Skip Navigation


Human Molecular Genetics Advance Access originally published online on April 27, 2007
Human Molecular Genetics 2007 16(13):1578-1586; doi:10.1093/hmg/ddm107
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/13/1578    most recent
ddm107v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Itoh, T.
Right arrow Articles by Linn, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Itoh, T.
Right arrow Articles by Linn, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Ddb2 is a haploinsufficient tumor suppressor and controls spontaneous germ cell apoptosis

Toshiki Itoh1,*, Sachiyo Iwashita1, Michael B. Cohen1, David K. Meyerholz1 and Stuart Linn2

1 Department of Pathology, The University of Iowa, Carver College of Medicine, Iowa City, IA 52242, USA and 2 Department of Molecular and Cell Biology, University of California, Barker Hall, Berkeley, CA 94720, USA

* To whom correspondence should be addressed at: 1169ML, Department of Pathology, The University of Iowa, Newton Road, Iowa City, IA 52242, USA. Tel: +1 3193534235; Fax: +1 3193356559; Email: toshiki-ito{at}uiowa.edu

Received March 19, 2007; Accepted April 17, 2007


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Damage-specific DNA-binding (DDB) protein heterodimer has been extensively studied in the context of nucleotide excision repair. However, the smaller subunit, DDB2, is also implicated in tumor suppressor p53-mediated processes, although the precise details of the DDB2 – p53 interactions are unknown. Here, we report that Ddb2–/– and Ddb2+/– mice have shortened lifespans and increased frequency and spectrum of spontaneous tumors. Notably, Ddb2 deficiency enhances lung and mammary adenocarcinomas. Ddb2–/– mice are smaller than normal. Whereas weights of kidneys and livers are reduced proportionately, spleens from Ddb2–/– mice gradually enlarge with age due to lymphoid proliferation. Ddb2–/– mice also have larger testes, and the testicular germ cells show significantly decreased spontaneous apoptosis. These changes parallel reduced levels of p53 and its serine 15 phosphorylation in testicular germ cells. Since tumors that appeared in heterozygous Ddb2+/– mice conserve the wild-type Ddb2 allele, Ddb2 RNA expression and Ddb2 exon sequence, Ddb2 heterozygosity can facilitate tumor development as a haploinsufficient tumor suppressor. These results demonstrate that in whole animals as in cultured cells Ddb2 can regulate apoptosis and tumor incidence.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Nucleotide excision repair (NER) is crucial for preventing human skin cancer, especially non-melanoma skin cancer induced by exposure to ultraviolet (UV) light. NER was reconstituted using six essential factors (XPA, XPB, XPC, XPD, XPF and XPG), which were identified as proteins defective in various subtypes of xeroderma pigmentosum (XP) (1,2). XP also includes two further subtypes: XP-V, in which the bypass damage DNA polymerase {eta} is compromised and XP-E, in which the damage-specific DNA-binding (DDB) protein is defective (3). DDB is composed of two subunits, a larger subunit DDB1 and a smaller subunit DDB2 (4,5), the product of the XPE gene (6). Whereas DDB1 is virtually ubiquitous among eukaryotes, DDB2 is present only in vertebrates, suggesting role(s) for DDB1 that are independent of DDB2. DDB has a strong binding affinity to minor photoproducts, but not to a major photoproduct, [cis,syn] cyclobutane pyrimidine dimer, which is a main cause of skin cancer (4,7). DDB has extensively been studied for a role in damage recognition in NER pathway. Recent studies pro-pose three different models in this capacity (8): (i) DDB initially binds to UV damage and recruits the XPC–HR23B complex and, after degradation of DDB2, the XPC–HR23B complex continues the NER process (9); (ii) DDB removes histones from damaged regions of chromatin DNA to facilitate access of the XPC–HR23B complex (10) and (iii) other factors recognize UV-induced DNA damage and DDB is involved instead in cell cycle regulation and signaling pathways (11,12). However, little is known about DDB2 function in reducing general carcinogenesis and organ-specific abnormalities.

Although XP patients and cells from them are extremely sensitive to UV light, in general, those with XP-E are not abnormally sensitive but are rather resistant to killing by UV radiation (13,14). Moreover, DDB2 levels are diminished during the first 6 h following irradiation then reappear, peaking at 48 h after UV irradiation at a time when NER has already been completed (14). The resistance to UV radiation of XP-E cells is due to impaired tumor suppressor p53-dependent apoptosis. DDB2 and p53 were shown in some way to regulate one-another both before and after exposure to UV light (14). DDB2 has a WD40 domain, suggesting that it could interact with proteins involved in a variety of cellular functions (15), while DDB1 is an adaptor for the CUL4 ubiquitin ligase complex (1618), likewise suggesting pleiotropic functions for DDB.

XP mouse models have been effective for investigating in vivo pathophysiological phenotypes as well as understanding the functions of human XP proteins (1923). Similar to XP patients, these mouse models usually have significantly increased incidence of both UV- and chemical-induced skin tumors, but not spontaneous tumors. Homozygous Ddb2–/– mutant mice have been established (24,25) and cells from the mutant mice show similar abnormalities as those of human XP-E cells (24). Ddb2–/– mice are significantly prone to UV-induced skin squamous cell carcinomas, but not to chemical-induced papillomas, as would be expected from no increase of chemically induced papillomas in p53–/– mice (26). It is noteworthy that heterozygous Ddb2+/– mice also showed enhanced UV-induced skin tumors (24). Whereas Ddb2–/– mice are viable and fertile, Ddb1–/– mice are embryonic lethal (27).

