to Gapdh.

Absolute quantitative PCR
RNA was extracted from normal human brain cortex using the RNeasy Mini Kit. Cortex samples of various ages were obtained from the brain and tissue bank for developmental disorders of NICHD maintained by the University of Maryland. Work with human tissues was approved by the NICHD IRB. Standard curves were generated for both DHCR7 and Dhcr7 by serial dilution. All reactions were performed in triplicate. Absolute quantitative PCR was performed, per manufacturers protocol, on an ABI Prism 7000 using 100 ng of cDNA template in a 40 µl reaction.

Statistical analysis
Data are reported as mean±SEM. Survival analysis is reported as mean±SD. Either paired or unpaired Student's two-tailed t-tests were used to compare two datasets. For the comparison of three or more datasets, a one-way ANOVA with Newman–Keuls post-hoc test was used. Unless otherwise specified P<0.05 was considered significant.


    SUPPLEMENTARY MATERIAL
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Supplementary Material is available at HMG Online.


    ACKNOWLEDGEMENTS
 
We would like to thank Drs Heiner Westphal and Richard I. Kelley for their assistance, and both Sing-Ping Huang and Michael J. Richard for their technical assistance. L.C.C. is a recipient of a Fogarty Visiting Fellowship. This research was supported by the intramural research program of the National Institute of Child Health and Human Development, National Institutes of Health, DHHS (FDP), by USPHS Grant EY07361, and by an unrestricted departmental grant from Research to Prevent Blindness (S.J.F.).

Conflicts of Interest statement. None.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 

  1. Porter, F.D. (2003) Human malformation syndromes due to inborn errors of cholesterol synthesis. Curr. Opin. Pediatr., 15, 607–613.[CrossRef][Web of Science][Medline]

  2. Smith, D.W., Lemli, L. and Opitz, J.M. (1964) A newly recognized syndrome of multiple congenital anomalies. J. Pediatr., 64, 210–217.[CrossRef][Web of Science][Medline]

  3. Kelley, R.I. and Hennekam, R.C. (2000) The Smith–Lemli–Opitz syndrome. J. Med. Genet., 37, 321–335.[Abstract/Free Full Text]

  4. Porter, F.D. (2002) Malformation syndromes due to inborn errors of cholesterol synthesis. J. Clin. Invest., 110, 715–724.[CrossRef][Web of Science][Medline]

  5. Irons, M., Elias, E.R., Salen, G., Tint, G.S. and Batta, A.K. (1993) Defective cholesterol biosynthesis in Smith–Lemli–Opitz syndrome. Lancet, 341, 1414.[Web of Science][Medline]

  6. Tint, G.S., Irons, M., Elias, E.R., Batta, A.K., Frieden, R., Chen, T.S. and Salen, G. (1994) Defective cholesterol biosynthesis associated with the Smith–Lemli–Opitz syndrome. N. Engl. J. Med., 330, 107–113.[Abstract/Free Full Text]

  7. Wassif, C.A., Maslen, C., Kachilele-Linjewile, S., Lin, D., Linck, L.M., Connor, W.E., Steiner, R.D. and Porter, F.D. (1998) Mutations in the human sterol delta7-reductase gene at 11q12-13 cause Smith–Lemli–Opitz syndrome. Am. J. Hum. Genet., 63, 55–62.[CrossRef][Web of Science][Medline]

  8. Fitzky, B.U., Witsch-Baumgartner, M., Erdel, M., Lee, J.N., Paik, Y.K., Glossmann, H., Utermann, G. and Moebius, F.F. (1998) Mutations in the Delta7-sterol reductase gene in patients with the Smith–Lemli–Opitz syndrome. Proc. Natl. Acad. Sci. USA, 95, 8181–8186.[Abstract/Free Full Text]

  9. Waterham, H.R., Wijburg, F.A., Hennekam, R.C., Vreken, P., Poll-The, B.T., Dorland, L., Duran, M., Jira, P.E., Smeitink, J.A., Wevers, R.A. et al. (1998) Smith–Lemli–Opitz syndrome is caused by mutations in the 7-dehydrocholesterol reductase gene. Am. J. Hum. Genet., 63, 329–338.[CrossRef][Web of Science][Medline]

  10. Correa-Cerro, L.S. and Porter, F.D. (2005) 3beta-hydroxysterol Delta7-reductase and the Smith–Lemli–Opitz syndrome. Mol. Genet. Metab., 84, 112–126.[CrossRef][Web of Science][Medline]

