Skip Navigation


Human Molecular Genetics Advance Access originally published online on March 14, 2006
Human Molecular Genetics 2006 15(8):1329-1341; doi:10.1093/hmg/ddl053
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
15/8/1329    most recent
ddl053v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Desai, J.
Right arrow Articles by Culiat, C. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Desai, J.
Right arrow Articles by Culiat, C. T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Nell1-deficient mice have reduced expression of extracellular matrix proteins causing cranial and vertebral defects

Jayashree Desai1, Mark E. Shannon2, Mahlon D. Johnson3, David W. Ruff2, Lori A. Hughes4, Marilyn K. Kerley4, Donald A. Carpenter4, Dabney K. Johnson4, Eugene M. Rinchik4,5,{dagger} and Cymbeline T. Culiat4,*

1Graduate School for Genome Science and Technology, University of Tennessee-Oak Ridge National Laboratory, 1060 Commerce Park, Oak Ridge, TN 37831, USA, 2Applied Biosystems, 850 Lincoln Centre Drive, Foster City, CA 94404, USA, 3The University of Tennessee Graduate School of Medicine, 1924 Alcoa Highway, Knoxville, TN 37920-6999, USA, 4Life Sciences Division, Oak Ridge National Laboratory, PO Box 2008, Bethel Valley Road, Oak Ridge, TN 37831-6445, USA and 5Department of Biochemistry, Cellular and Molecular Biology, The University of Tennessee, Knoxville, TN 37996, USA

* To whom correspondence should be addressed. Tel: +1 8652410672; Fax: +1 8655745345; Email: culiatct{at}ornl.gov

Received January 4, 2006; Accepted March 7, 2006

GenBank accession no. AY622226


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
The mammalian Nell1 gene encodes a protein kinase C-ß1 (PKC-ß1) binding protein that belongs to a new class of cell-signaling molecules controlling cell growth and differentiation. Over-expression of Nell1 in the developing cranial sutures in both human and mouse induces craniosynostosis, the premature fusion of the growing cranial bone fronts. Here, we report the generation, positional cloning and characterization of Nell16R, a recessive, neonatal–lethal point mutation in the mouse Nell1 gene, induced by N-ethyl-N-nitrosourea. Nell16R has a T->A base change that converts a codon for cysteine into a premature stop codon [Cys(502)Ter], resulting in severe truncation of the predicted protein product and marked reduction in steady-state levels of the transcript. In addition to the expected alteration of cranial morphology, Nell16R mutants manifest skeletal defects in the vertebral column and ribcage, revealing a hitherto undefined role for Nell1 in signal transduction in endochondral ossification. Real-time quantitative reverse transcription-PCR assays of 219 genes showed an association between the loss of Nell1 function and reduced expression of genes for extracellular matrix (ECM) proteins critical for chondrogenesis and osteogenesis. Several affected genes are involved in the human cartilage disorder Ehlers-Danlos Syndrome and other disorders associated with spinal curvature anomalies. Nell16R mutant mice are a new tool for elucidating basic mechanisms in osteoblast and chrondrocyte differentiation in the developing skull and vertebral column and understanding how perturbations in the production of ECM proteins can lead to anomalies in these structures.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Bone and cartilage are specialized connective tissues that provide structural support for the vertebrate organism and participate in key metabolic processes (e.g. calcium homeostasis). The formation of bone (osteogenesis) and cartilage (chondrogenesis) are complex processes governed by numerous genes acting in several stages: (a) commitment of the precursor cells; (b) the proliferation of the osteoprogenitor/chondroprogenitor cells; (c) differentiation of osteoblasts and chondrocytes; and (d) formation of cartilage or a calcified bone matrix (1Go). In the developing skull, calvarial bones are formed by intramembranous ossification, wherein mesenchymal cells differentiate into osteoblasts and the production of bone matrix occurs directly without previous cartilage formation. Other bones in the body are formed by endochondral ossification, wherein mesenchymal cells aggregate, differentiate into chondrocytes and form cartilaginous tissue that is ultimately replaced by mineralized bone (1Go,2Go). Normal bone formation requires a delicate balance between proliferation, differentiation and apoptosis in osteoblasts and chondrocytes.

Craniosynostosis (CS) is among the numerous abnormalities resulting from perturbations in intramembranous ossification in the developing skull. CS is a significant medical condition because of its high incidence (1/3000 births) and the fact that cessation of skull growth at the prematurely fused suture sites can severely constrain the growth of the underlying brain, leading to increased intracranial pressure, impaired cerebral blood flow and airway obstruction (3Go,4Go). Moreover, certain types of CS are associated with defects in limb and spine development (5Go,6Go). Several genes controlling the establishment, maintenance and closure of cranial sutures have been identified (e.g. MSX2, FGRFR1, 2, 3, TWIST) and the underlying molecular mechanisms elucidated by examining the consequences of mutations in mice (3Go,4Go,7Go–10Go). The importance of the NELL1 gene in cranial development was first postulated with the discovery that it was dramatically up-regulated in prematurely fusing and fused sutures of patients with unilateral coronal synostosis (11Go). Transgenic mice over-expressing the rat Nell1 gene displayed CS at birth, thereby confirming the earlier report that Nell1 has a key role in human cranial development and suggesting that the underlying mechanisms can be investigated accurately using mouse models (12Go). The over-expressing transgenic mice have abnormalities specific to calvarial development and are viable. Further in vivo and in vitro studies showed that Nell1 over-expression triggers premature fusion of growing skull bones by increasing osteoblast differentiation, apoptosis and mineralization (12Go,13Go).

The NELL1 gene encodes a polypeptide (810 amino acids) that is glycosylated and processed in the cytoplasm and then secreted as a 400 kDa trimer. The protein contains thrombospondin-like, laminin G, von Willebrand factor-like repeats and epidermal growth factor (EGF)-like domains (14Go,15Go). The NELL1 protein binds to and is phosphorylated by PKC-ß1 via the EGF-like domains, suggesting that Nell1 represents a novel class of cell-signaling ligand molecules critical for growth and development (15Go).