Since little is known about DDB2 function, in general, carcinogenesis and organ-specific abnormalities, we have begun to explore Ddb2–/– and Ddb2+/– mice at the whole body and organ levels in the absence of DNA damage treatments. We find that DDB2 is involved in spontaneous apoptosis in testes that corresponds to levels of p53 and its phosphorylation at serine 15 and that Ddb2 is a haploinsufficient tumor suppressor, emphasizing the importance of Ddb2 gene dosage for the prevention of spontaneous tumors.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Effect of Ddb2 deficiency in mice on overall and tumor-free lifespans
Mutations in the DDB2 gene cause the resistance to the p53-dependent apoptotic pathway (14), while photosensitive XP patients and mouse models are exclusively predisposed to skin cancer mainly caused by UV exposure (1923,28). Since p53 is a general tumor suppressor that is defective in a large fraction of cancers (http://www.p53.free.fr/Database/p53_cancer/all_cancer.html), a Ddb2 disruption might in-crease the frequency of cancers other than UV-induced skin cancers. To this end, 130 F2 and F3 mice from a Ddb2 disrupted strain (39+/+, 54+/– and 37–/– each in 50% 129/Sv and 50% C57Bl/6 backgrounds) were monitored. Overall survival for the Ddb2–/– mice was shorter than that of Ddb2+/+ mice (median lifespan = 22.7 ± 1.1 versus 28.2 ± 1.0 months, P = 0.00012) (Fig. 1A). To our surprise, Ddb2+/– mice also exhibited a shortened lifespan (median lifespan = 24.4 ± 0.8 months, P = 0.35), indicating that the Ddb2 gene is haploinsufficient for maintaining normal lifespan.


Figure 1
View larger version (28K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. Overall and tumor-free survival of Ddb2-deficient mice. (A) Natural lifespan in Ddb2-deficient mice: wild type (open squares; n = 39), Ddb2+/– (filled triangles; n = 54), and Ddb2–/– (filled circles; n = 37). (B) Tumor-free lifespan in Ddb2-deficient mice: symbols are the same as in (A). Statistical differences were determined by the log-rank test.

 
To identify specific abnormalities that shortened the lifespan in the Ddb2+/– and Ddb2–/– mice, we focused on spontaneous tumors. The tumor-free survival rate was significantly decreased in the Ddb2–/– mice compared with the Ddb2+/+ mice (median lifespan = 25.3 ± 1.0 versus 33.4 ± 1.0 months, P = 0.0016) (Fig. 1B). That of the Ddb2+/– mice also was decreased (median lifespan = 28.5 ± 1.0 months (+/–), P = 0.0078) (Fig. 1B). Although the median lifespan of the Ddb2+/– mice was longer than that of Ddb2–/– mice, the statistical significance between them was not clearly detected by the log-rank (Mantel–Haenszel) test (P = 0.18), but was detected by the Tarone–Ware test (P = 0.048). The Mantel–Haenszel test gives equal weight to all deaths, whereas the Tarone–Ware test gives more weight to earlier deaths. The differences in tumor incidence between Ddb2+/– and Ddb2–/– mice are more significant at early time points prior to 24 months of age, and thereafter both Ddb2+/– and Ddb2–/– mice show a similar tumor incidence (Fig. 1B). It is also noteworthy that the fraction of mice that died without tumors was very different: 74% for the +/+, 63% for +/– and 54% for the –/–. Thus, Ddb2+/– and Ddb2–/– mice increased spontaneous tumors, indicating that Ddb2 is involved in general tumor suppression even in the absence of UV radiation.

Increased incidence and spectrum of spontaneous tumors associated with Ddb2 deficiency in mice
The tumor incidence prior to mouse death increased with increasing Ddb2 deficiency: 25.6% (+/+), 37.0% (+/–) and 46.0% (–/–) (Table 1). Malignant lymphomas and sarcomas dominated the tumor spectrum in the Ddb2+/+ mice (90% of total tumors, Table 1), consistent with the wild-type mice with similar genetic backgrounds in the previous reports (2932). Compared with the wild-type control, Ddb2 disrupted mice had not only an enhancement of tumor incidence, but also a change of the tumor spectrum. The incidence of malignant lymphomas increased from 18 (7/39, +/+) to 24 (13/54, +/–) to 27% (10/37, –/–), whereas that of sarcomas did not show any significant difference among the genotypes. Broad types of tumors appeared only in Ddb2+/– and Ddb2–/– mice, and epithelial malignancies appeared only in the Ddb2 disrupted mice [20% (+/–) and 17.7% (–/–) of total tumors, Table 1].


View this table:
[in this window]
[in a new window]

 
Table 1. Tumor spectrum in Ddb2–/–, Ddb2+/–, and Ddb2+/+ mice

 
Detailed histopathology of tumors
Adenocarcinoma of the lung showed characteristic morphology of papillary adenocarcinoma (Fig. 2A and B). The moderately differentiated, pleomorphic cancer cells replaced normal lung tissues. The lung adenocarcinoma was identified at 15 and 25 months of age in the Ddb2–/– mice and 24.5, 27 and 31 months in the Ddb2+/– mice. In contrast, one 32.5-month-old Ddb2+/+ mouse had a small adenoma (<2 mm) that was well circumscribed and lacked atypia (data not shown).