  11. Elias, E.R., Irons, M.B., Hurley, A.D., Tint, G.S. and Salen, G. (1997) Clinical effects of cholesterol supplementation in six patients with the Smith–Lemli–Opitz syndrome (SLOS). Am. J. Med. Genet., 68, 305–310.[CrossRef][Web of Science][Medline]

  12. Irons, M., Elias, E.R., Abuelo, D., Bull, M.J., Greene, C.L., Johnson, V.P., Keppen, L., Schanen, C., Tint, G.S. and Salen, G. (1997) Treatment of Smith–Lemli–Opitz syndrome: results of a multicenter trial. Am. J. Med. Genet., 68, 311–314.[CrossRef][Web of Science][Medline]

  13. Nwokoro, N.A. and Mulvihill, J.J. (1997) Cholesterol and bile acid replacement therapy in children and adults with Smith–Lemli–Opitz (SLO/RSH) syndrome. Am. J. Med. Genet., 68, 315–321.[CrossRef][Web of Science][Medline]

  14. Linck, L.M., Lin, D.S., Flavell, D., Connor, W.E. and Steiner, R.D. (2000) Cholesterol supplementation with egg yolk increases plasma cholesterol and decreases plasma 7-dehydrocholesterol in Smith–Lemli–Opitz syndrome. Am. J. Med. Genet., 93, 360–365.[CrossRef][Web of Science][Medline]

  15. Starck, L., Lovgren-Sandblom, A. and Bjorkhem, I. (2002) Cholesterol treatment forever? The first Scandinavian trial of cholesterol supplementation in the cholesterol-synthesis defect Smith–Lemli–Opitz syndrome. J. Intern. Med., 252, 314–321.[CrossRef][Web of Science][Medline]

  16. Merkens, L.S., Connor, W.E., Linck, L.M., Lin, D.S., Flavell, D.P. and Steiner, R.D. (2004) Effects of dietary cholesterol on plasma lipoproteins in Smith–Lemli–Opitz syndrome. Pediatr. Res., 56, 726–732.[CrossRef][Web of Science][Medline]

  17. Jurevics, H.A., Kidwai, F.Z. and Morell, P. (1997) Sources of cholesterol during development of the rat fetus and fetal organs. J. Lipid Res., 38, 723–733.[Abstract]

  18. Pardridge, W.M. and Mietus, L.J. (1980) Palmitate and cholesterol transport through the blood–brain barrier. J. Neurochem., 34, 463–466.[Web of Science][Medline]

  19. Sikora, D.M., Ruggiero, M., Petit-Kekel, K., Merkens, L.S., Connor, W.E. and Steiner, R.D. (2004) Cholesterol supplementation does not improve developmental progress in Smith–Lemli–Opitz syndrome. J. Pediatr., 144, 783–791.[Web of Science][Medline]

  20. Jira, P.E., Wevers, R.A., de Jong, J., Rubio-Gozalbo, E., Janssen-Zijlstra, F.S., van Heyst, A.F., Sengers, R.C. and Smeitink, J.A. (2000) Simvastatin. A new therapeutic approach for Smith–Lemli–Opitz syndrome. J. Lipid Res., 41, 1339–1346.[Abstract/Free Full Text]

  21. Starck, L., Lovgren-Sandblom, A. and Bjorkhem, I. (2002) Simvastatin treatment in the SLO syndrome: a safe approach? Am. J. Med. Genet., 113, 183–189.[CrossRef][Web of Science][Medline]

  22. Saheki, A., Terasaki, T., Tamai, I. and Tsuji, A. (1994) In vivo and in vitro blood–brain barrier transport of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors. Pharm. Res., 11, 305–311.[CrossRef][Web of Science][Medline]

  23. Wassif, C.A., Krakowiak, P.A., Wright, B.S., Gewandter, J.S., Sterner, A.L., Javitt, N., Yergey, A.L. and Porter, F.D. (2005) Residual cholesterol synthesis and simvastatin induction of cholesterol synthesis in Smith–Lemli–Opitz syndrome fibroblasts. Mol. Genet. Metab., 85, 96–107.[CrossRef][Web of Science][Medline]

  24. Wassif, C.A., Zhu, P., Kratz, L., Krakowiak, P.A., Battaile, K.P., Weight, F.F., Grinberg, A., Steiner, R.D., Nwokoro, N.A., Kelley, R.I. et al. (2001) Biochemical, phenotypic and neurophysiological characterization of a genetic mouse model of RSH/Smith–Lemli–Opitz syndrome. Hum. Mol. Genet., 10, 555–564.[Abstract/Free Full Text]

  25. Fitzky, B.U., Moebius, F.F., Asaoka, H., Waage-Baudet, H., Xu, L., Xu, G., Maeda, N., Kluckman, K., Hiller, S., Yu, H. et al. (2001) 7-Dehydrocholesterol-dependent proteolysis of HMG-CoA reductase suppresses sterol biosynthesis in a mouse model of Smith–Lemli–Opitz/RSH syndrome. J. Clin. Invest., 108, 905–915.[CrossRef][Web of Science][Medline]

  26. Caldas, H., Cunningham, D., Wang, X., Jiang, F., Humphries, L., Kelley, R.I. and Herman, G.E. (2005) Placental defects are associated with male lethality in bare patches and striated embryos deficient in the NAD(P)H steroid dehydrogenase-like (NSDHL) enzyme. Mol. Genet. Metab., 84, 48–60.[CrossRef][Web of Science][Medline]

  27. Lee, J.N., Bae, S.H. and Paik, Y.K. (2002) Structure and alternative splicing of the rat 7-dehydrocholesterol reductase gene. Biochim. Biophys. Acta, 1576, 148–156.[Medline]

  28. Horton, J.D., Goldstein, J.L. and Brown, M.S. (2002) SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J. Clin. Invest., 109, 1125–1131.[CrossRef][Web of Science][Medline]

  29. Woollett, L.A. (2001) The origins and roles of cholesterol and fatty acids in the fetus. Curr. Opin. Lipidol., 12, 305–312.[CrossRef][Web of Science][Medline]

  30. Krakowiak, P.A., Wassif, C.A., Kratz, L., Cozma, D., Kovarova, M., Harris, G., Grinberg, A., Yang, Y., Hunter, A.G., Tsokos, M. et al. (2003) Lathosterolosis: an inborn error of human and murine cholesterol synthesis due to lathosterol 5-desaturase deficiency. Hum. Mol. Genet., 12, 1631–1641.[Abstract/Free Full Text]

  31. Brunetti-Pierri, N., Corso, G., Rossi, M., Ferrari, P., Balli, F., Rivasi, F., Annunziata, I., Ballabio, A., Russo, A.D., Andria, G. et al. (2002) Lathosterolosis, a novel multiple-malformation/mental retardation syndrome due to deficiency of 3beta-hydroxysteroid-delta5-desaturase. Am. J. Hum. Genet., 71, 952–958.[CrossRef][Web of Science][Medline]

  32. Rossi, M., Vajro, P., Iorio, R., Battagliese, A., Brunetti-Pierri, N., Corso, G., Di Rocco, M., Ferrari, P., Rivasi, F., Vecchione, R. et al. (2005) Characterization of liver involvement in defects of cholesterol biosynthesis: long-term follow-up and review. Am. J. Med. Genet. A, 132, 144–151.[Medline]

  33. FitzPatrick, D.R., Keeling, J.W., Evans, M.J., Kan, A.E., Bell, J.E., Porteous, M.E., Mills, K., Winter, R.M. and Clayton, P.T. (1998) Clinical phenotype of desmosterolosis. Am. J. Med. Genet., 75, 145–152.[CrossRef][Web of Science][Medline]

  34. Wechsler, A., Brafman, A., Shafir, M., Heverin, M., Gottlieb, H., Damari, G., Gozlan-Kelner, S., Spivak, I., Moshkin, O., Fridman, E. et al. (2003) Generation of viable cholesterol-free mice. Science, 302, 2087.[Free Full Text]

  35. Shackleton, C.H., Roitman, E. and Kelley, R. (1999) Neonatal urinary steroids in Smith–Lemli–Opitz syndrome associated with 7-dehydrocholesterol reductase deficiency. Steroids, 64, 481–490.[CrossRef][Web of Science][Medline]