While investigating the molecular basis for phenotypes of N-ethyl-N-nitrosourea (ENU)-induced lethal mutations mapping to a small segment of mouse chromosome 7, we previously defined mutations in the l7R6 locus as late gestation/neonatal lethals (16Go). In this report, we present a new allele, designated l7R66R, which is a point mutation in Nell1 resulting in severe loss of expression. The loss of Nell1 function leads to skeletal defects in the cranial vault, vertebral column and ribcage. Gene expression assays reveal that these aberrant phenotypes are because of the downregulation of extracellular matrix (ECM), cell adhesion and cell communication proteins that are necessary in osteogenesis and chondrogenesis. This report is the first demonstration of the significance of Nell1-mediated pathways in cartilage development and the consequences of loss-of-function of Nell1 in vivo.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
l7R66R mice die during birth, exhibit enlarged heads and abnormal body curvature
l7R66R hemi- and homozygotes develop to late gestation (E19 days) but do not survive the physical trauma of birth. Observations on females during delivery showed that all l7R66R mutant neonates were born dead, whereas remaining undelivered mutants were alive when recovered by caesarean section. However, rescued mutant mice quickly succumbed because they were unable to breathe and foster mothers usually cannibalized them. Mutant fetuses are easily distinguished from normal littermates by their pronounced curled position, enlarged head region (Fig. 1A), inability to open their mouths and very weak reflexes in extremities when stimulated by touching. Heterozygotes survive to adulthood and breed normally, with no readily visible phenotypic differences when compared with wild-type mice.


Figure 0531
View larger version (33K):
[in this window]
[in a new window]
 
Figure 1. (A) Phenotype of l7R66R homozygote mutants at 19 days of gestation. On the right is a fetus homozygous for the l7R66R allele (stock 102DSJ) showing a very curled position and enlarged head size compared with the control littermate (left). l7R66R mouse fetuses are recovered alive by caesarean rescue because they do not survive delivery through the birth canal, perhaps owing to the physical trauma in the neck and spine region brought about by the abnormal spinal curvature. (B) Complementation analysis showing the mapping of the l7R6 locus into an interval in mouse chromosome 7 (red box) that is homologous to a segment of human chromosome 11p15 (red box) where the Nell1 gene is located. Mouse chromosome 7 is represented by the line with a filled circle at the left (indicating the centromere) and relative positions of genes and markers are indicated above the line. Five mutant mouse lines carrying deletions of varying lengths and surrounding the pink-eyed dilution gene (p) are shown as 46DFiOD, 47DTD, 2MNURf, 8R250M and 3R30M. Among these mutations, only the 3R30M deletion can complement the ENU-induced mutations at l7R6 indicating that this deletion does not extend to the position where the l7R6 gene is located. The interval is therefore defined by the proximal deletion breakpoints of the 8R250M and 3R30M mutant mouse lines.

 
Gross anatomical observations indicated that compared with their wild-type littermates, homozygous mutant fetuses manifested a decreased body length because of the pronounced altered curvature of the spine and an enlarged altered head shape brought about by increased head length (Table 1). No significant changes in head height and width were detected.


View this table:
[in this window]
[in a new window]
 
Table 1. Quantitative analysis of changes in body length and head size of Nell16R homozygous mutants compared with wild-type littermates, measured (in mm) at E18.5 days of gestation
 
l7R66R is a point mutation in the Nell1 gene resulting in a Cys->Ter codon substitution and severe reduction in transcript levels
Trans-complementation analysis with a number of P-deletions localized l7R66R to the same <1 cM segment of chromosome 7 (Fig. 1B, Materials and Methods) as other l7R6 alleles, with homology to a region of human 11p15. Gene content analysis of the human chromosomal region suggested at least six candidate genes for l7R6 (http://genome.ucsc.edu), including NELL1, which was particularly provocative because of its over-expression in the prematurely fused sutures of patients manifesting unilateral coronal synostosis. The pronounced enlarged head phenotype, along with the deletion-map position, suggested that recessive l7R66R mutation may be a loss-of-function allele in the Nell1 gene. To test this hypothesis, Nell1 gene expression in wild-type and mutant embryos and in wild-type adult tissues was assayed by Northern blot analysis. The cDNA probe detected a 3.5 kb message in polyA+ RNA extracted from wild-type embryos from E10–18 days of gestation (Fig. 2B). During gestation, expression was first detected at E10 and steadily increased in the head region and decreased in the body. In adult tissues, normal expression was observed primarily in adult brain (Fig. 2A). In contrast, northern blot assays of RNA samples isolated from E15 fetuses showed little detectable expression of Nell1 in l7R66R mutants (Fig. 2B).


Figure 0532
View larger version (34K):
[in this window]
[in a new window]
 
Figure 2. Expression of the mouse Nell1 gene. (A) Northern blot analysis on polyA+ RNAs from heads (H) and bodies (B) of wild-type embryos/fetuses (samples 1–8) and adult mouse tissues (samples 9–16). The lane positions, developmental stages and adult tissues are: 1, E10; 2, E12; 3, E14 H; 4, E14 B; 5, E16 H; 6, E16 B; 7, E18 H; 8, E18 B; 9, brain; 10, liver; 11, spleen; 12, kidney; 13, thymus; 14, heart; 15, lung; 16, muscle. The Nell1 cDNA probe detects a 3.5 kb transcript as early as E10 days. From E14 to E18 days, the Nell1 message is abundant in both fetal heads and bodies, increasing markedly in the head as development proceeds. Hybridization of the blot with an actin probe serve as control to compare levels of samples loaded in each lane. (B) Northern blot analysis on polyA+ RNAs extracted from the heads of hemizygous E15 l7R6 fetuses, shows a severely reduced expression of the Nell1 gene in the l7R66R (102DSJ) allele compared with normal levels of expression detected in mice with the following genotypes: wild-type, mutant hemizygotes for four other alleles at the l7R6 locus (335SJ, 88SJ, 45DSJ, 2038SJ).

 
To identify the presumed Nell16R (l7R66R) mutation, each exon along with flanking intron sequences was amplified from genomic DNA and analyzed for single base pair changes by heteroduplex analysis using temperature gradient capillary electrophoresis (17Go). Heteroduplexes were detected in exon 14 (not shown), hence the samples were sequenced in mutant animals and compared with the sequence in the wild-type controls. Sequence analysis showed a single base pair substitution of T->A that converts a codon for cysteine into a premature stop codon [TGT->TGA; Cys(502)Ter] that truncates the 810 amino acid polypeptide at residue no. 502 and eliminates the EGF-like domains that bind PKC-ß1 protein (Fig. 3). As transcripts bearing premature stop codons in positions such as the one present in the Nell16R transcript are subject to nonsense-mediated decay (18Go,19Go), the mutation scanning data are consistent with the observation of severely decreased Nell1 mRNA levels in mutants (Fig. 2B).