Figure 2
View larger version (139K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. Histology of malignant (AJ) and benign (K, L) tumors and splenic abnormality (M, N) in the Ddb2-deficient mice. (A, B) Papillary lung adenocarcinoma from Ddb2–/– mice. (A) Tumors cells effaced normal lung. (B) The moderately differentiated tumor had pleomorphic cellular foci (arrow) with a high mitotic rate that invaded adjacent interstitium and airways. (C, D) Mammary adenocarcinoma from Ddb2+/– mice. (C) The lobulated mass compressed and effaced normal dermal architecture and extended into the deep panniculus: S, skin epidermis. (D) The neoplastic cells formed poorly differentiated acini and effaced normal subcutaneous tissues. (E, F) Malignant lymphoma from Ddb2–/– mice. (E) The neoplastic lymphocytes invaded and effaced the normal architecture of the spleen. (F) Anisocytotic and atypic lymphoied cells effaced red pulp. B220-positive and CD3-negative lymphocytes were clonally proliferated (insets), confirming that the lymphoma was of B-cell lineage. (G, H) Hemangiosarcoma from Ddb2–/– mice. (G) Striated muscle hemangiosarcoma at the left hind-limb: M, normal muscle. (H) The neoplastic spindle cells (arrows) had plump nuclei and formed blood-filled clefts and channels. The neoplastic cells invaded and effaced normal striated muscle. (I, J) Soft-tissue sarcoma (leiomyosarcoma) from Ddb2–/– mice. (I) The mass was composed of interlacing cords of spindle cells with indistinct cell borders, pale eosinophilic cytoplasm and elongate nuclei. It extended from the superficial dermis to the deep panniculus with invasion and effacement of deep muscle and adnexal structures: F, normal fat tissues. (J) In much of the dermal mass, only remmant hair follicles were occasionally visible (arrows). Leiomyosarcoma was confirmed with strong SMA staining (inset). (K, L) Hepatocellular adenoma from Ddb2–/– mice. (K) The mass was moderately circumscribed, lacked normal lobular organization and showed compression of adjacent normal hepatic parenchyma. Arrows show the boundary between the tumor and normal tissues. (L) The tumor cells were larger than adjacent normal hepatocytes and frequently had a cytoplasmic vacuolization. Arrows show the boundary of the larger more basophilic tumor cells compressing adjacent tissue. The arrowhead shows a mitotic figure. (M, N) Lymphoid proliferation from Ddb2–/– mice at 12 months of age. (M) Owing to expansions of white pulp, red pulp was diminished. (N) The proportion of erythrocytes decreased compared with that of lymphocytes. B220-positive B-cells were clonally proliferated (inset) indicative of an early B-cell lymphoma. Bars, 0.1 mm (A, C, E, G, I, K, M); 10 µm (B, D, F, H, J, L, N).

 
Adenocarcinomas of the breast presented as solitary subcutaneous masses along with the milk line in female mice only, and showed a solid pattern with uncommon acinar gland formation (Fig. 2C and D). The mammary adenocarcinomas were identified at 26 months of age in both Ddb2+/– and Ddb2–/– mice.

Malignant lymphomas in Ddb2+/– and Ddb2–/– mice were typical non-thymic lymphomas, i.e. splenic and diffuse B-cell lymphomas, which were similar histological types observed in the Ddb2+/+ mice (Fig. 2E and F). Various types of sarcomas were observed in the Ddb2–/– mice (Fig. 2G–J). Sarcomas were of an earlier onset and more aggressive compared with those in Ddb2+/+ mice. Hemangiosarcoma (Fig. 2G and H), spindle cell sarcoma (negative staining of B220, CD3 and F4/80, data not shown) and soft-tissue sarcoma (leiomyosarcoma) (Fig. 2I and J) arose at 14.5, 20 and 22 months of age, respectively. In contrast, two hemangiosarcomas were observed at 27 and 33.5 months of age in the wild-type control (Table 1).

One Ddb2–/– mouse (27 months of age) had a hepatocellular adenoma characterized by several mitotic figures, compression of adjacent tissue and hemorrhage into the abdomen (Fig. 2K and L).

Abnormalities of spleen and testis in the Ddb2–/– mice
We examined various organs in the mice between 2 and 15 months of age. Since organ weights parallel body sizes, organ weights are normalized by body weights for each animal (Fig. 3). The relative weights of liver (Fig. 3A) and kidney (Fig. 3B) were similar between Ddb2–/– and Ddb2+/+ mice, ranging from ~0.04 to 0.05 for liver and ~0.06 to 0.08 for kidney. There was no significant difference in the relative weight ratio of spleen between Ddb2–/– and Ddb2+/+ mice until 12 months of age (relative weight ratio = 0.002–0.003). However, the relative ratio increased from 0.004 to 0.005 for the Ddb2–/– spleens thereafter. Lymphoid proliferation was more prominent in the Ddb2–/– spleens compared with the Ddb2+/+ spleens (Fig. 2M and N). The white pulp, consisting of aggregates of lymphoid tissue, was expanded in the Ddb2–/– spleens, suggesting that the histological changes may result in the lymphomagenesis observed in the Ddb2–/– mice (Table 1). [Note that extramedullary hematopoiesis was observed in 12-month-old wild-type spleens (data not shown).]


Figure 3
View larger version (28K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3. Relative weight ratios of organs in the Ddb2–/– mice. (AD) Relative weight ratio (organ weight per body weight) was calculated for each examined mouse. A total of 154 mice aged from 2 to 15 months were evaluated (90 Ddb2+/+ and 64 Ddb2–/– mice). (A) Liver. (B) Kidney. (C) Spleen. (D) Testis. (E) Comparison of relative weight ratio of testis (left) and kidney (right) in Ddb2–/–, Ddb2+/+, and Trp53–/– mice. Average of relative weight ratio was calculated using mice from 3 to 8 months of the age; n = 60 Ddb2–/–, 82 Ddb2+/+ and 24 Trp53–/–, respectively. Error bars show SEM. Statistical differences were determined by the two-sample Student's t-test.

 
A second unique observation was that the relative weight ratio of testes of the Ddb2–/– mice was higher than that of the Ddb2+/+ mice [0.004–0.005 (–/–) versus 0.002–0.004 (+/+); Figs. 3D and 4A]. The absolute sizes of the Ddb2–/– and Ddb2+/+ testes were not significantly different until around 14 months of age as a result of the diminished body weight of the Ddb2–/– mice (Fig. 4A). Since Ddb2 was proposed to be involved in p53-dependent apoptosis (14,24), we examined whether the Ddb2–/– testes show abnormalities in apoptosis using the terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) method. Indeed, Ddb2–/– testes were defective in spontaneous apoptosis (Compare Fig. 4C and D with E and F). The reduction in spontaneous apoptosis in testicular germ cells was most dramatic at 10 months (Fig. 4G) at which time sizes relative to body weight differed by 1.5-fold (Fig. 3D), although the absolute sizes were similar. In addition to reduced levels of apoptosis, the levels of p53 and its phosphorylation at serine 15 residue were significantly reduced in the Ddb2–/– testes (Compare Fig. 4H and I with J and K). Interestingly, the relative weight ratio of testis, but not kidneys, in Trp53–/– mice was also higher than that in the Ddb2+/+ mice (P < 0.001, Fig. 3E). Therefore, the relative weight ratio of testis correlates with p53 levels. Taken together, the results suggest that the enlargement of Ddb2–/– testes is related to a defect in p53-dependent apoptosis.


Figure 4
View larger version (105K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4. Spontaneous germ cell apoptosis in the Ddb2–/– mice. (A, B) Gross view of organs from Ddb2+/+ and Ddb2–/– mice at 15 months of age. (A) Testis. (B) Kidney. Ddb2–/– mice have larger testes (A), but smaller kidneys (B), than Ddb2+/+ mice: Bars, 5 mm. (CF) Germ cell apoptosis detected by the TUNEL assay in testicular sections from Ddb2–/– (C, D) and Ddb2+/+ mice (E, F) at 10 months of age. Bars, 0.25 mm (C, E); 50 µm (D, F). (G) Mean germ cell apoptosis per seminiferous tubule at 10 and 15 months of age in Ddb2–/– (n = 2 and 5, respectively) and Ddb2+/+ (n = 3 and 6, respectively) mice. Error bars show SEM. Statistical differences were determined by the two-sample Student's t-test. (HK) p53 (H, J) and p53 phospho-serine 15 (I, K) immunostaining of testis from Ddb2–/– (H, I) and Ddb2+/+ (J, K) mice at 10 months of age. Bars, 50 µm (H–K). Both p53 and p53 phospho-serine 15 were positive in spermatocytes. The intensity of staining in the Ddb2–/– spermatocytes was much weaker than that in the Ddb2+/+ spermatocytes (compare H, I to J, K).

 
Conservation of Ddb2 heterozygosity, Ddb2 expression and Ddb2 exon sequence in tumors from Ddb2+/– mice
We previously reported that Ddb2+/– mice had enhanced UV-induced skin cancer (24). Moreover, we noted above that the spontaneous tumor frequency is also higher in the Ddb2+/– mice (Figs. 12), suggesting that Ddb2 gene dosage may be critical for tumorigenesis. To determine whether Ddb2 can be a haploinsufficient tumor suppressor, we examined the loss of heterozygosity (LOH) in 15 tumors from Ddb2+/– mice (Fig. 5). Each of the tumors retained a wild-type Ddb2 allele (five skin tumors and two visceral tumors are presented in Fig. 5A). Furthermore, Ddb2 expression in the Ddb2+/– tumors was altered, but it was detectable in the Ddb2+/– tumors using RT–PCR (Fig. 5B). No mutations were found in all exons in the Ddb2 gene of eight tumors (five skin tumors and three malignant lymphomas) from Ddb2+/– mice (data not shown). Thus, Ddb2 heterozygosity can facilitate tumor development as a haploinsufficient tumor suppressor in addition to the inactivation of both Ddb2 alleles.


Figure 5
View larger version (25K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5. LOH and Ddb2 expression in tumors from Ddb2+/– mice. (A) Amplification of wild-type and disrupted Ddb2 alleles using genomic DNA extracted from tumors in Ddb2+/– mice: M, size maker. Skin tumors are UV-induced squamous cell carcinomas. Visceral tumors are mammary adenocarcinoma (M) and malignant lymphoma (L). (B) Ddb2 expression in tumors from Ddb2+/– mice. RT–PCR analysis shows continuous Ddb2 expression in Ddb2+/– tumors, indicating that the Ddb2 gene is not completely inactivated by epigenetic mechanisms.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Considerable progress has been made in understanding how DDB might function as an initial damage-recognition factor in NER. Although NER-defective patients and mice are not predisposed to spontaneous tumors, a recent study provided a fascinating preliminary finding that Ddb2–/– and Ddb2+/– mice may be prone to spontaneous tumors (25). What was not clearly defined in that study was the types and frequencies of spontaneous malignancies and the natural and tumor-free lifespans of Ddb2–/–, Ddb2+/– and Ddb2+/+ mice. That study was started using 10 each Ddb2–/–, Ddb2+/– and Ddb2+/+ mouse and for 3 Ddb2–/– and 7 Ddb2+/– mice, the cause of death was not identified. In this study, we have demonstrated that Ddb2 deficiency promotes spontaneous epithelial malignancies, malignant lymphomas and sarcomas. In particular, Ddb2+/– mice show a qualitatively similar phenotype to Ddb2–/– mice, suggesting that the gene dosage of Ddb2 is important for preventing spontaneous malignancies. Recent studies emphasize that mutations in tumor suppressor genes can have haploinsufficient, dominant negative or gain- of-function phenotypes, suggesting that a reevaluation of the ‘two-hit’ model of tumor suppressor inactivation is needed. Hence, tumor suppressor genetics was proposed (33). It is unknown whether the naturally occurring DDB2 mutations can have dominant negative and/or gain-of-function effects. In normal primary cells, DDB2 gene products are precisely regulated before and after DNA damage, whereas abnormal DDB2 regulation is observed in cells from true XP-E patients (14,34). Ddb2 knock-in mouse models harboring naturally occurring Ddb2 mutations might be required for evaluation of the variable severity of the human XP-E phenotype.

We proposed that DDB2 and p53 reciprocally regulate one another (14). However, details about pathophysiological interactions between the two proteins as well as the tumor suppression function(s) of DDB2 itself are lacking. The tumor suppressors p53 and INK4a, key proteins controlling cell death and senescence, mainly cause malignant lymphomas and sarcomas and drastically reduce the lifespan of mice with similar genetic backgrounds to our Ddb2–/– mice (30,35). The Trp53–/– mice showed malignant lymphomas and sarcomas, which were 97% of a total number of tumors from 3 months of age and a reduced average lifespan of 5–6 months. Sixty-four per cent of these tumors was thymic lymphomas (30). Ddb2 disruption enhanced spontaneous malignant tumors. Interestingly, Ddb2 disruption did not primarily induce thymic lymphomas, but rather expanded incidence of epithelial malignancies. Treatment with a tumor initiator, DMBA (7,12-dimethylbenz[{alpha}]anthracene), did not enhance the initiation and the promotion of skin benign tumors in Ddb2–/– and Ddb2+/– mice (24), the phenotype of which is similar to Trp53–/– mice (26). Therefore, Ddb2 may prevent malignant progression in multi-state carcinogenesis by assisting Trp53.

Approximately 54 and 63% of Ddb2–/– and Ddb2+/– mice, respectively, died earlier than Ddb2+/+ mice without malignant tumors. They were generally stunted and showed a hunched posture and rough fur, consistent with a premature aging phenotype. The Ddb2 disruption enhanced both epithelial malignancies and a modest phenotype of premature aging. These suggest that DDB2 might play a crucial role for the normal aging process as well as the cancer prevention.

We observed in this study that testicular germ cells were defective in spontaneous apoptosis, which is related to levels of p53 and its phosphorylation at serine 15, consistent with our observations that DDB2/Ddb2 controls basal levels of p53 (14,24). High expression of p53 protein was observed in the tetraploid pachytene primary spermatocytes, indicating that p53 is important for meiosis (36). Transgenic mice carrying p53 promoter–chloramphenicol acetyltransferase and p53-null mice with the 129 genetic background exhibited testicular giant-cell degenerative syndrome (37). Moreover, p53 is involved in germ cell quality control (38,39). While we observed low expression of p53 and its phosphorylation at serine 15 residues in the Ddb2–/– mice, neither testicular giant-cells nor abnormal fertilization were observed (data not shown). The p53-mediated development of male germ cells depends on the genetic background. For example, p53-null mice with the 129 background were infertile and showed a high incidence of seminoma and teratocarcinoma, whereas those with C57BL/6 X 129 mixed genetic background were fertile and exhibited normal structure of the seminiferous tubules (37). Since our mice, used in this study, were C57BL/6 X 129-mixed background, the development of germ cells may be relatively conserved.

A critical question, of course, is whether the epithelial malignancies observed in the Ddb2-deficient mice are relevant to humans. Recent high-throughput analysis of human cancers exposed a tentative link between DDB2 and lung cancer (40). Compound heterozygous Rs830083CG/GG and homozygous Rs830083CG increased the risk of lung adenocarcinomas in both non-smokers and smokers, although the latter was not statistically significant. Nonetheless, it is clearly important to investigate mutations and single nucleotide polymorphisms of the DDB2 gene in human cancers other than skin cancers and perhaps then to re-define the XP-E phenotype if the abnormal phenotypes of XP-E were underestimated.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Ddb2+/+, Ddb2+/– and Ddb2–/– mice
Homozygous Ddb2–/– mice were produced as described previously (24). For survival studies, 130 F2 and F3 mice (50% 129/Sv and 50% C57Bl/6 genetic backgrounds) were used. F2 and F3 offspring were raised by crossing F1 and F2 Ddb2+/– male and female mice, respectively. The wild-type control mice have the same genetic background as homozygous and heterozygous Ddb2 knockout mice. For organ assessments, 64 Ddb2–/– mice (38 mice with 50% 129/Sv and 50% C57Bl/6; 7 mice with 75% 129/Sv and 25% C57Bl/6 and 19 mice with 25% 129Sv and 75% C57Bl/6), 90 Ddb2+/+ mice (45 mice with 50% 129/Sv and 50% C57Bl/6; 2 mice with 75% 129/Sv and 25% C57Bl/6; 5 mice with 25% 129/Sv and 75% C57Bl/6 and 38 mice with 100% C57Bl/6) and 12 Trp53–/– mice (25% 129/Sv and 75% B57Bl/6) were examined.

Animal observations, tumor incidence and histochemical analysis
All mice were bred and housed in barrier facilities at the University of California, Berkeley and the University of Iowa. For organ assessments, mice were euthanized monthly from 2 to 15 months and weighed before dissection.

To determine the overall and tumor-free lifespans, mice were observed carefully for evidence of ill health or overt tumor growth. Mice were euthanized if profoundly ill or if external tumors or skin lesions (ulceration) exceeded 1 cm in diameter, and scored as a death in both tumor and overall survival analyses. Only those animals with histologically proven malignancies or benign tumors related to the direct cause of death (e.g. bleeding) were scored as a death in the tumor-free survival. Kaplan–Meier analysis was used for both analyses. Statistical significance was measured using the log-rank (Mantel–Haenszel) and the Tarone–Ware tests. All mice were subjected to autopsy and gross examinations. Tumors and organs were weighed and fixed in 10% neutral-buffered formalin for histological analysis. Fixed tissues were embedded in paraffin, and 4–5 µm sections were stained with hematoxylin and eosin. Immunohistochemistry staining was also performed to diagnose the origin of lymphomas and to determine total and phosphorylated p53 levels. Rabbit anti-CD3 (1:100, Dakocytomation) and mouse anti-B220 (1:200, AbD Serotec) antibodies were used to detect the expression of T- and B-cell surface markers, respectively. Histiocytes (macrophages) were determined by rat anti-F4/80 antibody (1:500, AbD Serotec) in order to distinguish macrophages, B- and T-lymphocytes. Rabbit polyclonal antibodies against p53 (1:200, Cell Signaling) and p53 phospho-serine 15 (1:50, Cell Signaling) were used to detect p53 expression in testicular germ cells. Leiomyosarcoma was determined with a rabbit anti-SMA antibody (1:2000, Sigma). Pre-immune sera that correspond to the species of primary antibodies were used for negative controls for each immunostaining.

TUNEL assay
The TUNEL assay (ApopTag plus peroxidase in situ apoptosis detection kit, Chemicon) was performed according to the manufacturer’s instruction with some modifications. Briefly, terminal deoxynucleotidyl transferase was diluted from 1:3 to 1:20 and incubated for 1 h at 37°C. After adding the peroxidase substrate, tissue sections were stained for 1–4 min at room temperature to obtain an optimal staining, and then the reaction was stopped.

TUNEL positive cells were counted from 164 to 304 (average = 234) Ddb2–/– tubules per mouse and 140–308 (average = 211) Ddb2+/+ seminiferous tubules per mouse. Statistical differences were determined by the two-sample Student’s t-test.

LOH, RT–PCR and mutation analysis
Genomic DNA was extracted from either frozen or formalin-fixed tissues using the DNeasy tissue extraction kit (Qiagen) as instructed by the manufacturer. Formalin-fixed tissues were incubated with phosphate-buffered saline overnight at 4°C before lysis of tissues. PCR was performed using a primer set of Pneo, P6 and P7, as described elsewhere (24). For DNA from frozen tissues and tail samples (control), both mutant and wild-type alleles were amplified in one tube using these primers. For DNA from formalin-fixed tissues, the mutant and the wild-type alleles were separately amplified, and then both samples were mixed and subjected to 2.5% agarose gel electrophoresis.

Total RNA was extracted from the frozen tissues using the RNeasy mini kit (Qiagen) and paraffin-embedded tissues using the RNeasy FFPE kit (Qiagen). First-strand cDNA was synthesized using the Stratascript first-strand synthesis kit (Stratagene) with random primers or a Ddb2 specific primer (5'-CCT GCT CCA ACC CTA AGA AT). RNA samples from frozen tissues were directly amplified with Ddb2 primers 5'-GTT TAA CCA TCT CAA TAC CA (exon 4) and 5'-GTG TGAGGTGCTGAAAATGG (exon 7), as described before (24). RNA samples from paraffin-embedded tissues (several 10 µm sections for each tumor) were amplified with the same primer set, and then nested-PCR was performed with DDB2 primers: 5'-GCA GAG TGG TGG TTA CAG GA (exon 5) and 5'-GCGCAGGTCCCAAATCTTCACT (exon 6).

Ddb2 exons were amplified from genomic DNA using the following primers: Ex1S (TTCTCCACGGAGGCTTTTTCC) and Ex1AS (TGAACCCCCGGAAAGCTAAG) for exon 1; Ex2S (GGAGATGATGAGACAAAGG) and Ex3AS (TTATAGCATAACCATCTGGC) for exons 2 and 3; Ex4S (CAGATATTCTAATGTGAGGT) and Ex4AS (ATGTTCTCAGCAAACTGCAT) for exon 4; Ex5S (ACAGACTATCTCAGTCTCGA) and Ex7AS (TTGTAGGCTGTGTATGTGAC) for exons 5–7; Ex8S (ACTTATACCAACCAAGTCCT) and Ex10AS (CTATTAACAAACAGCTGCCA) for exons 8–10. PCR products were purified by the QIAquick gel extraction kit (Qiagen) and subjected to direct sequencing using PCR primers.


    ACKNOWLEDGEMENTS
 
The authors thank C. Bromley, J. Rodgers and E. Solin in the Core Pathology Laboratory in the Department of Pathology, University of Iowa for histological service, K. Trott, J. Goic and L. Braasch for help with organ preparation at the University of California, Berkeley and Dr F. Domann and Dr C.M. Knudson for discussions. This work was supported by the startup funds from the Department of Pathology and the seed grant from the Holden Comprehensive Cancer Center at the University of Iowa (T.I.), and grant GM050424 from USPHS (S.L.).

Conflict of Interest statement. None declared.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Mu D., Park C.H., Matsunaga T., Hsu D.S., Reardon J.T., Sancar A. Reconstitution of human DNA repair excision nuclease in a highly defined system. J. Biol. Chem. (1995) 270:2415–2418.[Abstract/Free Full Text]

  2. Aboussekhara A., Bigerstaff M., Shivji M.K.K., Vilpo J.A., Monocollin V., Podust V.N., Protic M., Hubshcer U., Egly J.-M., Wood R.D. mammalian DNA excision repair reconstituted with purified protein components. Cell (1995) 80:859–868.[CrossRef][Web of Science][Medline]

  3. Itoh T. Xeroderma pigmentosum group E and DDB2, a smaller subunit of damage-specific DNA binding protein: proposed classification of xeroderma pigmentosum, Cockayne syndrome, and ultraviolet-sensitive syndrome. J. Dermatol. Sci. (2006) 41:87–96.[CrossRef][Web of Science][Medline]

  4. Keeney S., Chang G.J., Linn S. Characterization of a human DNA damage binding protein implicated in xeroderma pigmentosum E. J. Biol. Chem. (1993) 268:21293–21300.[Abstract/Free Full Text]

  5. Dualan R., Brody T., Keeney S., Nichols A.F., Admon A., Linn S. Chromosomal localization and cDNA cloning of the genes (DDB1 and DDB2) for the p127 and p48 subunits of a human damage-specific DNA binding protein. Genomics (1995) 29:62–69.[CrossRef][Web of Science][Medline]

  6. Itoh T., Linn S., Ono T., Yamaizumi M. Reinvestigation of the classification of five cell strains of xeroderma pigmentosum group E with reclassification of three of them. J. Invest. Dermatol. (2000) 114:1022–1029.[CrossRef][Web of Science][Medline]

  7. Reardon J.T., Nichols A.F., Keeney S., Smith C.A., Taylor J.-S., Linn S., Sancar A. Comparative analysis of binding of human damaged DNA-binding protein (XPE) and Escherichia coli damage recognition protein (UvrA) to the major ultraviolet photoproducts: T[c,s]T, T[t,s]T, T[6–4]T, and T[Dewar]T. J. Biol. Chem. (1993) 268:21301–21308.[Abstract/Free Full Text]

  8. Bennett D., Itoh T. The XPE gene of xeroderma pigmentosum, its product and biological roles. Molecular Mechanisms of Xeroderma Pigmentosum. Chapter 7, Eurekah (http://www.eurekah.com), in press.

  9. Sugasawa K., Okuda Y., Saijo M., Nishi R., Matsuda N., Chu G., Mori T., Iwai S., Tanaka K., Tanaka K., et al. UV-induced ubiquitylation of XPC protein mediated by UV–DDB–ubiquitin ligase complex. Cell (2005) 121:387–400.[CrossRef][Web of Science][Medline]

  10. Wang H., Zhai L., Xu J., Joo H.Y., Jackson S., Erdjument-Bromage H., Tempst P., Xiong Y., Zhang Y. Histone H3 and H4 ubiquitylation by the CUL4–DDB–ROC1 ubiquitin ligase facilitates cellular response to DNA damage. Mol. Cell (2006) 22:383–394.[CrossRef][Web of Science][Medline]

  11. Reardon J.T., Sancar A. Recognition and repair of the cyclobutane thymine dimmer, a major cause of skin cancers, by the human excision nuclease. Gene Dev. (2003) 17:2539–2551.[Abstract/Free Full Text]

  12. Kulaksíz G., Reardon J.T., Sancar A. Xeroderma pigmentosum complementation group E protein (XPE/DDB2): purification of various complexes of XPE and analyses of their damaged DNA binding and putative DNA repair properties. Mol. Cell Biol. (2005) 25:8784–9792.

  13. Itoh T., Mori T., Ohkubo H., Yamaizumi M. A newly identified patient with clinical xeroderma pigmentosum phenotype has a non-sense mutation in the DDB2 gene and incomplete repair in (6–4) photoproducts. J. Invest. Dermatol. (1999) 113:251–257.[CrossRef][Web of Science][Medline]

  14. Itoh T., O'Shea C., Linn S. Impaired regulation of tumor suppressor p53 caused by mutations in the xeroderma pigmentosum DDB2 gene: mutual regulatory interactions between p48DDB2 and p53. Mol. Cell Biol. (2003) 23:7540–7553.[Abstract/Free Full Text]

  15. Saeki M., Irie Y., Ni L., Yoshida M., Itsuki Y., Kamisaki Y. Monad, a WD40 repeat protein, promotes apoptosis induced by TNF-alpha. Biochem. Biophys. Res. Commun. (2006) 342:568–572.[CrossRef][Web of Science][Medline]

  16. Petroski M.D., Deshaies R.J. Function and regulation of cullin-RING ubiquitin ligases. Nat. Rev. Mol. Cell Biol. (2005) 6:9–20.[CrossRef][Web of Science][Medline]

  17. Higa L.A., Wu M., Ye T., Kobayashi R., Sun H., Zhang H. Cul4-DDB1 ubiquitin ligase interacts with multiple WD40-repear proteins and regulates histone methylation. Nat. Cell Biol. (2006) 8:1277–1283.[CrossRef][Web of Science][Medline]

  18. Angers S., Li T., Yi X., MacCoss M.J., Moon R.T., Zheng N. Molecular architecture and assembly of the DDB1-CUL4A ubiquitin ligase machinery. Nature (2006) 443:590–593.[Medline]

  19. Nakane H., Takeuchi S., Yuba S., Saijo M., Nakatsu Y., Murai H., Nakatsuru Y., Ishikawa T., Hirota S., Kitamura Y., et al. High incidence of ultraviolet-B- or chemical-carcinogen induced skin tumours in mice lacking the xeroderma pigmentosum group A gene. Nature (1995) 377:165–168.[CrossRef][Medline]

  20. de Vries A., van Oostrom C.T.M., Hofhuis F.M.A., Dortant P.M., Berg R.J.W., de Gruijl F.R., Wester P.W., van Kreijl C.F., Capel P.A., van Steeg H., et al. Increased susceptibility to ultraviolet-B and carcinogens of mice lacking the DNA excision repair gene XPA. Nature (1995) 377:169–173.[CrossRef][Medline]

  21. Sands A.T., Abbuin A., Sanchez A., Conti C.J., Bradley A. High susceptibility to ultraviolet-induced carcinogenesis in mice lacking XPC. Nature (1995) 377:162–165.[CrossRef][Medline]

  22. de Bohr J., van Steeg H., Berg R.J.W., Garssen J., de Wit J., van Oostrum C.T.M., Beems R.B., van der Horst G.T.J., van Kreijl C.F., De Gruijl F.R., et al. Mouse model for the DNA repair/basal transcription disorder trichothiodystrophy reveals cancer predisposition. Cancer Res. (1999) 59:3489–3494.[Abstract/Free Full Text]

  23. Harada Y., Shiomi N., Koike M., Ikawa M., Okabe M., Hirota S., Kitamura Y., Kitagawa M., Matsunaga T., Nikaido O. Postnatal growth failure, short life span, and early onset of cellular senescence and subsequent immortalization in mice lacking xeroderma pigmentosum group G gene. Mol. Cell Biol. (1999) 19:2366–2372.[Abstract/Free Full Text]

  24. Itoh T., Cado D., Kamide R., Linn S. DDB2 gene disruption leads to skin tumors and resistance to apoptosis after exposure to ultraviolet light but not a chemical carcinogen. Proc. Natl. Acad. Sci. USA (2004) 101:2052–2057.[Abstract/Free Full Text]

  25. Yoon T., Chakrabortty A., Franks R., Valli R., Valli T., Kiyokawa H., Raychaudhuri P. Tumor-prone phenotype of the DDB2-deficient mice. Oncogene (2005) 24:469–478.[CrossRef][Web of Science][Medline]

  26. Kemp C.J., Donehower L.A., Bradley A., Balmain A. Reduction of p53 gene dosage does not increase initiation or promotion but enhances malignant progression of chemically induced skin tumors. Cell (1993) 74:813–822.[CrossRef][Web of Science][Medline]

  27. Cang Y., Zhang J., Nichlas S.A., Bastien J., Li B., Zhou P., Goff S.P. Deletion of DDB1 in mouse brain and lens leads to p53-dependent elimination of proliferating cells. Cell (2006) 127:929–940.[CrossRef][Web of Science][Medline]

  28. Cleaver J.E. Cancer in xeroderma pigmentosum and related disorders of DNA repair. Nat. Rev. Cancer (2005) 5:564–573.[CrossRef][Web of Science][Medline]

  29. Jacks T., Remington L., Williams B.O., Schmitt E.M., Halachmi S., Bronson R.T., Weinberg R.A. Tumor spectrum analysis in p53-mutant mice. Curr. Biol. (1994) 4:1–7.[CrossRef][Web of Science][Medline]

  30. Donehower L.A., Harvey M., Vogel H., McArthur M.J., Montogomery C.A., Jr, Park S.H., Thompson T., Ford R.J., Bradley A. Effects of genetic backgrounds on tumorigenesis in p53-deficient mice. Mol. Carcinog. (1995) 14:16–22.[Web of Science][Medline]

  31. Artandi S.E., Chang S., Shwu-Luan L., Alson S., Gottlieb G.J., Chin L., DePinho R.A. Telomere dysfunction promotes non-reciprocal translocations and epithelial cancers in mice. Nature (2000) 406:641–645.[CrossRef][Medline]

  32. Lang G.A., Iwakuma T., Suh Y.-A., Liu G., Rao V.A., Parant J.M., Valentin-Vega Y.A., Terzian T., Caldwell L.C., Strong L.C., et al. Gain of function of a p53 hot spot mutation in a mouse model of Li-Fraumeni syndrome. Cell (2004) 199:861–872.

  33. Payne S.R., Kemp C.J. Tumor suppressor genetics. Carcinogenesis (2005) 26:2031–2045.[Abstract/Free Full Text]

  34. Itoh T., Nichols A., Linn S. Abnormal regulation of DDB2 gene expression in xeroderma pigmentosum group E strains. Oncogene (2001) 20:7041–7050.[CrossRef][Web of Science][Medline]

  35. Serrano M., Lee H.-W., Chin L., Cordon-Cardo C., Beach D., DePinho R.A. Role of the INK4a locus in tumor suppression and cell mortality. Cell (1996) 85:27–37.[CrossRef][Web of Science][Medline]

  36. Schwartz D., Goldfinger N., Rotter V. Expression of p53 protein in spermatogenesis is confined to the tetraploid pachytene primary spermatocytes. Oncogene (1993) 8:1487–1494.[Web of Science][Medline]

  37. Rotter V., Schwartz D., Almon E., Goldfinger N., Kapon A., Meshorer A., Donehower L.A., Levine A.J. Mice with reduced levels of p53 protein exhibit the testicular giant-cell degenerative syndrome. Proc. Natl. Acad. Sci. USA (1993) 90:9075–9079.[Abstract/Free Full Text]

  38. Yin Y., Stahl B.C., DeWolf W.C., Morgentaler A. p53-mediated germ cell quality control in spermatogenesis. Dev. Biol. (1998) 204:165–171.[CrossRef][Web of Science][Medline]

  39. Takeuchi A., Mishina Y., Miyaishi O., Kojima E., Hasegawa T., Isobe I. Heterozygosity with respect to Zfp148 causes complete loss of fetal germ cells during mouse embryogenesis. Nat. Genet. (2003) 33:172–176.[CrossRef][Web of Science][Medline]

  40. Hu Z., Shao M., Yuan J., Xu L., Wang F., Wang Y., Yuan W., Qian J., Ma H., Wang Y., et al. Polymorphisms in DNA damage binding protein 2 (DDB2) and susceptibility of primary lung cancer in the Chinese: a case-control study. Carcinogenesis (2006) 27:1475–1480.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/13/1578    most recent
ddm107v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Itoh, T.
Right arrow Articles by Linn, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Itoh, T.
Right arrow Articles by Linn, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?