  36. Shackleton, C., Roitman, E., Guo, L.W., Wilson, W.K. and Porter, F.D. (2002) Identification of 7(8) and 8(9) unsaturated adrenal steroid metabolites produced by patients with 7-dehydrosterol-delta7-reductase deficiency (Smith–Lemli–Opitz syndrome). J. Steroid Biochem. Mol. Biol., 82, 225–232.[CrossRef][Web of Science][Medline]

  37. Wassif, C.A., Yu, J., Cui, J., Porter, F.D. and Javitt, N.B. (2003) 27-Hydroxylation of 7- and 8-dehydrocholesterol in Smith–Lemli–Opitz syndrome: a novel metabolic pathway. Steroids, 68, 497–502.[CrossRef][Web of Science][Medline]

  38. Marcos, J., Guo, L.W., Wilson, W.K., Porter, F.D. and Shackleton, C. (2004) The implications of 7-dehydrosterol-7-reductase deficiency (Smith–Lemli–Opitz syndrome) to neurosteroid production. Steroids, 69, 51–60.[CrossRef][Web of Science][Medline]

  39. Javitt, N.B. (2004) Oxysteroids: a new class of steroids with autocrine and paracrine functions. Trends Endocrinol. Metab., 15, 393–397.[CrossRef][Web of Science][Medline]

  40. Lanoue, L., Dehart, D.B., Hinsdale, M.E., Maeda, N., Tint, G.S. and Sulik, K.K. (1997) Limb, genital, CNS, and facial malformations result from gene/environment-induced cholesterol deficiency: further evidence for a link to sonic hedgehog. Am. J. Med. Genet., 73, 24–31.[CrossRef][Web of Science][Medline]

  41. Shefer, S., Salen, G., Honda, A., Batta, A.K., Nguyen, L.B., Tint, G.S., Ioannou, Y.A. and Desnick, R. (1998) Regulation of rat hepatic 3beta-hydroxysterol delta7-reductase: substrate specificity, competitive and non-competitive inhibition, and phosphorylation/dephosphorylation. J. Lipid Res., 39, 2471–2476.[Abstract/Free Full Text]

  42. Ness, G.C. and Gertz, K.R. (2004) Hepatic HMG-CoA reductase expression and resistance to dietary cholesterol. Exp. Biol. Med. (Maywood), 229, 412–416.[Abstract/Free Full Text]

  43. Dietschy, J.M., Turley, S.D. and Spady, D.K. (1993) Role of liver in the maintenance of cholesterol and low-density lipoprotein homeostasis in different animal species, including humans. J. Lipid Res., 34, 1637–1659.[Web of Science][Medline]

  44. Tierney, E., Nwokoro, N.A., Porter, F.D., Freund, L.S., Ghuman, J.K. and Kelley, R.I. (2001) Behavior phenotype in the RSH/Smith–Lemli–Opitz syndrome. Am. J. Med. Genet., 98, 191–200.[CrossRef][Web of Science][Medline]

  45. Wyatt, A.W., Steinert, J.R. and Mann, G.E. (2004) Modulation of the L-arginine/nitric oxide signalling pathway in vascular endothelial cells. Biochem. Soc. Symp., 71, 143–156.[Medline]

  46. Ness, G.C., Zhao, Z. and Lopez, D. (1996) Inhibitors of cholesterol biosynthesis increase hepatic low-density lipoprotein receptor protein degradation. Arch. Biochem. Biophys., 325, 242–248.[CrossRef][Web of Science][Medline]

  47. Bucher, N.L. and McGarrahan, K. (1956) The biosynthesis of cholesterol from acetate-1-C14 by cellular fractions of rat liver. J. Biol. Chem., 222, 1–15.[Free Full Text]

  48. Aaronson, S.A. and Todaro, G.J. (1968) Development of 3T3-like lines from Balb-c mouse embryo cultures: transformation susceptibility to SV40. J. Cell Physiol., 72, 141–148.[CrossRef][Web of Science][Medline]

  49. Cham, B.E. and Knowles, B.R. (1976) A solvent system for delipidation of plasma or serum without protein precipitation. J. Lipid Res., 17, 176–181.[Abstract]

  50. Paxinos, G. and Keith, B.J.F. (1997) The Mouse Brain in Stereotaxic Coordinates. 2nd edition. Academic Press, USA.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Material
Right arrow All Versions of this Article:
15/6/839    most recent
ddl003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Correa-Cerro, L. S.
Right arrow Articles by Porter, F. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Correa-Cerro, L. S.
Right arrow Articles by Porter, F. D.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?