Figure 0533
View larger version (70K):
[in this window]
[in a new window]
 
Figure 3. Identification of the Nell16R mutation. (A) Mouse Nell1 cDNA sequence (GenBank accession no. AY622226) and position of predicted protein domains [Thrombospondin (gray); Laminin G (underlined); von Willebrand factor type C (yellow); calcium-binding EGF-like (blue)]. The locations of the ENU-induced mutation at base pair no. 1546 in the cysteine codon and the change in amino acid no. 502 are both highlighted in red text. The premature termination codon introduced at this site will truncate the protein and remove the EGF-like domains that are essential for the binding to PKC-ß1. One von Willebrand factor type C domain will also be missing from the putative mutant protein product. (B) Sequence electropherograms showing the T to A base change (red arrows) in the wild-type (left) and the mutant sequence (right) of the Nell1 gene.

 
Nell16R mutant mice have skeletal defects in the skull and vertebral column
Because of prior reports on the role of Nell1 in cranial development and osteoblast differentiation, we performed a detailed analysis of skull and skeletal defects in the Nell16R mutants (E18.5 days) using Alizarin Red–Alcian Blue staining. Skeletal analysis showed compression of intervertebral spaces and alteration of spinal curvature, and anomalies in the shape and volume of the ribcage (Fig. 4A and B). The cervical region of the vertebral column displayed the most dramatic reduction in the intervertebral disc matrix and a pronounced change in spinal curvature is observed at the juncture of the cervical and thoracic vertebral bones (Fig. 4A and B). Enlargement and thinning of the parietal, frontal and interparietal bones in the skull were readily apparent (Fig. 4C–F). The nasal bones were also enlarged but thinning was not clearly observed in these structures. The consistently decreased staining by Alizarin Red in the Nell16R calvarial bones indicated decreased ossification in the mutant. These Nell16R skeletal defects were confirmed by microcomputerized tomography scanning (Fig. 4G and H). Radiographs showed the sharp curvature change between the cervical and thoracic vertebrae (Fig. 4G). Moreover, the microCat scanning data suggested lesser bone density (Fig. 4G) and areas of ossification (Fig. 4H) in the Nell16R mutant homozygotes. Although the effect of Nell16R mutation in the head region was expected, its profound impact on the development of the vertebral and thoracic skeleton was not anticipated as the deleterious effects of Nell1 over-expression were confined to the growth and differentiation of the calvarial bones (12Go).


Figure 0534
View larger version (98K):
[in this window]
[in a new window]
 
Figure 4. Skeletal defects in Nell16R homozygote mutant fetuses at 18.5 days of gestation. (A) Alizarin Red and Alcian Blue staining showed that mutant homozygotes have altered spinal curvature, decreased intervertebral disc spaces, reduced thoracic cavity, protruding sternum and a slight enlargement of the skull. (B) Close-up of the cervical region where the most pronounced vertebral compression was observed. The skeletal specimens in (B) are a different pair of littermates from those in (A). (C) Side view of the cranial vault showing enlargement of parietal bones (Pr) in mutant fetal heads. (D) Top view of the skull showing the increased size of the nasal (Ns), frontal (Fr) and parietal (Pr) bones in the Nell16R mutant mice. (E) Enlargement of the interparietal and (F) frontal bones. (D–F) The calvarial bones of the Nell16R mutant mice are thinner than those of the wild-type and consistently have less Alizarin Red staining, suggesting a lesser degree of ossification. (G) Radiographs of a wild-type fetus compared to a Nell16R mutant littermate. A pronounced alteration in spine curvature occurs at the cervical vertebrae in the mutant fetuses (arrow). The lesser intensity of signals in the craniofacial and vertebral skeletons of the mutant suggests lesser bone density. (H) Images from 3D re-construction of microCat scans for wild-type and mutant fetuses show lesser areas of ossification in the mutant fetal head (arrow). The observation in earlier skeletal analysis that the mutant calvarial bones are thinner is consistent with microCat data showing larger areas of dense bone in the wild-type fetus (arrows).

 
Loss of Nell1 function reduces expression of genes coding for ECM, cell adhesion and communication proteins
Nell1 is a novel gene, thus the molecular and cellular mechanisms of its role in mammalian development are unknown. In order to define the genes and pathways that were perturbed by the Nell16R mutation, we screened hundreds of potential ‘downstream’ genes for differences in expression levels between wild-type and mutant Nell16R fetuses. Real-time quantitative RT-PCR analysis of 219 experimental and six control genes was carried out in RNA samples extracted from individual heads and bodies of four Nell16R mutants and four wild-type E18 fetuses. These assays on whole tissues enabled a rapid and efficient assessment of the impact of the Nell16R mutation on a wide range of genes. Changes in ‘expression levels’ of these genes may either be direct (e.g. transcriptional changes) or indirect (e.g. expansion or reduction of specific cell populations). The 219 genes were carefully selected based on the observed mutant phenotype and the putative domains and functions of the Nell1 gene. Genes associated with CS (e.g. Runx2, Msx2, Fgfr3), bone and cartilage development, cell growth and differentiation, neural development and signal transduction pathways were also included. The complete list of genes assayed by qRT-PCR is presented in Supplementary Material, Table S1 online.

Gene expression analyses revealed reduced expression of 13 genes in the head and 28 genes in the body because of the Nell16R mutation (Fig. 5). Expression levels of the following nine genes were affected in both heads and bodies: collagen 5 alpha 3 subunit (Col5a3), tenascin (Tnxb), procollagen type XV alpha 1 (Col15a1), procollagen type V alpha 1 (Col5a1), thrombospondin 3 (Thbs3), matrilin 2 (Matn2), tumor necrosis factor receptor superfamily member 11b (Tnfrsf11b), osteoblast-specific factor (Osf2) and chondroadherin (Chad). Further analysis using publicly available tools such as DAVID (Database for Annotation, Visualization and Integrated Discovery) (20Go), GeneCards®, UCSC genome browser and extensive PubMed literature searches showed that the majority of the genes with reduced expression encode ECM proteins such as specific collagens, thrombospondins, tenascins and matrilins. These proteins provide cell adhesion and communication, and impart strength and flexibility to tissues. The most severely affected genes (2–3-fold) in the fetal head were Tnxb and Col5a3, whereas in the body they were: Tnxb, proteoglycan 4 (Prg4), Thbs3 and Col5a3. Eight out of 21 collagen genes assayed showed significant changes in expression indicating that the loss of Nell1 influences only a specific set of collagen subunits. Another striking result is that mutations in the human counterparts of two dramatically affected genes, Tnxb and Col5a1, cause Ehlers-Danlos Syndrome (EDS), a severe cartilage defect (1/5000 individuals) characterized by hyperextensibility of the skin and extreme flexibility of joints (21Go,22Go). EDS patients do not have the ability to make certain components of the connective tissue, particularly fibrillar collagens, or they have defective regulation of collagen synthesis and deposition (22Go,23Go). Because of the importance of collagen V in EDS, it is predicted that mutations in Col5a3, another gene whose expression is globally reduced (2-fold) in Nell1-deficient mice, will generate certain forms of EDS (22Go,24Go). Of the six distinct EDS clinical syndromes, EDS-type V1 is an autosomal recessive form characterized by abnormal curvature of the spine, hypotonia, joint laxity and ocular fragility (22Go). Other genes expressed in the fetal body that are affected by Nell1 (e.g. Tnc, Tnx, Matn3, Chad, Tnrsf11b and Bmpr1a) are already known to be critical in the development of the vertebral column in human and/or mouse (25Go–27Go).


Figure 0535
View larger version (66K):
[in this window]
[in a new window]
 
Figure 5. Gene expression profile of Nell16R mutants compared with wild-type fetuses (E18). Genes with significantly reduced expression in mutant mice are listed from highest to lowest fold change. Nine genes (in red text) are affected in both heads and bodies. Majority of the genes that are affected by the Nell16R mutation encode proteins for the ECM, cell adhesion (Adhn) and cell communication (Comm) during bone and cartilage development.

 
Nell16R mutant mice have reduced ECM and decreased bone mineralization
The gene expression profile resulting from the Nell16R mutation is further supported by standard histological analysis using haematoxylin and eosin, periodic Acid Schiff and Masson staining (Fig. 6). Nell16R mutant mice display considerable reduction in the amount of extracellular material surrounding cells in the developing vertebral bone and intervertebral discs, compared with the wild-type controls (Fig. 6A–D). In addition, histology data suggested lesser degree of bone and cartilage development in mutant animals (Fig. 6C and D). Results from von Kossa staining of sagittal sections through the vertebral column and parietal bones (Fig. 6E–H) showed decreased bone mineralization in Nell16R. The cranial and vertebral bones of mutant homozygotes have a lesser number of mineralized areas and exhibit a highly irregular pattern when compared with wild-type specimens. The frontal bones display the same defects in bone mineralization as the parietal bones (data not shown).


Figure 0536
View larger version (102K):
[in this window]
[in a new window]
 
Figure 6. Histopathology indicating loss of extracellular material and disrupted bone development in the Nell16R mutant vertebral column and calvarial bones. (A) The normal architecture of the cervical vertebral column in a wild-type mouse (sagittal section; Masson Stain) compared with the mutant Nell6R homozygote (B), showing the decrease of intervertebral disk matrix/space between the vertebral bodies (arrows). Higher magnification view of sagittal sections of the vertebral bodies in wild-type (C) and mutant (D) animals (haematoxylin and eosin staining) indicating lesser amount of ECM and cellular development of chondrocytes in the mutants. Von Kossa staining of sagittal sections through the vertebral columns of wild-type (E) and mutant E18 fetuses (F) showing decreased bone mineralization in the vertebral bodies of Nell16R homozygotes. The intensity and the distribution of stained areas (black spots) are lesser and exhibit an irregular pattern in the mutant fetuses. Von Kossa analysis of sagittal sections through the parietal bones of wild-type (G) and mutant (H) fetuses also revealed decreased mineralization. In mutant parietal (H) and frontal bones (data not shown), the intensity of von Kossa staining is less and in contrast to the wild-type Nell16R calvarial bones, have thinner and more ‘patchy’ pattern of mineralization. There are larger and more frequent gaps between mineralized regions, similar to the pattern seen in the vertebral bodies (F).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
We have characterized the phenotypic and molecular consequences of Nell16R, an ENU-induced point mutation in the Nell1 gene that converts a cysteine codon to a premature termination codon, thereby truncating an 810 amino-acid polypeptide at residue no. 502. The severe reduction of Nell1 transcripts in Nell16R homozyotes (presumably because of nonsense-mediated decay) results in neonatal lethality, an enlarged skull with thinning at the calvarial bone edges, reduced intervertebral disc spaces, alteration in the vertebral column curvature, abnormal shape and size of the ribcage. The range of skeletal anomalies manifested by Nell16R mutants indicate that the Nell1 gene plays a key role in both intramembranous and endochondral ossification during early mammalian development.

The impact of the loss of Nell1 function in the cranial phenotype and the characteristic gene expression profile in the fetal heads of Nell16R mutant mice are consistent with the role of Nell1 in osteoblast differentiation and the known mechanisms of suture development and closure. Developing sutures contain undifferentiated proliferating osteogenic stem cells, a proportion of which differentiate into osteoblasts at the edges of the calvarial bones. Mature osteoblasts secrete a collagen–proteoglycan matrix that binds calcium salts, mineralizes and generates new bone from the osteoid matrix. A delicate balance between stem-cell proliferation and differentiation into bone is required so that the stem-cell population is maintained until skull growth is complete (28Go). Signals from the dura mater directly underneath the skull maintain sutural patency by regulating cell proliferation and collagen production (29Go). CS involves excessive growth of the calvarial bones so that two opposing growing bone fronts become very close or overlap and the subsequent fusion of juxtaposed bone fronts (12Go). Over-expression experiments (in vivo and in vitro) have clearly shown that Nell1 promotes osteoblast differentiation at the growing calvarial bones (11Go–13Go). In contrast, downregulation of Nell1 using in vitro approaches demonstrated decreased cell differentiation and predicted that reduced levels of Nell1 protein will promote cell proliferation at the suture (12Go). The enlargement and immature bone development of the cranial vault and the decreased levels of ECM proteins secreted by mature osteoblasts in Nell16R mice support these earlier observations.

