Human Molecular Genetics Advance Access originally published online on May 20, 2007
Human Molecular Genetics 2007 16(14):1699-1707; doi:10.1093/hmg/ddm118
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mutations in splicing factor PRPF3, causing retinal degeneration, form detrimental aggregates in photoreceptor cells


1 Department of Biomedical Sciences, University of Modena and Reggio Emilia, Modena, Italy, 2 Telethon Institute of Genetics and Medicine (TIGEM), Naples, Italy and 3 Department of Molecular Genetics, Institute of Ophthalmology, University College London, London, UK
* To whom correspondence should be addressed at: Department of Biomedical Sciences, University of Modena and Reggio Emilia, via Campi 287, 41100 Modena, Italy; Tel: +39 0592055392; Fax: +39 0592055410; E-mail: marigo.valeria{at}unimore.it
Received February 2, 2007; Accepted April 27, 2007
| ABSTRACT |
|---|
|
|
|---|
PRPF3 is an element of the splicing machinery ubiquitously expressed, yet mutations in this gene are associated with a tissue-specific phenotype: autosomal dominant retinitis pigmentosa (RP). Here, we studied the subcellular localization of endogenous- and mutant-transfected PRPF3. We found that (i) subcellular distribution of the endogenous wild-type protein co-localizes with small nuclear ribonucleoproteins, partially with a nucleolar marker and accumulates in speckles labeled by SC35; (ii) in human retinas, PRPF3 does not show a distinctive abundance in photoreceptors, the cells affected in RP and (iii) the RP causing mutant PRPF3, differently from the wild-type protein, forms abnormally big aggregates in transfected photoreceptor cells. Aggregation of T494M mutant PRPF3 inside the nucleus triggers apoptosis only in photoreceptor cells. On the basis of the observation that mutant PRPF3 accumulates in the nucleolus and that transcriptional, translational and proteasome inhibition can induce this phenomenon in non-photoreceptor cells, we hypothesize that mutation affects splicing factor recycling. Noteworthy, accumulation of the mutant protein in big aggregates also affects distribution of some other splicing factors. Our data suggest that the mutant protein has a cell-specific dominant effect in rod photoreceptors while appears not to be harmful to epithelial and fibroblast cells.
| INTRODUCTION |
|---|
|
|
|---|
Retinitis pigmentosa (RP) is a genetically heterogeneous disease, and can be inherited as autosomal dominant, autosomal recessive and X-linked trait. Many genes mutated in RP have a tissue-specific expression in the eye and are either components of the phototransduction cascade or of the visual cycle or structural proteins of photoreceptor cells. In contrast, in the last years, four pre-mRNA splicing factors have been linked to autosomal dominant RP. PRPF31 was found mutated in RP11 patients (1), RP13 is due to mutations in the PRPF8 gene (2), PAP-1 underlies RP9 (3) and mutations in the PRPF3 gene cause RP18 (4). RP18 patients show a typical RP phenotype starting at the end of the first decade of life (5). Two different missense mutations in English, Danish and Spanish families have been identified in the PRPF3 gene, and they are localized in two adjacent amino acids of the C-terminal portion of the protein, a region well conserved in evolution (4,6). The link between mutant PRPF3 and retinal degeneration is completely obscure. It is unclear why mutations in a ubiquitously expressed gene cause such a specific phenotype.
The yeast homologs of PRPF3, PRPF31 and PRPF8 are part of the U4/U6 + U5 spliceosome trimer. Splicing of pre-mRNA is catalyzed in the nucleus by a large ribonucleoprotein complex, the spliceosome. The spliceosome consists of pre-mRNA substrate and several small nuclear ribonucleoproteins (snRNPs) together with non-RNP splicing factors. Each snRNP particle consists of one (U1, U2 and U5) or two (U4/U6) snRNAs associated with many auxiliary proteins. The U6 snRNP is chemically modified by snoRNA in the nucleolus before its final assembly into the U6 snRNP. PRPF31 is part of U4/U6 + U5 trimer (7), whereas PRPF8 contacts both the 5' and 3' splice sites of the intron as well as U6 RNA (8). Interaction of PRPF3 protein with PRP4, a key component of the U4U6 splicing complex, defined PRPF3 as an snRNP (9). Deletion analysis of the PRPF3 protein showed that the central region (amino acids 195442) binds PRP4 in the U4U6 complex while the C-terminal part of the protein is involved in binding with snRNAs (9) and with PAP-1 (10). Not all splicing factors are always bound to pre-mRNA and assembled into active spliceosomes in vivo. Therefore, labeling of a splicing factor will detect not only sites of splicing but also sites of assembly, transport or storage. snRNPs and non-snRNP splicing factors localize in the nucleus in a characteristic speckled pattern. The pattern typically contains 2040 intensely stained speckles against a diffuse nuclear population of splicing factors. While PRPF3 is biochemically defined as snRNP, its expression pattern, subnuclear localization in mammalian cells and association with different nuclear structures have not been characterized in detail yet.
The aim of our study was to define the molecular mechanism underlying photoreceptor cell death caused by PRPF3 mutations. We show that mutations found in RP patients cause mislocalization of the PRPF3 protein in a photoreceptor cell line. Aggregation in the nucleolus of mutant PRPF3 affects nuclear distribution of other splicing factors. Aberrant behavior of mutant PRPF3 is followed by an activation of programmed cell death. This phenomenon cannot be observed in epithelial or fibroblast cell lines. We otherwise found that a similar phenotype can be caused in non-photoreceptor cells when either transcription or translation or proteasome are inhibited. Our data provide evidence that disease causing mutations are associated with aberrant protein aggregation in photoreceptors and that this may be related to defects in recycling of the pre-mRNA splicing factor.
| RESULTS |
|---|
|
|
|---|
PRPF3 localization in the retina
Previous studies based on RTPCR showed ubiquitous expression of human PRPF3 (4), but this analysis did not allow a resolution of transcript distribution at a cellular level. We therefore analyzed PRPF3 protein localization in sections of adult human retina. PRPF3 protein was localized to the nuclei of photoreceptor cells, interneurons and ganglion cells. Relatively higher levels were detected in ganglion and inner nuclear layers and lower levels in the outer nuclear layer where photoreceptors are localized (Fig. 1A). Similarly, murine Prpf3 mRNA showed an uneven distribution in the adult where a prevalent expression was detected in ganglion cells and in the inner nuclear layer (Supplementary Material, Fig. S1B). Higher levels of expression were detected 8 days after birth (P8) in the outer nuclear layer of a not fully developed retina when rods have not completed their differentiation yet (Supplementary Material, Fig. S1A).
|
Subcellular distribution of wild-type and mutant PRPF3
To characterize subcellular distribution of endogenous PRPF3, we compared PRPF3 protein localization with known proteins labeling different nuclear compartments in HeLa cells. PRPF3 co-localized with snRNPs inside the nuclei (Fig. 1BD) and also partially overlapped with splicing nuclear speckles detected with an antibody to the SC35 protein, a non-snRNP splicing factor of the SR family of proteins (Fig. 1EG). Low amount of PRPF3 was observed inside the nucleolus, as shown by co-localization with the nucleolar marker fibrillarin (Fig. 1HJ, arrow). PRPF3 staining inside the nucleolus varied from cell to cell compared with fibrillarin, suggesting that PRPF3, as other snRNPs, transiently enters the nucleolus. Conversely, we detected no co-localization of PRPF3 with coilin, which labels Cajal bodies (Fig. 1KM).
To define whether mutations found in RP patients affected localization of PRPF3, we cloned human PRPF3 in frame with EGFP at the N-terminus. The use of wild-type P493S mutant and T494M mutant tagged PRPF3 was motivated by the requirement to distinguish transfected proteins from the endogenous protein. Transfected, wild-type PRPF3 localized to the nucleus of HeLa cells with a dot-like pattern, and more abundantly in the nucleolus when compared to endogenous PRPF3 (Fig. 1N, arrow). Similar to the wild-type protein, both mutations found in patients were observed inside the nucleus of transfected cells, in dot-like structures and in the nucleolus (Fig. 1O and P). To rule out the possibility that subcellular localization of the transfected proteins was affected by the EGFP tag, we cloned wild-type and mutant PRPF3 in frame with a His tag at the C-terminus and obtained identical results (data not shown). Therefore, transfected protein localized in speckles (as seen by co-localization with SC35); however, over-expression causes storage of extra protein in the nucleolus.
Aberrant and detrimental behavior of mutant PRPF3 in a photoreceptor cell line
Wild-type and mutant PRPF3 showed a similar subcellular localization in epithelial cells in culture. However, mutations in patients cause a specific phenotype in rod photoreceptors. We therefore tested subcellular distribution in in vitro-cultured photoreceptor cells. 661W cells are a good model for in vitro studies of photoreceptors, because they are an immortalized mouse cell line derived from transgenic mice expressing the SV40 T antigen under the control of the photoreceptor specific IRBP promoter (11). These cells, under regular culture conditions, do not show a very specific morphological and molecular photoreceptor phenotype (Supplementary Material, Fig. S1C). Treatment of 661W cells with sodium butyrate, as previously reported for Y79 human photoreceptor tumor cells (12), induced differentiation as shown by elongated shape, upregulation of rhodopsin and phosphodiesterase 6ß (Supplementary Material, Fig. S1D) and reduction in the progenitor marker nestin (Supplementary Material, Fig. S1GH). Differently from Y79, treatment of 661W with sodium butyrate did not activate apoptosis (Fig. 4B and D). We also observed that sodium butyrate reduced expression of endogenous Prpf3 (Supplementary Material, Fig. S1EF). This result was in line with the observation that in vivo expression in photoreceptors decreased upon differentiation (Supplementary Material, Fig. S1AB). These findings, together with the previous characterization of this cell line (11), confirmed that 661W in the presence of sodium butyrate can be a valuable system for functional studies in photoreceptor cells. Hence, we transfected wild-type and mutant EGFP-tagged PRPF3 in 661W cells and we allowed in vitro differentiation by treatment with sodium butyrate. Wild-type PRPF3 localized to the nucleus of photoreceptors with a dot-like pattern in addition to a diffuse staining (Fig. 2AB). On the contrary, T494M mutant PRPF3 accumulated in a big aggregate inside the nucleus (Fig. 2D, arrow). Formation of big aggregates was subsequent to treatment with sodium butyrate of 661W cells (Fig. 2CD). By introducing a negatively charged residue (aspartate, T494D), which may mimic the effect of putative phosphorylation at the threonine residue (13), we generated a different mutation in amino acid 494 of PRPF3 protein. Interestingly, T494D mutant behaves like the wild-type protein (Fig. 2E). Similar results were obtained with P493S mutant protein and with differently tagged constructs (Supplementary Material, Fig. S2).
|
|
|
To define whether the mutant PRPF3 behaved abnormally also in photoreceptors in vivo, we electroporated neonatal murine eyes with the EGFP-tagged constructs and analyzed protein distribution 13 days later, when photoreceptor cells differentiated. While wild-type PRPF3 localized with a dot-like pattern inside the nuclei of electroporated photoreceptors (Fig. 3A), T494M mutant PRPF3 formed, similar to 661W cells in vitro, a big aggregate detectable inside photoreceptor nuclei (Fig. 3B).
We speculated that aggregation of a pre-mRNA splicing factor could affect distribution of other components of the splicing machinery and found SC35 in the aggregate together with the mutant PRPF3 (Fig. 2FK). Differently, no major change of other snRNPs was induced by expression of mutant PRPF3 (Fig. 2LQ).
Finally, we assessed whether aggregation of mutant PRPF3 is detrimental to photoreceptors in vitro. No TUNEL positive cells were detected after transfection of the wild-type protein with or without sodium butyrate (Fig. 4AD and I), on the contrary expression of T494M mutant PRPF3 in the presence of sodium butyrate strictly correlated with chromatin fragmentation and apoptosis (Fig. 4EH). A time course experiment showed that 12 h after transfection aggregation of T494M mutant PRPF3 could be observed in 25% of transfected cells; however, no apoptosis could be detected by TUNEL staining yet. Six hours later, the number of T494M PRPF3 expressing cells decreased compared with wild-type transfected cells, suggesting that cell demise occurred. Consistently, most of the transfected cells showed amassed nuclear T494M PRPF3 and chromatin fragmentation and 36 h after transfection no cell that expressed mutant PRPF3 could be found (Fig. 4I). Similar experiments were performed in HeLa and NIH3T3 cells (Supplementary Material, Fig. S3GL and data not shown) and, unlike as presented with 661W cell line, no indication of apoptosis was observed.
Nuclear distribution of mutant PRPF3 is affected by transcription, translation and proteasome inhibition
Aggregation of mutant PRPF3 appears to be cell specific, and this may be correlated to specific physiological conditions of differentiated photoreceptors. Previous studies showed that treatment of cells with transcriptional inhibitors reduces splicing activity and foci associated with RNA processing undergo dynamic changes, in particular, speckles labeled with SC35 become fewer, increase in size and round up (14). To determine whether localizations of wild-type and mutant PRPF3 could be affected by the transcriptional activity of the cell, transfected HeLa cells were treated with actinomycin D, inhibitor of nucleolar RNA and mRNA synthesis, or
-amanitin, inhibitor of transcription mediated by RNA polymerase II. Similar results were observed with both drugs, but a stronger phenotype was observed when both mRNA and nucleolar RNA syntheses were inhibited. Inhibition of transcription caused the wild-type PRPF3 to diffuse inside the nucleus and to lose the dot-like pattern (Fig. 5A), whereas T494M mutant PRPF3 accumulated in a single big mass (Fig. 5D). We also observed that the abnormal behavior of mutant PRPF3 caused changes in the distribution of SC35 (Fig. 5EF), preventing it to form typical big speckles (Fig. 5B). Similarly, inhibition of either protein synthesis or proteasome caused abnormal behavior of T494M mutant PRPF3 that formed big masses aggregating with SC35 (Fig. 5GR). When we analyzed the localization of other snRNPs, we found that after treatment with proteasome inhibitor, Y12 completely co-localized with wild-type PRPF3 and only partially co-localized with mutant PRPF3 in the big aggregate (Fig. 5S and T).
|
Formation of aggregates inside the nucleus was specific for these treatments. In fact, treatment with sodium butyrate, a histone deacetylase inhibitor, or thapsigargin, which inhibits ER-associated Ca2+ATPase and disrupts Ca2+ homeostasis, did not cause changes in subcellular distribution of mutant PRPF3 that behaved like the wild-type protein (Supplementary Material, Fig. S3).
We finally wanted to characterize in which nuclear compartment T494M mutant PRPF3 aggregated. We performed double labeling of transfected cells with other markers of different nuclear compartments. Mutant PRPF3 formed a single big aggregate co-localizing with nucleolar marker fibrillarin (Fig. 5U).
| DISCUSSION |
|---|
|
|
|---|
In the recent years, four genes encoding pre-mRNA splicing factors have been associated to autosomal dominant RP. They are all component of the U4/U6.U5 tri-snRNP complex, and this suggests that mutations in these genes may activate a common detrimental pathway in photoreceptor cells. The mechanism by which mutations in pre-mRNA splicing factor proteins cause the selective demise of photoreceptors is currently unknown. In fact, a direct link between the function of U4/U6.U5 tri-snRNP complex and photoreceptor cells has not been discovered, and expression analyses of these genes did not support a cell-specific function (24,15).
In this study, we report tissue and subcellular distribution of endogenous PRPF3. Protein localization experiments did not show prevalent PRPF3 expression in photoreceptors, the cells that undergo degeneration in RP patients. Subcellular distribution is consistent with previous studies characterizing PRPF3 as a pre-mRNA splicing factor (16,17). Nuclear localization was similar to other snRNPs, and also partially concentrated in speckles as shown by co-localization with the SR protein SC35. Interestingly, we observed low amounts of the protein inside the nucleolus. Some of the U4/U6.U5 tri-snRNP complex components, like U6 snRNP, are modified in the nucleolus before final assembly. Similarly, PRPF3 may require chemical modifications in the nucleolus to become active.
Our analysis of wild-type versus mutant PRPF3 brought to light an abnormal behavior of the protein subsequent to mutations found in RP patients. Interestingly, this phenotype manifested only upon differentiation to photoreceptors. This indicates that the abnormal behavior requires either a cell-specific factor expressed in differentiated rods or a metabolic change consequent to differentiation. This last hypothesis is supported by previous reports describing reorganization of subnuclear structures during neuronal differentiation (18). Of note is the observation that aggregation of mutant PRPF3 can also be caused by changes in transcriptional activities or protein translation and degradation. As spliceosome assembly is a dynamic and reversible process, it is possible that mutant PRPF3 is sensitive to the turnover determined by proteasome-mediated degradation. In fact proteasome inhibition may stabilize the dynamic interaction of mutant PRPF3 with other splicing factors in the nucleolar region. A similar effect was previously reported on interaction of Myc and PML in the nucleolus (19). Our data indicate a defect in recycling of mutant PRPF3 in these stressful conditions. It is known that in the absence of nascent RNAs, as in conditions of transcriptional inhibition, splicing factors cannot find a target and therefore they return to their storage or assembly sites (14,20). This can be visualized by rounding up of speckles containing SC35 in response to transcription inhibitors and diffuse staining of snRNP proteins. On the contrary, mutant PRPF3 amassed in big aggregates in the nucleolus and this also affects localization of SC35. Other snRNPs (sm proteins) are otherwise only marginally affected by mutant PRPF3. This can be due to specific properties of distinct splicing factors that can reside in different nuclear compartments for shorter or longer time and specifically in the nucleolus. We also observed that mutant PRPF3, from a condition similar to the wild type protein, slowly accumulated in a big protein mass close to the nucleolar region. Interestingly, this behavior is similar to the Smn protein, mutated in spinal muscular atrophy, that was shown to co-localize with fibrillarin in the nucleolus of neurons, and this raised the hypothesis of a neuronal-specific function of this protein (21). The formation of aggregates appears to be specific to the mutation Threonine 494 to Methionine, because mutation of the threonine to an acidic amino acid behaves like the wild-type protein. Noteworthy, the specific mutation T494M has been found several times in RP18 patients and no founder effect was demonstrated (4,6).
In conclusion, our data suggest that mutant PRPF3 causes mislocalization of splicing factors and forms aggregates that can be detrimental to the photoreceptor cell. We can envision the possibility that the pathogenetic mechanism is also similar for mutations in other pre-mRNA splicing factors. In fact, downregulation of PRPF31 inhibits formation of U4/U6.U5 tri-snRNP, causing accumulation of snRNPs in bigger nuclear speckles (22). Further studies are needed to define whether aggregates found with mutant PRPF3 and those caused by haploinsufficiency of PRPF31 have similar effects on other splicing factors in the nucleus and whether they impair splicing of rod-specific genes. Two possible outcomes can develop from PRPF3 mutation: the mutation leads to haploinsufficiency or the mutant protein has a cell-specific, dominant negative effect in photoreceptor cells only. With all the above evidence shown in this paper, we favor the second hypothesis. In fact, we demonstrated a detrimental behavior of mutant PRPF3 only upon differentiation of rod photoreceptor cells. Future studies will address biochemical changes underlying the formation of nuclear aggregates by mutant PRPF3.
| MATERIALS AND METHODS |
|---|
|
|
|---|
PRPF3 constructs
Human wild-type and mutant (P493S and T494M) PRPF3 were cloned using the pTriEx-1 expression vector (Novagen, La Jolla, CA, USA) using EcoRV and XhoI restriction sites.
EGFPPRPF3pTriEx-1, wild-type and T494M mutant, were generated by amplification with Pfu DNA polymerase (Promega, Milan, Italy) starting from PRPF3 in pTriEx-1 (wild type and T494M) using as primers: 5'HPRPF3: CGGAATTCGCACTGTCAAAGAGGGAGCTG and 3'HPRP3: CGGGATCCAATCACTTAGTGATGGTGATG. The PCR products were cloned using the pTriEx-1 expression vector in which EGFP was cloned at the XbaIXhoI sites to obtain a PRPF3 tagged at the N-terminal (Novagen).
T494D mutant PRPF3 was generated by DNA amplification using QuikChangeXL site-directed mutagenesis kit (Stratagene) and the mutagenized primer (5'GTTCAAGACCCCGACAAGGTAGAAGCC). Underlined characters indicate base substitutions.
Cell transfection and immunohistochemistry
HeLa cells and 661W cells (11) were grown at 37°C and 5% CO2 in DMEM supplemented with 10% FBS, penicillin (100 U/ml) and streptomycin (50 µg/ml).
HeLa cells were seeded on covereslips, whereas 661W cells were seeded on ECM substrate (Sigma, Milan, Italy) at the concentration of 104 per cm2. Cells were cultured overnight and transfected with 0.4 µg of DNA using PolyFect transfection reagent (Qiagen, Milan, Italy) according to the manufacturer's instructions. 661W cells were cultured for 1 day after transfection and then treated with 4 mM Na butyrate, 50 µM taurine and 50 ng/ml EGF.
For either transcription or translation or proteasome inhibition, 24 h after transfection, HeLa cells were treated for 6 h with either actinomycin D (5 µg/ml, Sigma) or
-amanitin (50 µg/ml, Sigma) or the proteasome inhibitor carbobenzoxy-L-leucyl-L-leucyl-L-leucinal (MG132, 50 µM in DMSO, Calbiochem, Darmstadt, Germany) or cycloheximide (0.1 µg/µl, Sigma).
As primary antibodies we used: anti-human PRPF3 (clone 4E3, MBL, Japan) 1:200, anti-His tag (Qiagen) 1:50, anti-SC35 (Sigma) 1:200, anti-Sm proteins (clone Y12, Lab Vision Corporation, Milan, Italy) 1:100, anti-Fibrillarin (72B9) 1:10 (23), anti-coilin (clone pd, Sigma) 1:100, anti-Rhodopsin (RET-P1, Sigma) 1:10 000. Slides were photographed using a Zeiss Axioplan microscope.
Immunohistochemistry was performed on cryosections of human retinas (a donation of the Italian Eye Bank, Fondazione Banca degli Occhi del Veneto Venice; two different individuals were analyzed). Retinas were incubated with anti-human PRPF3 and stained using Vectastain ABC kit (Vector laboratories, Burlingame, CA, USA) following manufacturer's instructions. Images were acquired by the AxioCam MRc camera (Carl Zeiss), using the Axiovision 3.0 software (Carl Zeiss), with a format of 1030 x 1300 pixel.
In situ hybridization
The Prpf3 antisense probe was obtained by linearization of the EST clone 5344086 (IMAGE) with EcoRI and transcription with T7 RNA polymerase. Digestion of the same plasmid with XhoI and transcription with SP6 RNA polymerase generated the sense control probe. Eyes at postnatal day 8 (P8) and 2-month-old (adult) C57BL6 mice were analyzed by in situ hybridization on sectioned tissue as described previously (24).
Retina electroporation
All procedures on mice were performed in accordance with institutional guidelines for animal research. Wild type and T494M PRPF3EGFP (PRP3EGFPpTriEx-1) were electroporated in neonatal CD1 mice. Newborn mouse pups were anesthetized by chilling on ice, and eyelids were opened using a scalpel. After piercing the sclera with a 30-gauge needle, the DNA solution (2 µg/µl) was delivered subretinally by using a Hamilton syringe as described (25). After DNA injection, five 100 V square pulses of 50 ms duration were applied with a T820 electroporation system (BTX, San Diego, USA). Electroporated retinas were harvested 13 days after electroporation, fixed with 4% paraformaldehyde in PBS over night at 4°C. After cryoprotection with 30% sucrose in PBS and embedding in gelatin, cryosections (12 µm) were cut on a cryostat. Retina sections were analyzed with Zeiss Axioplan microscope.
| SUPPLEMENTARY MATERIAL |
|---|
|
|
|---|
Supplementary Material is available at HMG Online.
| ACKNOWLEDGEMENTS |
|---|
The authors thank Dr M.R. Al-Ubaidi for providing 661W cells, the Fondazione Banca degli Occhi del Veneto for human tissue, Prof. P. Bouvet and Dr M. Karali for reagents and Dr G. Meroni for valuable discussion concerning data. This work was supported in part by research grant from Fondazione Telethon to V.M., by research grants RETNET: MRTN-CT-2003-504003 and EVIGENORET: LSHG-CT-2005-512036 from the European Community to V.M. and S.S.B. Funding support is gratefully acknowledged by S.S.B from the Foundation Fighting Blindness (USA) and the Special Trustees of Moorfields Eye Hospital, London.
Conflict of Interest statement. None declared.
| FOOTNOTES |
|---|
The first two authors should be regarded as joint First Authors. | REFERENCES |
|---|
|
|
|---|
- Vithana E.N., Abu-Safieh L., Allen M.J., Carey A., Papaioannou M.G., Chakarova C.F., Al-Maghtheh M., Ebenezer N.D., Willis C., Moore A.T., et al. A human homolog of yeast pre-mRNA splicing gene, PRP31, underlies autosomal dominant retinitis pigmentosa on chromosome 19q13.4 (RP11). Mol. Cell (2001) 8:375381.[CrossRef][ISI][Medline]
-
McKie A.B., McHale J.C., Keen T.J., Tarttelin E.E., Goliath R., van Lith-Verhoeven J.J., Greenberg J., Ramesar R.S., Hoyng C.B., Cremers F.P., et al. Mutations in the pre-mRNA splicing factor gene PRPC8 in autosomal dominant retinitis pigmentosa (RP13). Hum. Mol. Genet. (2001) 10:15551562.
[Abstract/Free Full Text] - Maita H., Kitaura H., Keen T.J., Inglehearn C.F., Ariga H., Iguchi-Ariga S.M. PAP-1, the mutated gene underlying the RP9 form of dominant retinitis pigmentosa, is a splicing factor. Exp. Cell Res (2004) 300:283296.[CrossRef][ISI][Medline]
-
Chakarova C.F., Hims M.M., Bolz H., Abu-Safieh L., Patel R.J., Papaioannou M.G., Inglehearn C.F., Keen T.J., Willis C., Moore A.T., et al. Mutations in HPRP3, a third member of pre-mRNA splicing factor genes, implicated in autosomal dominant retinitis pigmentosa. Hum. Mol. Genet. (2002) 11:8792.
[Abstract/Free Full Text] -
Xu S.Y., Schwartz M., Rosenberg T., Gal A. A ninth locus (RP18) for autosomal dominant retinitis pigmentosa maps in the pericentromeric region of chromosome 1. Hum. Mol. Genet. (1996) 5:11931197.
[Abstract/Free Full Text] -
Martinez-Gimeno M., Gamundi M.J., Hernan I., Maseras M., Milla E., Ayuso C., Garcia-Sandoval B., Beneyto M., Vilela C., Baiget M., et al. Mutations in the pre-mRNA splicing-factor genes PRPF3, PRPF8 and PRPF31 in Spanish families with autosomal dominant retinitis pigmentosa. Invest. Ophthalmol. Vis. Sci. (2003) 44:21712177.
[Abstract/Free Full Text] - Makarova O.V., Makarov E.M., Liu S., Vornlocher H.P., Luhrmann R. Protein 61K, encoded by a gene (PRPF31) linked to autosomal dominant retinitis pigmentosa, is required for U4/U6*U5 tri-snRNP formation and pre-mRNA splicing. EMBO J. (2002) 21:11481157.[CrossRef][ISI][Medline]
-
Kuhn A.N., Reichl E.M., Brow D.A. Distinct domains of splicing factor Prp8 mediate different aspects of spliceosome activation. Proc. Natl. Acad. Sci. USA (2002) 99:91459149.
[Abstract/Free Full Text] -
Gonzalez-Santos J.M., Wang A., Jones J., Ushida C., Liu J., Hu J. Central region of the human splicing factor Hprp3p interacts with Hprp4p. J. Biol. Chem. (2002) 277:2376423772.
[Abstract/Free Full Text] - Maita H., Kitaura H., Ariga H., Iguchi-Ariga S.M. Association of PAP-1 and Prp3p, the products of causative genes of dominant retinitis pigmentosa, in the tri-snRNP complex. Exp. Cell Res. (2005) 302:6168.[CrossRef][ISI][Medline]
-
Tan E., Ding X.Q., Saadi A., Agarwal N., Naash M.I., Al-Ubaidi M.R. Expression of cone-photoreceptor-specific antigens in a cell line derived from retinal tumors in transgenic mice. Invest. Ophthalmol. Vis. Sci. (2004) 45:764768.
[Abstract/Free Full Text] - Virtanen I., Kivela T., Bugnoli M., Mencarelli C., Pallini V., Albert D.M., Tarkkanen A. Expression of intermediate filaments and synaptophysin show neuronal properties and lack of glial characteristics in Y79 retinoblastoma cells. Lab. Invest. (1988) 59:649656.[ISI][Medline]
-
Chen T.J., Kuo C.B., Tsai K.F., Liu J.W., Chen D.Y., Walker A.M. Development of recombinant human prolactin receptor antagonists by molecular mimicry of the phosphorylated hormone. Endocrinology (1998) 139:609616.
[Abstract/Free Full Text] -
O'Keefe R.T., Mayeda A., Sadowski C.L., Krainer A.R., Spector D.L. Disruption of pre-mRNA splicing in vivo results in reorganization of splicing factors. J. Cell Biol. (1994) 124:249260.
[Abstract/Free Full Text] - Keen T.J., Hims M.M., McKie A.B., Moore A.T., Doran R.M., Mackey D.A., Mansfield D.C., Mueller R.F., Bhattacharya S.S., Bird A.C., et al. Mutations in a protein target of the Pim-1 kinase associated with the RP9 form of autosomal dominant retinitis pigmentosa. Eur. J. Hum. Genet. (2002) 10:245249.[CrossRef][ISI][Medline]
- Anthony J.G., Weidenhammer E.M., Woolford J.L. Jr. The yeast Prp3 protein is a U4/U6 snRNP protein necessary for integrity of the U4/U6 snRNP and the U4/U6.U5 tri-snRNP. RNA (1997) 3:11431152.[Abstract]
- Lauber J., Plessel G., Prehn S., Will C.L., Fabrizio P., Groning K., Lane W.S., Luhrmann R. The human U4/U6 snRNP contains 60 and 90 kD proteins that are structurally homologous to the yeast splicing factors Prp4p and Prp3p. RNA (1997) 3:926941.[Abstract]
- Santama N., Dotti C.G., Lamond A.I. Neuronal differentiation in the rat hippocampus involves a stage-specific reorganization of subnuclear structure both in vivo and in vitro. Eur. J. Neurosci. (1996) 8:892905.[CrossRef][ISI][Medline]
- Cairo S., De Falco F., Pizzo M., Salomoni P., Pandolfi P.P., Meroni G. PML interacts with Myc, and Myc target gene expression is altered in PML-null fibroblasts. Oncogene (2005) 24:21952203.[CrossRef][ISI][Medline]
- Sinclair G.D., Brasch K. The reversible action of alpha-amanitin on nuclear structure and molecular composition. Exp. Cell Res. (1978) 111:114.[CrossRef][ISI][Medline]
- Wehner K.A., Ayala L., Kim Y., Young P.J., Hosler B.A., Lorson C.L., Baserga S.J., Francis J.W. Survival motor neuron protein in the nucleolus of mammalian neurons. Brain Res. (2002) 945:160173.[CrossRef][ISI][Medline]
- Schaffert N., Hossbach M., Heintzmann R., Achsel T., Luhrmann R. RNAi knockdown of hPrp31 leads to an accumulation of U4/U6 di-snRNPs in Cajal bodies. EMBO J. (2004) 23:30003009.[CrossRef][ISI][Medline]
-
Roger B., Moisand A., Amalric F., Bouvet P. Repression of RNA polymerase I transcription by nucleolin is independent of the RNA sequence that is transcribed. J. Biol. Chem. (2002) 277:1020910219.
[Abstract/Free Full Text] - Buniello A., Montanaro D., Volinia S., Gasparini P., Marigo V. An expression atlas of connexin genes in the mouse. Genomics (2004) 83:812820.[CrossRef][ISI][Medline]
-
Matsuda T., Cepko C.L. Electroporation and RNA interference in the rodent retina in vivo and in vitro. Proc. Natl. Acad. Sci. USA (2004) 101:1622.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
J. J. Graziotto, C. F. Inglehearn, M. A. Pack, and E. A. Pierce Decreased Levels of the RNA Splicing Factor Prpf3 in Mice and Zebrafish Do Not Cause Photoreceptor Degeneration Invest. