Skip Navigation


Human Molecular Genetics Advance Access originally published online on April 11, 2007
Human Molecular Genetics 2007 16(11):1307-1318; doi:10.1093/hmg/ddm079
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/11/1307    most recent
ddm079v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Davies, V. J.
Right arrow Articles by Votruba, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davies, V. J.
Right arrow Articles by Votruba, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Opa1 deficiency in a mouse model of autosomal dominant optic atrophy impairs mitochondrial morphology, optic nerve structure and visual function

Vanessa J. Davies1, Andrew J. Hollins1, Malgorzata J. Piechota1, Wanfen Yip1, Jennifer R. Davies1, Kathryn E. White2, Phillip P. Nicols2, Michael E. Boulton1,3 and Marcela Votruba1,4,*

1 School of Optometry and Vision Sciences, Cardiff University, Cardiff, UK, 2 Neurology, Medical School, Newcastle upon Tyne, UK, 3 Department of Ophthalmology and Visual Sciences, University of Texas Medical Branch, Galveston, TX, USA and 4 Cardiff Eye Unit, University Hospital Wales, Cardiff, UK

* To whom correspondence should be addressed at: School of Optometry and Vision Sciences, Redwood Building, King Edward VII Avenue, Cathays Park, Cardiff University, Cardiff CF10 3NB, UK. Tel: +44 2920870134; Fax: +44 2920874859; Email: votrubam{at}cardiff.ac.uk

Received December 11, 2006; Revised February 5, 2007; Accepted March 21, 2007


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
OPA1 is a ubiquitously expressed, nuclear dynamin-related GTPase, targeted to the inner mitochondrial membrane, which plays a role in mitochondrial fusion. Mutations in the OPA1 gene on chromosome 3q28-qter are associated with autosomal dominant optic atrophy (ADOA), the most common inherited optic neuropathy, in which retinal ganglion cells (RGCs) are lost and visual acuity is impaired from an early age. We have generated a novel ENU-induced mutant mouse carrying a protein-truncating nonsense mutation in opa1 in order to explore the pathophysiology of ADOA. The heterozygous mutation, B6; C3-Opa1Q285STOP, located in exon 8 immediately before the central dynamin-GTPase, leads to ~50% reduction in opa1 protein in retina and all tissues on western analysis. The homozygous mutation is embryonic lethal by 13.5 days post coitum, demonstrating the importance of Opa1 during early development. Fibroblasts taken from adult heterozygous mutant mice show an apparent alteration in morphology, with an increase in mitochondrial fission and fragmentation. Heterozygous mutants show a slow onset of degeneration in the optic nerve electron microscopy. Furthermore, they demonstrate a functional reduction in visual function on testing with the optokinetic drum and the circadian running wheel. These findings indicate that the opa1 GTPase contains crucial information required for the survival of RGCs and that Opa1 is essential for early embryonic survival. The Opa1 +/– mice described here provide a means to directly investigate the cellular pathophysiology of OPA1 ADOA.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Autosomal dominant optic atrophy (ADOA) (1) is the most common form of primary inherited optic neuropathy, affecting approximately 1:12 000 to 1:50 000 individuals and manifesting with insidious onset in early childhood (2,3). It is characterized by a mild-to-moderate progressive loss of visual acuity, colour vision defects, central visual field defects and temporal optic disc pallor (1,4,5). The fundamental pathology of the disease is a loss of retinal ganglion cells (RGCs), particularly those of the papillomacular bundle, followed by ascending atrophy of the optic nerve and loss of optic nerve myelin (4,6). Several genetic loci have been implicated in ADOA, including the major locus OPA1 (MIM165500, 3q28–q29) (7,8), OPA4 (MIM605293, 18q12.2–q12.3) (9), OPA5 (22q12.1–q13.1) (10) and OPA3 (MIM165300, 19q13.2.2–q13.3, which is also associated with cataract) (11,12). The OPA1 gene encodes a 960 amino acid mitochondrial dynamin-related guanosine triphosphatase (GTPase) (7,8). The protein contains a mitochondrial leader sequence within the highly basic N-terminal targeting the protein to the outer surface of the mitochondrial inner membrane, a GTPase domain, a central dynamin domain that is conserved across all dynamins and a carboxy terminus of unknown function. Over 117 mutations are reported to date, the majority of which arise in the GTPase and dynamin central regions, coded by exons 8–16, and in the C-terminal coding region, exons 27–28 (1315). Approximately 50% of these mutations cause premature truncation of the OPA1 protein (http://lbbma.univ-angers.fr/lbbma://lbbma.univ-angers.fr/lbbma), and thus the functional loss of one allele, causing putative haploinsuffiency of OPA1 (16).

OPA1, one of a growing family of proteins involved in mitochondrial homeostasis, is associated with regulation of mitochondrial fusion and sequestration of cytochrome c in the mitochondria. It has been demonstrated in a number of cell types that down-regulation of OPA1 with siRNA leads to gross morphological changes in mitochondrial shape, increased fragmentation of the mitochondrial network, dissipation of the mitochondrial membrane potential, disorganization of the mitochondrial cristae and release of cytochrome c followed by caspase-dependent apoptotic nuclear events and a block in mitochondrial fusion (1721). Other mitochondrial shaping proteins function with OPA1 to maintain the dynamic control of mitochondrial morphology (22). These proteins include pro-fusion GTPases: mitofusin (Mfn) 1 and 2; and pro-fission GTPases: dynamin related protein 1 (Drp1) and Fis 1 (17,23). OPA1 and Mfn 1 are proposed to have a protective role within the cell (22), acting as anti-apoptotic GTPases. They protect the cell from spontaneous apoptosis and the detrimental consequences of apoptotic stimuli.

It remains unclear why OPA1 ADOA manifests with an apparently restricted clinical ocular phenotype, comprising RGC loss. OPA1 is ubiquitously expressed throughout the body: in the heart, skeletal muscle, liver, testis and most abundantly in the brain and retina (7). In the human retina, OPA1 is present in the cells of the RGC layer, nerve fibre layer, the photoreceptor layer and the inner and outer plexiform layers (IPL and OPL, respectively) (24). In the mammalian retina, it appears that Opa1 is present in the RGCs, amacrine cells, horizontal cells, IPL and OPL (2426), although Opa1 expression in the mammalian amacrine and horizontal cells and its exact expression profile within the optic nerve remains to be clarified (24,25).

In order to address many of the unanswered questions relating to the molecular and cellular pathophysiology of OPA1 ADOA and to develop systems for testing RGC rescue, we generated a mouse model by screening a mouse DNA ENU-mutagenized panel (27) for Opa1 point mutations and deriving an Opa1 mutant carrying a nonsense mutation which is protein truncating. We found that homozygous inactivation of Opa1 leads to early embryonic lethality, demonstrating an important role for Opa1 during mouse development. Mutant fibroblasts taken from Opa1 +/– muscle show increased mitochondrial fission when compared with cells from wild-type littermates. In heterozygous Opa1 +/– mice, we describe structural anomalies in myelination of the optic nerve in mutant mice. Heterozygous mutant mice for Opa1 also display functional visual abnormality. Our findings confirm that this is a valuable and useful model and cast light on visual dysfunction in OPA1 ADOA.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Generation of Opa1 mutant mice: the Q285X protein-truncating mutation
An ENU mutagenized DNA archive from 10 000 C3H male mice was screened for point mutations in Opa1 exons 1, 8, 9, 10, 12 and 28, using heteroduplex analysis by temperature gradient capillary electrophoresis (TGCE: Spectu Medix), run at two temperatures: 55–60°C and 60–70°C (Ingenium, SA). Positive fragments were sequenced and five SNPs were found, one of which was a heterozygous nonsense mutation in exon 8 coding for a C–T transition at 1051 bp (Fig. 1A and B). This mutation is predicted to cause protein truncation (Gln 285 to Stop: Q285X) at the start of exon 8, which represents the beginning of the dynamin GTPase, a domain where many human disease causing mutations cluster. Our mutation causes protein truncation approximately one-third of the way through the protein, close to human disease causing mutations at amino acid 290: R290W and R290Q (c.868C > T and c.869G > T). Sperm were used (IVF with C57Bl/6J females) to generate heterozygous hybrid Opa1 +/– ‘founders’ (the B6; C3-Opa1Q285X mouse line). All procedures complied with local ethical, national and international regulatory bodies.


Figure 1
View larger version (67K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. The Q285X mutation of Opa1. (A) DNA sequence chromatogram of B6;C3-Opa1Q285STOP Opa1 +/– mutant compared with Opa1 +/+ control, illustrating the exon 8 C–T transition at 1051 bp. (B) Mouse genomic sequence showing C–T transition at 1051 bp, which leads to Q285 STOP. (C) PCR allele-specific genotyping for Opa1 for a selection of Opa1 +/– and Opa1 +/+ mice. Both wild-type and mutant fragments are 160 bp and are resolved on 2% agarose. (D) Mouse genotyping for a selection of Rd1 +/+ and Rd1 +/– mice by multiplex PCR for Rd1 alleles. The wild-type fragment is 300 bp and the mutant allele is 450 bp. (E) RT–PCR from retinal cDNA extracted from a selection of Opa1 +/+ and Opa1 +/– mice and resolved on 3% agarose using primers F3 and R8/9. Three isoforms are shown (see text). (F) RT–PCR on retinal cDNA using primers F3 and R5 and R5b.

 
Effects of Opa1 +/– mutation on transcription and translation
The mouse Opa1 gene consists of 31 exons spanning more than 100 kb of genomic DNA, with 28 constitutive exons and three (exons 4, 4b and 5b) that are alternatively spliced in mouse and man. To evaluate how the Opa1 mutant gene is transcribed, RNA was extracted from Opa1 +/– mutant and control mice and converted to cDNA for PCR analysis from a range of tissues including brain, retina, heart, skeletal muscle, liver, kidney and spleen (data not shown). Opa1 transcripts were detected in Opa1 +/+ and Opa1 +/– mouse retinas with F3 and R8/9 primers. Three Opa1 isoforms were identified in wild-type and mutant mouse retina on 3% agarose gel electrophoresis: the predominant isoform 1 (deletion exon 4b and 5b), isoform 7 (deletion exon 4b) and isoform 8 (full transcript), which correspond to published findings from human and normal mouse retina (Fig. 1E). RT–PCR with F3 and reverse primers R5 and R5b show that exon 5b is present in the retina of both wild-type and heterozygous mutants, but exon 4b is only very weakly represented in both (Figure 1F.) Transcript size is not affected by the Opa1 +/– mutation.

To investigate whether the nonsense mutation Q285STOP causes a decrease in Opa1 protein to ~50% as predicted, we performed western blot analysis across a wide range of mouse tissues (Fig. 2A). The antibody was raised against the C-terminal of Opa1 and recognizes native Opa1 in mouse. The results showed that the level of Opa1 protein was significantly reduced in all tissues of Opa1 +/– mice (by a mean of ~60% Fig. 2B). A major band of ~90 kDa was detected in all protein extracts from retina, brain, heart, liver, skeletal muscle and spleen and from RGC5 cells (which were used as a positive control) from both Opa1 +/– and Opa1 ++ mice (Fig. 2A). Secondary bands at ~50 and 65 kDa were present in many of the tissues (particularly brain, heart, kidney and spleen), except retina, as in previous studies (7,8,25,28), possibly representing polyadenylation or protein processing.


Figure 2
View larger version (40K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. Western blot showing expression of the OPA1 protein in a panel of tissues taken from Opa1 +/– and Opa1 ++ mouse using the monoclonal anti-OPA1 antibody (BD Biosciences). (A) Protein extracts from retina, brain, heart and liver, kidney, skeletal muscle, spleen and RGC-5 cells. Equal loading was assessed by ß-actin expression, and RGC-5 cells were used as an internal control for Opa1. An ~100/90 KDa band was observed in all tissues and cells. A smaller band of ~65 KDa was also detected in all of the tissues except the retina and the RGC-5 cells. (B) Graph illustrating mean percentage ratio of Opa1 +/– protein extract to Opa1 +/+ protein extract. Data represent densitometric value of protein band, mean ± SEM of six readings. An ~50% reduction in OPA1 protein was seen in all Opa1 +/– samples compared with littermate controls.

 
Early embryonic lethality in nullizygous Opa1 mice
Animals heterozygous for Opa1 are viable and fertile. However, Opa1 +/– inter-crosses in three lines of mice did not yield any Opa1 –/– live progeny (Table 1.) The complete absence of nullizygous mutants, the wild-type to heterozygous progeny ratio of approximately 1:2, and the small mean litter size of Opa1+/– inter-crosses (mean 7.67 versus mean 9.44 for out-crosses) suggested that homozygosity for Opa1 null mutation resulted in embryonic lethality.


View this table:
[in this window]
[in a new window]

 
Table 1. Obtained and predicted percentages of genotypes from out-cross (N = 369) and inter-cross (N = 799) mouse matings

 
To determine the stage of embryonic lethality, timed matings were set up and pregnant females from matings between heterozygous (+/–) mice were sacrificed between 7.5 days post coitum (dpc) and 14.5 dpc (Fig. 3). The embryos were dissected and genotyped. No homozygotes (–/–) were found at 13.5 dpc and decidual vacuity was observed in all litters dissected at 13.5 dpc and 14.5 dpc. However, homozygotes were observed in litters at 11 dpc, although by this stage they were considerably smaller than littermate controls (Fig. 3F), displayed growth retardation and demonstrated gross morphological abnormalities (Fig. 3E). All morphologically normal embryos at all time points dissected were wild-type or heterzygote; however, the heterozygote embryos did show a variable phenotype which ranged from normal to growth retardation and forebrain truncation Fig. 3C). Some of the heterzygotes also showed signs of being absorbed (Fig. 3C).


Figure 3
View larger version (90K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3. Morphology and genotyping of normal and abnormal embryos taken at 9.5 dpc and 11 dpc. (A,B,C and D) are all embryos from the same 9.5 dpc litter. (A) is a 8.5 dpc staged homozygote littermate. (B) A normal wild-type littermate. (C) is an 8.5 dpc heterozygote littermate that looks to be undergoing absorption. (D) is an 8.0 dpc staged littermate that has failed to turn and has an open neural tube. (E) is a homozygote from an 11 dpc litter and (F) is its wild-type littermate.

 
One embryo (Fig. 3D) was of particular interest as it had a severe abnormal phenotype; however, difficulties with genotyping prevented us from verifying its homozygous status. This embryo was smaller than its littermate control (Fig. 3B), had 14 somites and displayed an almost completely open neural tube. In a 15–20 somite embryo, the anterior neuropore is completely closed and can be seen almost closed in (Fig. 3A and C). Furthermore, this embryo should have almost completed the process of turning from lordotic to foetal position as observed in (Fig. 3A and C).

In an 11 dpc litter, a homozygote embryo (Fig. 3E) was identified that had failed to turn embryonically, but also exhibited a severe reduction in the anterior forebrain tissue compared with its littermate control (Fig. 3F); a phenotype regularly observed in heterozygote and homozygote 8–11.5 dpc embryos.

Mitochondrial fragmentation in Opa1+/– muscle explants
To assess mitochondrial fusion defects as previously described in opa1 knockdown experiments in vitro (29), we assessed mitochondrial morphology in cells from two 3-month wild-type and heterozygous mutant mice. The morphology of the cells grown from muscle explants was classified into two categories. Category I cells displayed a normal network of mitochondria that surrounded the central nucleus. Category II cells displayed punctuated and completely dispersed mitochondria throughout the cytosol and nucleus, giving a distinct abnormal ‘powdered’ appearance. Cells from the Opa1+/+ mouse displayed predominantly category I type morphology (Fig. 4A) and cells from the Opa1+/– mouse displayed mainly category II type morphology (Fig. 4B). In three experiments, the distinction between wild-type and mutant cell morphology was striking under normal culture conditions (Fig. 4C).


Figure 4
View larger version (29K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4. Mitotraker CMXRos staining of cells grown from muscle explants. (A) Representative cell stained with Mitotraker CMXRos (100 nM) from Opa1+/+ mouse. This cell displays a network of mitochondria consisting of a combination of punctuated and tubular mitochondria that surround the cytosol and the central nucleus (category I). (B) Representative cell stained with Mitotraker CMXRos (100 nM) from Opa1+/– mouse. This cell displays punctuated completely dispersed mitochondria throughout the cytosol and nucleus giving a distinct ‘powdered’ appearance (category II). (C) Graph illustrating the mean percentage of cells displaying either category I or category II type morphology from the Opa1+/+ and Opa1+/– mice, mean ± SEM from three experiments. Opa1+/– mice display more cells with category II morphology compared with the Opa1+/+ controls who display more cells with category I morphology. Bar = 25 µm.

 
Morphological changes in optic nerve
No gross histopathological differences were observed between the organs and tissues of 6-month-old Opa1+/– mice compared with Opa1+/+ mice. In particular, brain, cardiac and skeletal muscle all appeared normal on haematoxylin and eosin (H&E) and specific staining (data not shown). Retinal morphology appeared grossly normal in the 6-month-old Opa1+/– mice Fig. 5A and B. The different cellular layers of the retina stained with a panel of markers for the retinal cell types (Tuj 1, Calbindin, Calretinin, ChAT, Rhodopsin and OPA1) were indistinguishable from that of littermate controls (data not shown). Statistical analysis using T-test showed that at 6 months of age RGC counts on H&E stained retinal sections were not statistically different between the Opa1+/– and littermate controls, P > 0.05 (Fig. 5C).


Figure 5
View larger version (67K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5. Analysis of the RGC layer of Opa1+/– mutant compared with Opa1+/+ control. Retinal sections were stained with haematoxylin and eosin (H&E). (A) Representative H&E retinal section from an Opa1+/– mouse. (B) Representative H&E retinal section from an Opa1+/+ mouse. The Opa1+/– mice display equivalent RGC counts compared with littermate controls. O/N, optic nerve; OS, outer segments; IS, inner segments; ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer; RGC, retinal ganglion cell layer. (C) Graph showing the mean ± SEM RGC count from 10 retinal sections taken from either side of the optic nerve from 5–6-month-old Opa1+/+ (N = 8) and Opa1+/– (N = 6) mice. Bar = 100 µm.

 
On electron microscopy no significant abnormalities were observed in optic nerve sections taken from 6-month-old Opa1+/– mice (Fig. 6A and B). However, by 9 months of age and at 18 months, significant abnormalities were observed in the myelin bundles and optic nerve fascicles of the Opa1+/– mice (Fig. 6C–F). These changes appear as gross whirls of myelin forming large abnormal forms in multiple areas of the optic nerve, alongside a noticeable loss of myelination in other nerve fibre bundles.


Figure 6
View larger version (120K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 6. Transmission electron micrographs of optic nerve taken from 5–6-month-old Opa1 +/+ (A) and opa1 +/– (B), 9-month-old Opa1 +/+ (C) and Opa1 +/– (D), 15-month-old C57Bl/6Jcrl (E) and 18-month-old Opa1+/– (F) mice. The optic nerves appear comparable at 6 months of age between genotypes; however, by 9 months of age, anomalies, shown by black arrows, identified as whirls of myelin, were observed in the optic nerves of the Opa1 +/– mice, which continued to 18 months of age. Bar = 2 µm.

 
Neurological defects and functional vision anomalies
Since OPA1 is ubiquitously expressed throughout the body (7), the OPA1 mutation may be predicted to have an effect on other tissues besides the retina, in particular, neuromuscular tissue. We therefore carried out a basic neurological examination on wild-type and Opa1+/– mice before they undertook visual acuity testing using an optokinetic drum test. The primary SHIRPA screen allows observational assessment of 37 different general health and neurological measures. In the 6-month-old Opa1+/– mice there was no significant effect of genotype on 34 of the separate behavioural measures. However, three tests showed abnormal results. There was a significant effect of genotype on transfer arousal from the viewing jar to the open field arena U (19,19) = 85.5, P < 0.05. Opa1+/– mice froze for a longer period in the arena, with a median score of 3 (brief freeze then active movement) compared with a median score of 4 (momentary freeze then swift movement) displayed by littermate controls. There was a significant effect of genotype on the locomotor activity in the arena, U (19,19) = 100.5, P < 0.05; the Opa1+/– mice were less active than littermate controls (Fig. 7). There was also a significant effect of genotype in terms of provoked biting displayed, U (19,19) = 133, P < 0.05. More Opa1+/+ animals displayed provoked biting compared with the littermate controls. Finally, all the mice had normal hearing as tested by the MRC standard click box.


Figure 7
View larger version (10K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 7. Performance on the SHIRPA primary screen. Graph showing 6 month Opa1+/– (N = 19) and littermate controls Opa1+/+ (N = 19) mean locomotor activity ± SEM. The Opa1+/– mice display less locomotor activity than controls. *P < 0.05.

 
Examination of the eye was carried out on the slit lamp and by indirect ophthalmoscopy. No significant retinal pathology was identified by dilated fundal examination or by indirect ophthalmoscopy in Opa1+/– mice. Their fundus appeared similar to the Opa1+/+ littermate controls at 6 months of age and there was no evidence of retinal degeneration, which is compatible with findings in patients with ADOA, in whom the only abnormality is the colour of the optic disc. However, one of the key clinical characteristics of patients suffering ADOA is a progressive loss of visual acuity and a highly variable, and often very mild, phenotype. For this reason, we sought to examine the visual acuity of the Opa1+/– mutant mice at 6 and 12 months of age. Sighted C57Bl/6JCrl mice, which were capable of tracking the moving acuity square wave gratings of all frequencies (defined as at least one head tracking movement in the same direction and speed as the drum), and non-sighted C3H mice, who failed to track any of these gratings, confirmed the validity and sensitivity of our test (data not shown) (30). Opa1+/– mice at 6 and 12 months of age demonstrated tracking of all three square wave gratings, indicating that they are not functionally totally blind (Fig. 8A and B). No main effect of genotype or grating was observed at 6 months of age, P > 0.05. However, by 12 months of age, the Opa1+/– mice tracked all three gratings less often than littermate controls (Fig. 8B). Analysis of the time spent tracking across the whole 2 min test period showed that by 12 months there was a significant main effect of genotype F (1,33) = 14.99, P < 0.0001, but no main effect of grating P > 0.05. This demonstrates an across the board reduction in acuity which was significant between Opa1+/+ and Opa1+/– mice.


Figure 8
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 8. Performance on the optokinetic visual screening test and the circadian running wheel screening test. (A) Mean time spent tracking a moving 2°, 4° and 8° grating on the optokinetic drum at 6 months of age, Opa1+/+ (N = 19) and Opa1+/– (N = 19), and at (B) 12 months of age, Opa1+/+ (N = 19) and Opa1+/– (N = 16). The Opa1+/– mice display comparable level of tracking for all three gratings at 6 months of age compared with littermate controls; however, by 12 months of age they track all three gratings less often. (C) 12-month-old Opa1+/– (N = 16) and littermate control Opa1+/+ (N = 19) mean activity ± SEM on the running wheel at baseline and during a 1 h presentation of a light source (test). The Opa1+/– mice fail to cease their running wheel activity during the presentation of a light source compared with littermate controls, who stop their activity. *P < 0.05.

 
A second test, to explore visual function, and in particular RGC loss, used standard mouse running wheels in home cages and the presentation of a light source at night. Mice display considerable nocturnal activity. If a mouse has good visual function and detects the onset of a light source during the night, it will halt all activity, including running wheel activity. However, if a mouse has poor visual function due to loss of photosensitive melanopsin-containing RGCs, and is unable to see the light source, it will continue its running wheel activity. In our experiments, the 12-month-old Opa1+/+ control mice stopped their running wheel activity during the presentation of the light as expected; however, the Opa1+/– continued their running wheel activity, indicating that they had not seen or detected the onset of the light. This pattern of results was confirmed as statistically significant. Comparison of test period activity between the two genotypes using Mann–Whitney U revealed a significant difference in activity U (19,16) = 93.00, P = 0.043 (indicated by the asterisks in Fig. 8C), whereas no significant difference in activity was revealed for the baseline scores U (19,16) = 142.00, P = 0.74.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In this study, we describe for the first time the generation and characterization of a novel ENU-induced mouse model of ADOA. The Opa1+/– mice exhibited abnormal mitochondrial morphology, optic nerve anomalies in myelination and structure and evidence of impaired visual functions. Opa1 homozygous mutant mice display early embryonic lethality.

The mutation in our mouse model truncates the Opa1 protein immediately prior to the dynamin-related GTPase central domain, approximately one-third of the way through the protein. We have demonstrated a ~50% reduction in Opa1 protein expression in the Opa1+/– mice. In the heterozygous state, this is proposed to lead to haploinsufficiency. The loss of one allele may decrease the amount of OPA1 below a critical threshold for normal function and may thus compromise RGC survival. Neurons, in particular, owing to their rapid high-energy demands, appear to be particularly susceptible to changes in mitochondrial function (31). The OPA1 protein may have different functions in the mitochondria of different tissues, particularly as the eight mRNA splice isoforms are differentially expressed (32). Haploinsufficiency may also increase tissue susceptibility to physiologically present and biologically relevant apoptotic stimuli, such as daily exposure to blue light and reactive oxygen species (33).

The mutation we have modelled lies within 5 bp of a reported human protein-truncating mutation (c.869G > T, p.R290Q) which causes ADOA (13). Exon 8 contains at least one other reported nonsense mutation and six missense mutations. Together with exon 9, exon 8 is the exon with the highest number of human disease causing mutations reported (http://lbbma.univ-angers.fr/lbbma://lbbma.univ-angers.fr/lbbma). Over 65% of OPA1 mutations are substitutions and 66% affect the dynamin central GTPase domain, suggesting that this is an important functional domain. Moreover, this domain is the most highly conserved domain of OPA1 (7). This data leads us to conclude that we have generated a mutant with an appropriately placed mutation, which mirrors human disease mutation in both position and profile, and emphasizes the major importance of the GTPase in Opa1 function.

In the homozygous state, our mutation is likely to result in complete loss of normal Opa1 function, thus creating a ‘knockout’. The early embryonic lethality of homozygous mutant mice that we report indicates that Opa1 is an essential protein in mammalian development. Humans with OPA1 mutations in ADOA are heterozygous, and thus have at least one functional allele. A compound heterozygous patient (26) has been reported with a more severe phenotype than that which is usual for ADOA. It is not possible to say if homozygous mutation in human OPA1 leads to early miscarriage or significant fetal loss, or if two protein-truncating point mutations might cause early embryonic lethality, as this scenario is very unlikely to occur in human populations and may not have been ascertained yet. Unlike mice, humans may also have other complex compensatory mechanisms. Similar discrepancies between human dominant disease and homozygous null mouse mutants have been reported for the Friedreich ataxia mouse (34) and the spinal and muscular atrophy model (35). Knockout of other mitochondrial shaping proteins, such as Mfn1 and 2, has led to similar findings of embryonic lethality (36). Analysis of Mfn1 and Mfn2 knockout mice demonstrated that they die in midgestation, which is similar to Opa1 homozygous mutant mice described here. By 9.5 dpc, the Opa1–/– mutant embryos were immature, growth retarded and found to be abnormal and by 14.5 dpc no homozygote mutant embryos were evident. Reabsorption of the Opa1–/– mutant embryos makes them difficult to analyse. It particularly hampers the determination of genotype in parallel with morphological analysis.

OPA1 is ubiquitously expressed within the body. Clinical evidence (37) demonstrates a widespread, sub-clinical phenotype for patients with OPA1 mutations, which is highly supportive of the widely distributed defect in mitochondria. However, it is true that neurons demonstrate an overt phenotype, and this is a central question in the pathophysiology of ADOA which needs to be answered by future studies. Nonetheless, our finding of increased mitochondrial fragmentation in cells from Opa1+/– mice is of significance, given the functional role of Opa1 in mitochondrial fusion. Previous OPA1 expression knockdown studies using small interfering (si) RNA to reduce OPA1 expression in various cell lines (including non-retinal, retinal and primary RGC lines) have shown that a loss of OPA1 results in gross morphological changes, fragmentation of the mitochondrial network and a block in mitochondrial fusion (1820,29,38). In agreement with these studies,s we show here that cells from our mutant Opa1+/– mice, who demonstrate a ~50% reduction in Opa1 protein expression, also display significant fragmentation of the mitochondrial network.

More recent studies have shown that OPA1 processing takes place in the matrix. This processing is important for the regulation of the mitochondrial morphology, such that when activated by dissipation of the mitochondrial membrane or by proapoptotic stimuli, mitochondrial fragmentation arises; conversely, inhibition of this processing leads to an extension of the mitochondrial tubular network (39). Independent of its capacity as a profusion protein, OPA1 also protects cells from apoptosis by preventing cytochrome c release and controlling the shape of mitochondrial cristae (40,41). In support of this work, examination of opa1 splice variants has revealed a functional role of exon 4 in the maintenance of mitochondrial membrane and fusion of the mitochondrial network, whereas exon 4b and 5b are involved in cytochrome c release (42). With the generation of our mutant mouse B6;C3-Opa1Q285STOP model, it will be possible to examine mouse embryonic fibroblasts from our Opa1+/– and opa1–/– mice to examine these two functional roles of OPA1 in more depth.

The disease phenotype and RGC loss in human ADOA due to pathological mutations in OPA1 is highly variable, with a wide range of visual acuities seen in patients and with considerable variation in disease progression with age. Some individuals have near-normal visual acuities of 6/9 (5), whereas others are registered blind due to their poor vision. Ageing effects, as well as the effects of physiologically relevant stressors, such as light and intra-ocular pressure, may have important roles in the full manifestation of the phenotype. The mild phenotype of our heterozygous model, and the increased manifestation of anomalies with age, is therefore, not surprising. Furthermore, the presence of gross optic atrophy in human patients is by far from universal. Indeed, we have reported that one-third of individuals have subtle temporal pallor (5). The detection of optic atrophy in the mouse eye is a notoriously difficult clinical finding, since the mouse optic disc is considerably smaller in proportion to the retina than in the human, and the architecture of the disc is different, with the absence of a cribriform plate. Loss of optic nerve myelination and changes in optic nerve fibre bundles have been reported in human eyes with ADOA (4), paralleling our own findings of abnormal myelination and loss of myelin in the Opa1+/– mouse. An absence of extensive RGC loss at an age when optic nerve structure anomalies arise is consistent with reports from other diseases that neurodegeneration is a secondary consequence to, and often arises considerably later than, axonal impairments (43,44). However, we have no evidence that the primary defect is in the myelin sheath of the optic nerve. Indeed, our findings of demyelination in the optic nerve in old animals is in line with published findings (4,6) on human cases of ADOA in whom optic nerve pathology was available. Demyelination in the optic nerve was observed in these patients. A loss of photosensitive melanopsin RGCs would be predicted to result in the loss of the ability to maintain entrainment of circadian rhythmicity (45,46). This effect is demonstrated by the statistically significant loss of normal responses on the circadian running wheel seen in our animals.

Few patients with ADOA present clinically apparent systemic neurological symptoms or signs, with the exception of hearing loss associated with the R455H OPA1 mutation (47,48). Hearing in our Opa1+/– mice was normal. Patients with OPA1 ADOA who have been examined by magnetic resonance spectroscopy (P31) have been found to have post-exercise muscle changes in levels of ATP usage and generation. (37). In our SHIRPA neurological assessment, we detected reduced locomotor activity, which may reflect early changes in neurological function and is worthy of further investigation.

In summary, we describe the mutant mouse B6;C3-Opa1Q285STOP, which displays mitochondrial dysfunction, optic nerve anomalies and visual deficits. This novel mouse model will be a valuable tool, providing a means to directly investigate the pathophysiology of ADOA and the functional role of Opa1 in vivo. Future work will focus on mitochondrial dynamics and morphology.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Genotype analysis
Genomic DNA was prepared from mouse tail tips, yolk sacs and embryos. Opa1 allele-specific PCR genotyping was carried out in separate reactions to distinguish wild-type and mutant alleles using a common forward primer (F1: 5'- CTCTTCATGTATCTGTGGTC-3') and two reverse primers specific for the wild-type (R Wt: 5' TTACCCGTGGTAGGTGATCATG-3') and mutant (R Mut: 5'-TTACCCGTGGTAGGTGATCATA-3') Opa1 alleles (Fig. 1C). The PCR products were 160 bp for both alleles and were distinguished on separate agarose gels by electrophoresis. Rd1 genotyping was carried out as a multiplex reaction, with the following three primers in equal combination: RD3: 5'-TGACAATTACTCCTTTTCCCTCAGTCTGA-3', RD4: 5'-GTAAACAGCAAGAGGCTTTATTGGGAAC-3' and RD6: 5'-TACCCACCCTTCCTAATTTTTCTCAGC-3' (49,50). The wild-type Rd1 allele was 300 bp and the mutant allele was 450 bp (Fig. 1D).

PCR amplification for both genotypes was performed in 25 µl reactions containing 0.2 µg genomic DNA, 20 pmol of forward and reverse primers, 10 mM Tris–HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 200 µM of each dNTP and 1U of Taq DNA polymerase (Bioline). Cycling conditions were 35 cycles with the following steps: 95 for 30 s, 55 for 30 s, 72 for 30 s in a Techne PCR machine. PCR fragments were separated by electrophoresis on 2% agarose gels.

Breeding strategy and embryo analysis
Opa1 and rd1 allele-specific PCR genotyping was used to direct breeding with wild-type C57Bl/6JCrl mice and the removal of the rd1 allele of pdeB (carried by the C3H paternal line) was thus ensured within one generation. Opa1+/– ‘founder’ mice were crossed with C57Bl/6JCrl mice (Charles River, UK) to move the mutation to a C57Bl/6JCrl background. This was continued at G2 to (currently) G4. Opa1+/– F1 and F2 mice were inter-crossed to obtain homozygous Opa1–/– mice: equivalent to ‘knockouts’ for further immediate analysis. All Opa1+/– and Opa1+/+ mice tested were homozygous wild-type for the rdl allele.

Opa1+/– were inter-crossed to obtain Opa1–/– embryos. Matings were assumed to take place at midnight, and the day of plug detection until the following midnight was designated 0.5 dpc. Embryos were dissected daily from pregnant dams at 6.5 dpc through to 14.5 dpc. Whole embryos were observed and photographed using a dissecting microscope. Depending on the size of the embryo, tissue for genotyping was taken from either the tail or embryo yolk sac, before treatment with proteinase K and genotyping by PCR. Whole litters were genotyped in order to identify homozygous Opa1–/– mice.

RT–PCR and western blot analysis
Total RNA was isolated from 6-month-old mouse retina from three wild-type and three mutant animals with RNeasy Mini (Qiagen). 1.4 µg was loaded onto a formamide gel to check for RNA quality and cDNA was synthesized (Bioline). The mouse Opa1 cDNA was reconstructed to include the variably spliced exons 4, 4b and 5b, checked by BLAST and used to design primers by Primner3 PCR primer picking program (http://www-genome.wi.mit.edu/cgi-bin/ptimer/primer3_www.cgi://). The primers spanned from exon 3 to exon 8/9: F3: AAGTGGATTGTGCCTGACTTT and R8/9: CAACCCGTGGTAGGTGATCT. In order to discriminate the presence of exon 4b further, a second pair of reverse primers was designed: R5: GCTCGAAATGCTGTTTCTCC positioned in exon 5 and R5b: GCTTCTGTTGGGCATAGCTC positioned in exon 5b, and used with the forward primer above F3. For analysis of Opa1 protein tissue lysates were homogenized in lysis buffer, quantified using a modified Lowry protein assay kit and loaded into the gel system using Laemelli buffer at 20 µg total protein. The proteins were separated by 12% SDS–PAGE for 45 min at 200 V, and after 1 h, were transferred to a 0.2 µm nitrocellulose membrane (100 V, 450 mA). Membranes were blocked for 1 h with 5% milk, and probed with either monoclonal mouse anti-Opa1 (1:1000 dilution; BD Biosciences, UK) or monoclonal mouse anti-ß-actin (1:5000 dilution; Sigma, UK) primary antibody and then goat anti-mouse HRP secondary antibody (1:10 000 dilution; Jackson ImmunoResearch Laboratories). The analysis of protein expression was undertaken in six different mouse tissues taken from a 3-month-old Opa1+/– mouse and a littermate wild-type control, including retina, brain, heart, liver, skeletal muscle and spleen. Protein extract from RGC-5 cells acted as an internal positive control for Opa1 expression (38). Densitometry on the bands was carried out on three occasions and a mean value recorded.

Muscle fibroblast culture
Muscle was removed from two 3-month-old Opa1+/– mice and two littermate controls, minced into 2 mm pieces and cultured in 6-well plates (Triple Red, UK). The explants were cultured in DMEM (Sigma, UK) supplemented with 10% fetal bovine serum (FBS; BioSera, UK), 4 mM L-glutamine (Invitogen, UK), 1% penicillin/streptomycin (Sigma, UK) and 1% fungizone (Invitrogen, UK) until cells were visible, at which point, the explants were removed. Cells were grown to 80% confluence in four well Lab-Tek chamber slides (Nunc, UK), incubated for 30 min in 100 mM Mitotraker Red CMXRos (Invitrogen, UK) at 37°C and then fixed at 4°C in 4% paraformaldehyde (Sigma, UK) for 30 min. Slides were mounted in non-fluorescing hydromount (National Diagnostics, UK) and cell morphology assessed under a Leica DM6000B upright confocal microscope. Images of cells from three experiments were taken and categorized for morphology.

Histology and electron microscopy
Eyes were enucleated from 9-month-old Opa1+/– (N = 6) and Opa1+/+ (N = 8) littermate control mice. The eyes were placed in 10% neutral buffered formaldehyde (NBF) for fixation at 4°C, dehydrated in graded ethanol series and embedded in paraffin wax (RA Lamb, Eastbourne, UK) for serial sectioning at 7 µm. Globe position was marked and orthogonal coronal sections were taken at 1 in 20 intervals and H&E stained in order to identify the optic nerve. Ten retinal sections either side of the optic nerve were then mounted and alternately stained with H&E. Images were taken of each section using a Leica DMR microscope and a Leica DC500 camera with Qwin software for manual RGC counts. Brain, heart, skeletal muscle, liver, kidney and spleen were taken from four 6-month-old Opa1+/– and four littermate controls, fixed in 10% NBF, embedded, sectioned and H&E and crestyl violet stained for histology.

For transmission electron microscopy, optic nerves from three 6-month-old Opa1+/– and three littermate controls, four 9-month-old Opa1+/– and four littermate controls and two 18-month-old Opa1+/– ‘founders’ and two 15-month-old C57Bl/6JCrl controls were fixed in strong fixative comprising 4% paraformaldehyde and 5% glutaraldehyde in cacodylate buffer. The tissue was then post-fixed in osmium tetroxide, dehydrated in acetone and embedded in epoxy resin. Ultra-thin sections were taken transversely through the optic nerve, stained with uranyl acetate and lead citrate and examined with a Philips CM1000 transmission electron microscope (Biomedical EM Unit, Newcastle University).

Clinical evaluation and functional visual testing
Mice were subjected to a slit lamp and retinal fundus examination. Subjects were 6–7-month-old Opa1+/– mice (N = 19) and littermate controls (N = 19). Mice were scruffed tightly and each pupil was dilated by placing a drop of 1% atropine (Minims) on the cornea. Anterior segments were examined on a Haag Streit slit lamp and the fundi were examined using indirect ophthalmoscopy (Keeler) and a Super 66D stereo fundus Volk indirect lens. Opa1+/– mice (N = 19) and littermate controls (N = 19) were tested at the age of 6–7 months of age on the Primary SHIRPA neurological examination screen. Mice were assessed on 37 separate screening tests that form part of the SHIRPA primary protocol, described elsewhere (51). This included tests of muscle tone, power and co-ordination as well as hearing, using a click box (90 bD and 18–20 kHz). Statistical analysis to assess any differences between groups was performed using parametric T-test or non-parametric Mann–Whitney U test, where appropriate.

Mice were tested on the optokinetic drum visual screening test to assess for visual loss at 6–7 months of age and then again at 12–13 months of age. For this second period of testing, only 16 Opa1+/– mice were assessed, as three of the original cohort had died of natural causes in the interim. Mice were tested on the optokinetic response test with the use of a rotating optokinetic drum. A digital video camera (JVC, GR-D250) linked to a monitor and a DVD recorder (Hitachi) were used to record the mouse movements (protocol described in detail elsewhere (30,52) (www.eumorphia.org/.eumorphia.org/). Briefly, mice were placed on the platform and allowed to settle for 2 min. The drum was rotated for 1 min and the mice were observed for a head tracking response. After a 30 s break, the drum was rotated in the opposite direction for 1 min. The mice were presented with a 2°, 4° and 8° grating (corresponding to 0.25, 0.125 and 0.0625 cycles/degree, respectively) on separate occasions, all at the same time of day. Statistical analysis using a mixed ANOVA design compared the performance of each group of animals over the three different gratings. To validate the protocol and technique in our hands, we first tested sighted C57Bl/6JCrl mice (N = 3) and non-sighted C3H (N = 3) mice on the optokinetic drum.

The same mice were tested for circadian activity on a running wheel apparatus. At least 24 h before testing began, mice were placed in individual cages containing standard mouse running wheels, that were digitally linked to computer software (AIID software, UK). Mice were on a normal controlled 12–12 h light–dark cycle. On day one, 3 h into the dark cycle, the number of wheel revolutions was recorded in 1 min bins for 1 h, this represented baseline activity. On day 2, 3 h into the dark cycle, a light (150 W halogen bulb) was presented to all cages for 1 h. The number of wheel revolutions was recorded in 1 min bins; this represented the test period activity (53). The baseline and test period activity was compared between genotypes and a non-parametric Mann–Whitney U test performed for statistical analysis.


    ACKNOWLEDGEMENTS
 
The authors thank Ingenium Pharmaceuticals for ENU mutagenesis and IVF, Ruby Grewal from Cardiff University for assistance with genotyping, Professor Neeraj Agarawal, University North Texas for RGC5 cells and Dr David Brownstein, the University of Edinburgh, for mouse organ histology. This work was funded by a grant from the Medical Research Council.

Conflict of Interest statement: none declared.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Kjer P. Infantile optic atrophy with dominant mode of inheritance: a clinical and genetic study of 19 Danish families. Acta Ophthalmol. Suppl. (1959) 164:1–147.[Medline]

  2. Kline L.B., Glaser J.S. Dominant optic atrophy. The clinical profile. Arch. Ophthalmol. (1979) 97:1680–1686.[Abstract]

  3. Votruba M., Moore A.T., Bhattacharya S.S. Clinical features, molecular genetics, and pathophysiology of dominant optic atrophy. J. Med. Genet. (1998) 35:793–800.[Abstract]

  4. Johnston P.B., Gaster R.N., Smith V.C., Tripathi R.C. A clinicopathologic study of autosomal dominant optic atrophy. Am. J. Ophthalmol. (1979) 88:868–875.[ISI][Medline]

  5. Votruba M., Fitzke F.W., Holder G.E., Carter A., Bhattacharya S.S., Moore A.T. Clinical features in affected individuals from 21 pedigrees with dominant optic atrophy. Arch. Ophthalmol. (1998) 116:351–358.[Abstract/Free Full Text]

  6. Kjer P., Jensen O.A., Klinken L. Histopathology of eye, optic nerve and brain in a case of dominant optic atrophy. Acta Ophthalmol. (Copenh) (1983) 61:300–312.[Medline]

  7. Alexander C., Votruba M., Pesch U.E., Thiselton D.L., Mayer S., Moore A., Rodriguez M., Kellner U., Leo-Kottler B., Auburger G., et al. OPA1, encoding a dynamin-related GTPase, is mutated in autosomal dominant optic atrophy linked to chromosome 3q28. Nat. Genet. (2000) 26:211–215.[CrossRef][ISI][Medline]

  8. Delettre C., Lenaers G., Griffoin J.M., Gigarel N., Lorenzo C., Belenguer P., Pelloquin L., Grosgeorge J., Turc-Carel C., Perret E., et al. Nuclear gene OPA1, encoding a mitochondrial dynamin-related protein, is mutated in dominant optic atrophy. Nat. Genet. (2000) 26:207–210.[CrossRef][ISI][Medline]

  9. Kerrison J.B., Arnould V.J., Ferraz Sallum J.M., Vagefi M.R., Barmada M.M., Li Y., Zhu D., Maumenee I.H. Genetic heterogeneity of dominant optic atrophy, Kjer type: identification of a second locus on chromosome 18q12.2-12.3. Arch. Ophthalmol. (1999) 117:805–810.[Abstract/Free Full Text]

  10. Barbet F., Hakiki S., Orssaud C., Gerber S., Perrault I., Hanein S., Ducroq D., Dufier J.L., Munnich A., Kaplan J., et al. A third locus for dominant optic atrophy on chromosome 22q. J. Med. Genet. (2005) 42:e1.[Free Full Text]

  11. Anikster Y., Kleta R., Shaag A., Gahl W.A., Elpeleg O. Type III 3-methylglutaconic aciduria (optic atrophy plus syndrome, or Costeff optic atrophy syndrome): identification of the OPA3 gene and its founder mutation in Iraqi Jews. Am. J. Hum. Genet. (2001) 69:1218–1224.[CrossRef][ISI][Medline]

  12. Reynier P., Amati-Bonneau P., Verny C., Olichon A., Simard G., Guichet A., Bonnemains C., Malecaze F., Malinge M.C., Pelletier J.B., et al. OPA3 gene mutations responsible for autosomal dominant optic atrophy and cataract. J. Med. Genet. (2004) 41:e110.[Free Full Text]

  13. Pesch U.E., Leo-Kottler B., Mayer S., Jurklies B., Kellner U., Apfelstedt-Sylla E., Zrenner E., Alexander C., Wissinger B. OPA1 mutations in patients with autosomal dominant optic atrophy and evidence for semi-dominant inheritance. Hum. Mol. Genet. (2001) 10:1359–1368.[Abstract/Free Full Text]

  14. Thiselton D.L., Alexander C., Morris A., Brooks S., Rosenberg T., Eiberg H., Kjer B., Kjer P., Bhattacharya S.S., Votruba M. A frameshift mutation in exon 28 of the OPA1 gene explains the high prevalence of dominant optic atrophy in the Danish population: evidence for a founder effect. Hum. Genet. (2001) 109:498–502.[CrossRef][ISI][Medline]

  15. Toomes C., Marchbank N.J., Mackey D.A., Craig J.E., Newbury-Ecob R.A., Bennett C.P., Vize C.J., Desai S.P., Black G.C., Patel N., et al. Spectrum, frequency and penetrance of OPA1 mutations in dominant optic atrophy. Hum. Mol. Genet. (2001) 10:1369–1378.[Abstract/Free Full Text]

  16. Marchbank N.J., Craig J.E., Leek J.P., Toohey M., Churchill A.J., Markham A.F., Mackey D.A., Toomes C., Inglehearn C.F. Deletion of the OPA1 gene in a dominant optic atrophy family: evidence that haploinsufficiency is the cause of disease. J. Med. Genet. (2002) 39:e47.[Free Full Text]

  17. Lee Y.J., Jeong S.Y., Karbowski M., Smith C.L., Youle R.J. Roles of the mammalian mitochondrial fission and fusion mediators Fis1, Drp1 and Opa1 in apoptosis. Mol. Biol. Cell (2004) 15:5001–5011.[Abstract/Free Full Text]

  18. Arnoult D., Grodet A., Lee Y.J., Estaquier J., Blackstone C. Release of OPA1 during apoptosis participates in the rapid and complete release of cytochrome c and subsequent mitochondrial fragmentation. J. Biol. Chem. (2005) 280:35742–35750.[Abstract/Free Full Text]

  19. Griparic L., van der Wel N.N., Orozco I.J., Peters P.J., van der Bliek A.M. Loss of the intermembrane space protein Mgm1/OPA1 induces swelling and localized constrictions along the lengths of mitochondria. J. Biol. Chem. (2004) 279:18792–18798.[Abstract/Free Full Text]

  20. Olichon A., Baricault L., Gas N., Guillou E., Valette A., Belenguer P., Lenaers G. Loss of OPA1 perturbates the mitochondrial inner membrane structure and integrity, leading to cytochrome c release and apoptosis. J. Biol. Chem. (2003) 278:7743–7746.[Abstract/Free Full Text]

  21. Cipolat S., Martins de Brito O., Dal Zilio B., Scorrano L. OPA1 requires mitofusin 1 to promote mitochondrial fusion. Proc. Natl Acad. Sci. USA (2004) 101:15927–15932.[Abstract/Free Full Text]

  22. Chen H., Chan D.C. Emerging functions of mammalian mitochondrial fusion and fission. Hum. Mol. Genet. (2005) 14(Spec no. 2):R283–R289.[Abstract/Free Full Text]

  23. Chen H., Chomyn A., Chan D.C. Disruption of fusion results in mitochondrial heterogeneity and dysfunction. J. Biol. Chem. (2005) 280:26185–26192.[Abstract/Free Full Text]

  24. Wang A.G., Fann M.J., Yu H.Y., Yen M.Y. OPA1 expression in the human retina and optic nerve. Exp. Eye Res. (2006) 83:1171–1178.[CrossRef][ISI][Medline]

  25. Aijaz S., Erskine L., Jeffery G., Bhattacharya S.S., Votruba M. Developmental expression profile of the optic atrophy gene product: OPA1 is not localized exclusively in the mammalian retinal ganglion cell layer. Invest. Ophthalmol. Vis. Sci. (2004) 45:1667–1673.[Abstract/Free Full Text]

  26. Pesch U.E., Fries J.E., Bette S., Kalbacher H., Wissinger B., Alexander C., Kohler K. OPA1, the disease gene for autosomal dominant optic atrophy, is specifically expressed in ganglion cells and intrinsic neurons of the retina. Invest. Ophthalmol. Vis. Sci. (2004) 45:4217–4225.[Abstract/Free Full Text]

  27. Augustin M., Sedlmeier R., Peters T., Huffstadt U., Kochmann E., Simon D., Schoniger M., Garke-Mayerthaler S., Laufs J., Mayhaus M., et al. Efficient and fast targeted production of murine models based on ENU mutagenesis. Mamm. Genome. (2005) 16:405–413.[CrossRef][ISI][Medline]

  28. Misaka T., Miyashita T., Kubo Y. Primary structure of a dynamin-related mouse mitochondrial GTPase and its distribution in brain, subcellular localization, and effect on mitochondrial morphology. J. Biol. Chem. (2002) 277:15834–15842.[Abstract/Free Full Text]

  29. Kamei S., Chen-Kuo-Chang M., Cazevieille C., Lenaers G., Olichon A., Belenguer P., Roussignol G., Renard N., Eybalin M., Michelin A., et al. Expression of the Opa1 mitochondrial protein in retinal ganglion cells: its downregulation causes aggregation of the mitochondrial network. Invest. Ophthalmol. Vis. Sci. (2005) 46:4288–4294.[Abstract/Free Full Text]

  30. Hart A.W., McKie L., Morgan J.E., Gautier P., West K., Jackson I.J., Cross S.H. Genotype-phenotype correlation of mouse pde6b mutations. Invest. Ophthalmol. Vis. Sci. (2005) 46:3443–3450.[Abstract/Free Full Text]

  31. Delettre C., Griffoin J.M., Kaplan J., Dollfus H., Lorenz B., Faivre L., Lenaers G., Belenguer P., Hamel C.P. Mutation spectrum and splicing variants in the OPA1 gene. Hum. Genet. (2001) 109:584–591.[CrossRef][ISI][Medline]

  32. Chen H., Chan D.C. Critical dependence of neurons on mitochondrial dynamics. Curr. Opin. Cell Biol. (2006) 18:453–459.[CrossRef][ISI][Medline]

  33. Osborne N.N., Lascaratos G., Bron A.J., Chidlow G., Wood J.P. A hypothesis to suggest that light is a risk factor in glaucoma and the mitochondrial optic neuropathies. Br. J. Ophthalmol. (2006) 90:237–241.[Abstract/Free Full Text]

  34. Cossee M., Puccio H., Gansmuller A., Koutnikova H., Dierich A., LeMeur M., Fischbeck K., Dolle P., Koenig M. Inactivation of the Friedreich ataxia mouse gene leads to early embryonic lethality without iron accumulation. Hum. Mol. Genet. (2000) 9:1219–1226.[Abstract/Free Full Text]

  35. Schrank B., Gotz R., Gunnersen J.M., Ure J.M., Toyka K.V., Smith A.G., Sendtner M. Inactivation of the survival motor neuron gene, a candidate gene for human spinal muscular atrophy, leads to massive cell death in early mouse embryos. Proc. Natl Acad. Sci. USA (1997) 94:9920–9925.[Abstract/Free Full Text]

  36. Chen H., Detmer S.A., Ewald A.J., Griffin E.E., Fraser S.E., Chan D.C. Mitofusins Mfn1 and Mfn2 coordinately regulate mitochondrial fusion and are essential for embryonic development. J. Cell Biol. (2003) 160:189–200.[Abstract/Free Full Text]

  37. Lodi R., Tonon C., Valentino M.L., Iotti S., Clementi V., Malucelli E., Barboni P., Longanesi L., Schimpf S., Wissinger B., et al. Deficit of in vivo mitochondrial ATP production in OPA1-related dominant optic atrophy. Ann. Neurol. (2004) 56:719–723.[CrossRef][ISI][Medline]

  38. Ju W.K., Misaka T., Kushnareva Y., Nakagomi S., Agarwal N., Kubo Y., Lipton S.A., Bossy-Wetzel E. OPA1 expression in the normal rat retina and optic nerve. J. Comp. Neurol. (2005) 488:1–10.[CrossRef][ISI][Medline]

  39. Ishihara N., Fujita Y., Oka T., Mihara K. Regulation of mitochondrial morphology through proteolytic cleavage of OPA1. Embo J. (2006) 25:2966–2977.[CrossRef][ISI][Medline]

  40. Cipolat S., Rudka T., Hartmann D., Costa V., Serneels L., Craessaerts K., Metzger K., Frezza C., Annaert W., D'Adamio L., et al. Mitochondrial rhomboid PARL regulates cytochrome c release during apoptosis via OPA1-dependent cristae remodeling. Cell (2006) 126:163–175.[CrossRef][ISI][Medline]

  41. Frezza C., Cipolat S., Martins de Brito O., Micaroni M., Beznoussenko G.V., Rudka T., Bartoli D., Polishuck R.S., Danial N.N., De Strooper B., et al. OPA1 controls apoptotic cristae remodeling independently from mitochondrial fusion. Cell (2006) 126:177–189.[CrossRef][ISI][Medline]

  42. Olichon A., Elachouri G., Baricault L., Delettre C., Belenguer P., Lenaers G. OPA1 alternate splicing uncouples an evolutionary conserved function in mitochondrial fusion from a vertebrate restricted function in apoptosis. Cell Death Differ (2007) 14:423–430.

  43. Li S.H., Li X.J. Huntingtin and its role in neuronal degeneration. Neuroscientist (2004) 10:467–475.[Abstract]

  44. Lee W.C., Yoshihara M., Littleton J.T. Cytoplasmic aggregates trap polyglutamine-containing proteins and block axonal transport in a Drosophila model of Huntington's disease. Proc. Natl Acad. Sci. USA (2004) 101:3224–3229.[Abstract/Free Full Text]

  45. Provencio I., Cooper H.M., Foster R.G. Retinal projections in mice with inherited retinal degeneration: implications for circadian photoentrainment. J. Comp. Neurol. (1998) 395:417–439.[CrossRef][ISI][Medline]

  46. Sekaran S., Foster R.G., Lucas R.J., Hankins M.W. Calcium imaging reveals a network of intrinsically light-sensitive inner-retinal neurons. Curr. Biol. (2003) 13:1290–1298.[CrossRef][ISI][Medline]

  47. Amati-Bonneau P., Guichet A., Olichon A., Chevrollier A., Viala F., Miot S., Ayuso C., Odent S., Arrouet C., Verny C., et al. OPA1 R445H mutation in optic atrophy associated with sensorineural deafness. Ann. Neurol. (2005) 58:958–963.[CrossRef][ISI][Medline]

  48. Li C., Kosmorsky G., Zhang K., Katz B.J., Ge J., Traboulsi E.I. Optic atrophy and sensorineural hearing loss in a family caused by an R445H OPA1 mutation. Am. J. Med. Genet. (2005) 138:208–211.

  49. Gimenez E., Montoliu L. A simple polymerase chain reaction assay for genotyping the retinal degeneration mutation (Pdeb(rd1)) in FVB/N-derived transgenic mice. Lab. Anim. (2001) 35:153–156.[ISI][Medline]

  50. Qiao X., Pennesi M., Seong E., Gao H., Burmeister M., Wu S.M. Photoreceptor degeneration and rd1 mutation in the grizzled/mocha mouse strain. Vision Res. (2003) 43:859–865.[CrossRef][ISI][Medline]

  51. Rogers D.C., Fisher E.M., Brown S.D., Peters J., Hunter A.J., Martin J.E. Behavioral and functional analysis of mouse phenotype: SHIRPA, a proposed protocol for comprehensive phenotype assessment. Mamm. Genome (1997) 8:711–713.[CrossRef][ISI][Medline]

  52. Thaung C., Arnold K., Jackson I.J., Coffey P.J. Presence of visual head tracking differentiates normal sighted from retinal degenerate mice. Neurosci. Lett. (2002) 325:21–24.[CrossRef][ISI][Medline]

  53. Klassen H.J., Ng T.F., Kurimoto Y., Kirov I., Shatos M., Coffey P., Young M.J. Multipotent retinal progenitors express developmental markers, differentiate into retinal neurons, and preserve light-mediated behavior. Invest. Ophthalmol. Vis. Sci. (2004) 45:4167–4173.[Abstract/Free Full Text]