The processes that regulate the ossification and fusion of cranial sutures depend on specific ECM patterns. Mutation in genes that cause CS by over-stimulating osteoblast differentiation alter ECM turnover and can increase collagen, glycosaminoglycans and fibronectin in CS-derived fibroblasts (30Go). The decreased bone mineralization resulting from the loss-of-function of Nell1 gene, is also consistent with reduced levels of ECM detected in these mutant mice.

Although transgenic mice over-expressing Nell1 confirmed its role in craniofacial development, the broader role of Nell1 in skeletal development is revealed by the new loss-of-function allele, Nell16R. In particular, the alteration of spinal curvature and reduction of intervertebral disc spaces in these mutants indicate involvement of Nell1 in signal transduction in the developing spine. The finding that Nell1 directly or indirectly affects expression of at least eight genes (Tnxb, Tnc, Col12a1, Col6a1, Matn3, Bmpr1a, Thbs3) that are necessary for the development of and/or are specific constituents of the intervertebral disc matrix (25Go,31Go–35Go) provides additional support for a role for Nell1 in early vertebral column development. As the expression of EDS-associated genes, Tnxb, Col5a1 and Col5a3 are severely reduced by the Nell16R mutation, the role of Nell1 in the etiology of EDS (types V1, VIIa,b) or EDS-like disorders manifesting spinal curvature defects needs further investigation. Moreover, immunohistochemical studies of the proteins coded by the genes affected by the Nell16R mutation (based on qRT-PCR assays), especially during key stages of bone and cartilage development in the wild-type and Nell16R mutant mouse model, will further characterize the functions of the Nell1 gene during early skeletal development.

Our discovery of the involvement of Nell1 in the vertebral column development is consistent with the fact that PKC-ß1 isozyme localizes in the vertebral bodies and intervertebral disc spaces of human fetuses during the 8th week of development, a critical developmental period when chondrogenetic and osteogenetic processes are initiated in the vertebral column (36Go). PKC activity has also been observed in the fetal mouse vertebral column and is abundant in the more mature cells close to the ossification center and the intervertebral disc spaces. Over-expression of the Nell1 gene does not appear to disrupt vertebral development, but it is clearly altered by a reduction or malfunctioning of Nell1 protein. Our data demonstrate that, in addition to its role in intramembranous bone differentiation, Nell1 has a critical function in endochondral ossification and normal chrondrogenesis in the spine. The high degree of conservation in structure and function of the Nell1 gene itself suggests that the spinal phenotype could also be a consequence of human NELL1 loss-of-function mutations. Therefore, we suggest that linkage studies and mutation scanning in families segregating both cranial defects and spinal anomalies should focus on the NELL1 gene in chromosome 11p15.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Mouse breeding and maintenance
All animals were bred at the Mammalian Genetics Research Facility at Oak Ridge National Laboratory (ORNL) (Oak Ridge, TN, USA) using protocols approved under the ORNL Institutional Animal Care and Use Committee. The identification and fine-structure mapping of the l7R6 locus in mouse Chr 7 are described elsewhere (16Go). The 102DSJ mutation was recovered in a manner similar to that described previously for the 88SJ (l7R61R), 335SJ (l7R62R) and 2038SJ (l7R63R) alleles at the l7R6 locus (16Go). Mutagenized chromosomes marked with the P-mutation were recovered in G1 females from ENU-treated 21A G0 males. The 102DSJ lethal mutation was recognized when G1 female no. 102 failed to yield any pink-eyed-dilute G2 progeny when she was crossed to a +P7R/Del(Hps5ru2P)46DFiOD G1 male. Deletion mapping also similar to that performed previously (16Go) revealed that the 102DSJ lethal mapped to the same deletion interval as did the previously ascertained l7R6 alleles (data not shown). Allelism was confirmed (i.e. 102DSJ=l7R66R) when no pink-eyed dilute progeny were found in greater than 30 progeny of a cross of 88SJ (Hps5ru2 l7R61Rp/Hps5ru2++) and 102DSJ (+102DSJP/++p7R) heterozygotes, when 25% were expected (P<0.001). To generate fetuses hemizygous for 102DSJ progeny-tested males +P7R/l7R66R were mated with +P7R/Del(Hps5ru2P)46DFiOD females. Mice homozygous for the l7R66R mutation were obtained by breeding heterozygote carriers (l7R66RP/+P7R), which generated pink-eyed homozygotes (l7R66RP/l7R66RP) and dark-eyed wild-type mice (+P7R/+P7R). Matings were done for 1 h early in the morning, and females were examined for the presence of vaginal plugs (gestation day 0). Fetuses were collected at 15, 18 and 19 days of gestation.

Body and head measurements
Fetuses (E18.5) were recovered by caesarean section from nine pregnant females and a total of 16 wild-type and 19 homozygous l7R66R mutant mice were measured for body length, head height, head length and head width. Measurements were obtained using a Fisher Scientific Digital Caliper. Statistically significant differences between mutant and wild-type fetuses were determined using a two-tailed T-test, not assuming equal variances and with a P-value cutoff of 0.005.

Skeletal analysis
Skeletal defects were evaluated using standard protocols for Alizarin Red–Alcian Blue staining of intact fetuses (37Go) and small animal microcomputerized tomography scanning (microCat) (38Go). Thirteen wild-type and 13 homozygous mutant fetuses were recovered by caesarean at E18.5 days of gestation from seven pregnant females. Fetuses were briefly soaked in 70°C water and the skin and internal organs were removed. Specimens were fixed in 95% ethanol, stained in Alcian Blue for 1–2 days and rinsed in 95% ethanol. They were then cleared in 1% KOH (2–6 h), subsequently, stained for 3 h in Alizarin Red solution and cleared further by placing in 2% KOH overnight. Clearing was completed by processing through the following series of solutions of 2% KOH/glycerol: (80:20), (60:40), (40:60) and (20:80) with storage indefinitely in the final solution. Three Nell16R mutant and three wild-type E18.5 fetuses were analyzed using the small animal microCat system developed at Oak Ridge National Laboratory (38Go).

Histology
Histology was conducted on formalin-fixed, paraffin-embedded specimens of E18.5 fetuses (seven mutant and six wild-type specimens) recovered by caesarean section. Standard techniques were used for Haematoxylin and Eosin, Masson, periodic Acid Schiff (PAS) and von Kossa staining (39Go). Masson staining shows cytoplasm, keratin and muscle fibers as red, whereas collagens and mucus are stained blue. The PAS stains glycogen, mucopolysaccarides, glycoproteins and glycolipids purple. The presence and distribution of bone mineralization was determined by von Kossa staining, which shows deposits of calcium or calcium salts as black.

RNA analysis
Total RNAs were extracted from fetuses and adult tissues using standard guanidine isothiocyanate procedures (40Go). Phase Lock GelsTM (Eppendorf) were used for subsequent phenol–chloroform purifications. RNAs were precipitated with isopropanol and after centrifugation, pellets were re-suspended in nuclease-free water. About 700 µg to 1 mg total RNA per sample was used for purifying polyA+ RNA using Mini-Oligo(dt) Cellulose spin columns (5'–3' Inc.). One to two micrograms of polyA+ RNAs were used for northern blots using standard electrophoresis and blotting protocols (41Go). Blots were hybridized with the CTC55+59 probe, which was generated by RT-PCR using primers designed from mouse EST sequences matching the 5' and 3' ends of human NELL1 (1920 bp; ctc55-TGCAGCAGAAGCCGTCCA; ctc59-CAAACTAGGGCAAGCTAGAG).

DNA analysis and sequencing
The Nell16R mutation was identified by sequencing genomic DNAs extracted from the clipped tails of mutant and wild-type mice. cDNA sequencing was performed on reverse transcribed PCR-amplified segments. First-strand cDNA templates were generated from polyA+ RNAs extracted from E15 fetal heads using the RETROscript Kit (Ambion). Two overlapping cDNA segments covering the entire coding region plus the 5' and 3'-untranslated region were generated using the following primer pairs: ctc138/ctc149 and ctc150/ctc59. Ctc138/ctc149 generates a 556 bp fragment corresponding to the 5' end of Nell1 and was generated by standard PCR techniques. Ctc150/ctc59 amplifies a 1465 bp segment spanning the middle to 3' end of the coding region and was generated by long-range PCR (Expand Long Template CR, Roche Diagnostic Group). The primer sequences are as follows: ctc59:CAAACTAGGGCAAGCTAGAG; ctc150:GCAGAGACGAGACTTGGTCAACTGG; ctc138:CTGAAGCATTGGTTTCTTGC and ctc149:TCGACATGGAGTAGGAGGTGAGAGG. PCR products were sequenced using the primers that generated the products, and primers were designed using the acquired sequence data of preceding segments. Primers used for sequencing are available upon request. The mouse Nell1 full-length cDNA sequence was submitted to GenBank as accession no. AY622226.

Mutation scanning
Twenty primer sets were designed to amplify each exon of Nell1 from flanking intron sequences and two additional primer sets amplified conserved upstream elements. Each amplicon was amplified from genomic DNAs extracted from Nell16R hemizygous mutant mice, and the control strains (BJR and 21A). Corresponding PCR products were mixed in equal volumes, heteroduplexed and scanned for point mutations using TGCE (17Go). Three overlapping temperature gradients were used: 50–60°C, 55–62°C and 60–68°C. The 421 bp amplicon containing the mutation in the l7R66R allele was amplified by PCR using the following primer pairs designed from the intron sequences flanking the 131 bp exon 14 of Nell1; NellExon14(F): ATAGACCAGGGGCAGAAACC and NellExon14R: TTGCCTCAACCTCAATATCC.

High-throughput real-time qRT-PCR assays
RNAs from the heads and bodies of four Nell6R mutant and four wild-type E18 fetuses were extracted individually (16 RNA samples) according to the extraction method described earlier. DNase1-treated RNAs were ethanol precipitated and re-suspended in nuclease-free water. Total RNAs (2.5 µg) were reverse transcribed to cDNA using the random-priming High-Capacity cDNA Archive Kit (Applied Biosystems).

Multiplex pre-amplification of cDNA targets
To enable maximum sensitivity and detection of hundreds of gene expression targets from a small amount of cDNA, a novel multiplex PCR pre-amplification strategy was used prior to conventional quantitative PCR. Two hundred and twenty-five (219 experimental and six endogenous control genes) Taqman Gene Expression Assays (PCR primer/FAM-probe stock solutions) were pooled together and used in a single PCR to amplify all targets equally from the same cDNA template. The FAM-probe is a component of the final configuration of the manufactured TaqMan® gene expression assays and does not interfere with the pre-amplification process. To prepare the multiplex pre-amplification primer pool, equal volumes of the 225 TaqMan® gene expression assays were mixed together, dried under vacuum and re-suspended with water to generate a multiplex-pooled primer set with a concentration of 180 nM for each primer. The pre-amplification reaction was set up as follows: a 250 µl volume of 500 ng of cDNA was combined with 250 µl of the multiplex-pooled primers. Then, 500 µl of 2X Multiplex pre-amplification Master Mix was added to generate the final 1000 µl reaction volume (Applied Biosystems). The reaction mix was divided into 50 µl aliquots in a 96-well PCR tray and cycled on an ABI 9700 thermal cycler under the following conditions: 95°C for 10 min; then 10 cycles at 95°C for 15 s; and 60°C anneal/extension for 4 min.

Real-time PCR reactions
Pre-amplification products were recombined into one tube and diluted 1:5 with water. Individual singleplex TaqMan® Gene Expression Assays for each of the 225 pre-amplified markers, along with 18S rRNA (which was not included in the pre-amplification reaction because of its high level of expression) were prepared as follows: 5.0 µl of 2X TaqMan® Universal PCR Master Mix, 0.5 µl of TaqMan® Gene Expression Assay 20X primer/FAM-probe solution and 2.0 µl of water and 2.5 µl of pre-amplified cDNA product. For all samples, each assay was carried out in quadruplicate wells of 384-well plates and run in the ABI PRISM® 7900HT Sequence Detection System under two-temperature cycling: 95°C for 10 min, then 40 cycles of 95°C for 15 sec and 60°C for 1 min. CT (threshold cycle) values, the cycle number at which the PCR amplification fluorescence signal crosses a fluorescence threshold, were generated using the FAM dye layer setting at a threshold of 0.2 and a baseline of 3–13.

Data analysis
The relative levels of transcripts for each gene in wild-type and mutant samples were compared following normalization to endogenous control targets. GeNORM software (42Go) was used to select the two best targets with the least variation across samples from a collection of six potential endogenous controls (Hprt, Tfrc, Tbp, Gus, gk1 and 18s rRNA). Gus and Hprt were selected for heads, whereas Gus and gk1 were selected for bodies. The geometric mean of the selected targets was then used as the reference for determining {Delta}CT values. For each sample, {Delta}CT values were determined by the following equation: {Delta}CT Marker=CT Marker–CT Reference. Statistically significant differences between {Delta}CT values of wild-type and mutant groups were determined by a two-tailed t-test without assuming equal variances and with a P-value cutoff of 0.005. {Delta}{Delta}CTs were also calculated between wild-type and mutant groups based upon average {Delta}CT values for each group, and relative fold differences between them were determined by 2{wedge}{Delta}CT (43Go).


    SUPPLEMENTARY MATERIAL
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Supplementary Material is available at HMG Online.


    ACKNOWLEDGEMENTS
 
We thank Brynn Voy and Yie Liu for their constructive comments on this manuscript. Jennifer Millsaps generated the initial probe for the Northern Blots and Gurusahai-Khalsa Moyers assisted in the selection of gene expression assays. Mike Paulus provided training in microCat scanning and data analysis. The Office of Biological and Environmental Research, in the Department of Energy, funded this work under the contract DE-AC05-00OR22725.

Conflict of Interest statement. None.


    FOOTNOTES
 
{dagger} Present address: Taconic, One Hudson City Centre, Hudson, New York 12534, USA. Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 

  1. Bilezikian, J., Raisz, L. and Rodan, G. (2002) Principles of Bone Biology, 2nd ed. Academic Press, San Diego, CA, USA.

  2. Shum, L., Coleman, C.M., Hatakeyama, Y. and Tuan, R.S. (2003) Morphogenesis and dysmorphogenesis of the appendicular skeleton. Birth Defects Res. Part C. Embryo Today, 69, 102–122.

  3. Cohen, M.M. and Maclean, R.E. (2000) Craniosynostosis: Diagnosis, Evaluation, and Management. Oxford University Press, New York.

  4. Wilkie, A.O. (1997) Craniosynostosis: genes and mechanisms. Hum. Mol. Genet., 6, 1647–1656.[Abstract/Free Full Text]

  5. Anderson, P.J., Hall, C.M., Evans, R.D., Jones, B.M., Harkness, W. and Hayward, R.D. (1996) Cervical spine in Pfeiffer's syndrome. J. Craniofac. Surg., 7, 275–279.[Medline]

  6. Anderson, P.J., Hall, C.M., Evans, R.D., Hayward, R.D., Harkness, W.J. and Jones, B.M. (1997) The cervical spine in Saethre-Chotzen syndrome. Cleft Palate Craniofac. J., 34, 79–82.[Medline]

  7. Liu, Y.H., Tang, Z., Kundu, R.K., Wu, L., Luo, W., Zhu, D., Sangiorgi, F., Snead, M.L. and Maxson, R.E. (1999) Msx2 gene dosage influences the number of proliferative osteogenic cells in growth centers of the developing murine skull: a possible mechanism for MSX2-mediated craniosynostosis in humans. Dev. Biol., 205, 260–274.[CrossRef][Web of Science][Medline]

  8. Satokata, I., Ma, L., Ohshima, H., Bei, M., Woo, I., Nishizawa, K., Maeda, T., Takano, Y., Uchiyama, M., Heaney, S. et al. (2000) Msx2 deficiency in mice causes pleiotropic defects in bone growth and ectodermal organ formation. Nat. Genet., 24, 391–395.[CrossRef][Web of Science][Medline]

  9. Zhou, Y.X., Xu, X., Chen, L., Li, C., Brodie, S.G. and Deng, C.X. (2000) A Pro250Arg substitution in mouse Fgfr1 causes increased expression of Cbfa1 and premature fusion of calvarial sutures. Hum. Mol. Genet., 9, 2001–2008.[Abstract/Free Full Text]

  10. Carver, E.A., Oram, K.F. and Gridley, T. (2002) Craniosynostosis in Twist heterozygous mice: a model for Saethre-Chotzen syndrome. Anat. Rec., 268, 90–92.[CrossRef][Medline]

  11. Ting, K., Vastardis, H., Mulliken, J.B., Soo, C., Tieu, A., Do, H., Kwong, E., Bertolami, C.N., Kawamoto, H., Kuroda, S. et al. (1999) Human NELL-1 expressed in unilateral coronal synostosis. J. Bone Miner. Res., 14, 80–89.[CrossRef][Medline]

  12. Zhang, X., Kuroda, S., Carpenter, D., Nishimura, I., Soo, C., Moats, R., Iida, K., Wisner, E., Hu, F.Y., Miao, S. et al. (2002) Craniosynostosis in transgenic mice overexpressing Nell-1. J. Clin. Invest., 110, 861–870.[CrossRef][Medline]

  13. Zhang, X., Carpenter, D., Bokui, N., Soo, C., Miao, S., Truong, T., Wu, B., Chen, I., Vastardis, H., Tanizawa, K. et al. (2003) Overexpression of Nell-1, a craniosynostosis-associated gene, induces apoptosis in osteoblasts during craniofacial development. J. Bone Miner. Res., 18, 2126–2134.[CrossRef][Medline]

  14. Kuroda, S., Oyasu, M., Kawakami, M., Kanayama, N., Tanizawa, K., Saito, N., Abe, T., Matsuhashi, S. and Ting, K. (1999) Biochemical characterization and expression analysis of neural thrombospondin-1-like proteins NELL1 and NELL2. Biochem. Biophys. Res. Commun., 265, 79–86.[CrossRef][Web of Science][Medline]

  15. Kuroda, S. and Tanizawa, K. (1999) Involvement of epidermal growth factor-like domain of NELL proteins in the novel protein–protein interaction with protein kinase C. Biochem. Biophys. Res. Commun., 265, 752–757.[CrossRef][Medline]

  16. Rinchik, E.M., Carpenter, D.A. and Johnson, D.K. (2002) Functional annotation of mammalian genomic DNA sequence by chemical mutagenesis: a fine-structure genetic mutation map of a 1- to 2-cM segment of mouse chromosome 7 corresponding to human chromosome 11p14-p15. Proc. Natl Acad. Sci. USA, 99, 844–849.[Abstract/Free Full Text]

  17. Li, Q., Liu, Z., Monroe, H. and Culiat, C.T. (2002) Integrated platform for detection of DNA sequence variants using capillary array electrophoresis. Electrophoresis, 23, 1499–1511.[CrossRef][Web of Science][Medline]

  18. Hillman, R.T., Green, R.E. and Brenner, S.E. (2004) An unappreciated role for RNA surveillance. Genome Biol., 5, R8.[CrossRef][Medline]

  19. Nagy, E. and Maquat, L.E. (1998) A rule for termination-codon position within intron-containing genes: when nonsense affects RNA abundance. Trends Biochem. Sci., 23, 198–199.[CrossRef][Web of Science][Medline]

  20. Dennis, G., Jr., Sherman, B.T., Hosack, D.A., Yang, J., Gao, W., Lane, H.C. and Lempicki, R.A. (2003) DAVID: database for annotation, visualization, and integrated discovery. Genome Biol., 4, 3.

  21. Steinmann, B., Royce, P. and Superti-Furga, A. (1993) The Ehlers-Danlos Syndrome. In Connective Tissue and its Heritable Disorders. Wiley-Liss, New York, NY, USA.

  22. Mao, J.R. and Bristow, J. (2001) The Ehlers-Danlos syndrome: on beyond collagens. J. Clin. Invest., 107, 1063–1069.[Web of Science][Medline]

  23. Mao, J.R., Taylor, G., Dean, W.B., Wagner, D.R., Afzal, V., Lotz, J.C., Rubin, E.M. and Bristow, J. (2002) Tenascin-X deficiency mimics Ehlers-Danlos syndrome in mice through alteration of collagen deposition. Nat. Genet., 30, 421–425.[CrossRef][Web of Science][Medline]

  24. Imamura, Y., Scott, I.C. and Greenspan, D.S. (2000) The pro-alpha3(V) collagen chain. Complete primary structure, expression domains in adult and developing tissues, and comparison to the structures and expression domains of the other types V and XI procollagen chains. J. Biol. Chem., 275, 8749–8759.[Abstract/Free Full Text]

  25. Yoon, B.S., Ovchinnikov, D.A., Yoshii, I., Mishina, Y., Behringer, R.R. and Lyons, K.M. (2005) Bmpr1a and Bmpr1b have overlapping functions and are essential for chondrogenesis in vivo. Proc. Natl. Acad. Sci. USA, 102, 5062–5067.

  26. Cundy, T., Hegde, M., Naot, D., Chong, B., King, A., Wallace, R., Mulley, J., Love, D.R., Seidel, J., Fawkner, M. et al. (2002) A mutation in the gene TNFRSF11B encoding osteoprotegerin causes an idiopathic hyperphosphatasia phenotype. Hum. Mol. Genet., 11, 2119–2127.[Abstract/Free Full Text]

  27. Jackson, G.C., Barker, F.S., Jakkula, E., Czarny-Ratjczak, M., Makitie, O., Cole, W.G., Wright, M.J., Smithson, S.F., Suri, M., Rogala, P. et al. (2005) Missense mutations in the B strands of the single A-domain of matrilin-3 result in multiple epiphyseal dysplasia. J. Med. Genet., 41, 52–59.

  28. Johnson, D., Iseki, S., Wilkie, A.O. and Morriss-Kay, G.M. (2000) Expression patterns of Twist and Fgfr1, -2 and -3 in the developing mouse coronal suture suggest a key role for twist in suture initiation and biogenesis. Mech. Dev., 91, 341–345.[CrossRef][Web of Science][Medline]

  29. Opperman, L.A., Chhabra, A., Nolen, A.A., Bao, Y. and Ogle, R.C. (1998) Dura mater maintains rat cranial sutures in vitro by regulating suture cell proliferation and collagen production. J. Craniofac. Genet. Dev. Biol., 18, 150–158.[Web of Science][Medline]

  30. Carinci, F., Bodo, M., Tosi, L., Francioso, F., Evangelisti, R., Pezzetti, F., Scapoli, L., Martinelli, M., Baroni, T., Stabellini, G. et al. (2002) Expression profiles of craniosynostosis-derived fibroblasts. Mol. Med., 8, 638–644.[Web of Science][Medline]

  31. Gruber, H.E., Ingram, J.A. and Hanley, E.N.J. (2002) Tenascin in the human intervertebral disc: alterations with aging and disc degeneration. Biotech. Histochem., 77, 37–41.[Medline]

  32. Nerlich, A.G., Boos, N., Wiest, I. and Aebi, M. (1998) Immunolocalization of major interstitial collagen types in human lumbar intervertebral discs of various ages. Virchows Arch., 432, 67–76.[CrossRef][Medline]

  33. Roberts, S., Ayad, S. and Menage, P.J. (1991) Immunolocalisation of type VI collagen in the intervertebral disc. Ann. Rheum. Dis., 50, 787–791.[Abstract/Free Full Text]

  34. Jackson, G.C., Barker, F.S., Jakkula, E., Czarny-Ratajczak, M., Makitie, O., Cole, W.G., Wright, M.J., Smithson, S.F., Suri, M., Rogala, P. et al. (2004) Missense mutations in the beta strands of the single A-domain of matrilin-3 result in multiple epiphyseal dysplasia. J. Med. Genet., 41, 52–59.[Free Full Text]

  35. Miller, R.R. and McDevitt, C.A. (1991) Thrombospondin in ligament, meniscus and intervertebral disc. Biochim. Biophys. Acta, 1115, 85–88.[Medline]

  36. Bareggi, R., Martelli, A.M., Grill, V., Sandrucci, M.A., Zweyer, M. and Narducci, P. (1995) Protein kinase C (PKC) isozymes exhibit specific expression in the vertebral column of human fetuses. J. Biol. Res., 121, 83–90.

  37. Hogan, B., Beddington, R., Constantini, F. and Lacy, E. (1994) Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York.

  38. Paulus, M.J. (1999) A new X-ray computed tomography system for laboratory mouse imaging. IEEE Trans. Nucl. Sci., 46, 558–564.[CrossRef]

  39. Carson, F.L. (1990) Histotechnology. American Society of Clinical Pathologists Press, Chicago, USA.

  40. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. (1997) Current Protocols in Molecular Biology. John Wiley and Sons, New York.

  41. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press, New York, USA.

  42. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A. and Speleman, F. (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol., 3, RESEARCH0034.

  43. Applied, B. (2001) Relative quantitation of gene expresssion. User Bulletin 2.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
15/8/1329    most recent
ddl053v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Desai, J.
Right arrow Articles by Culiat, C. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Desai, J.
Right arrow Articles by Culiat, C. T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?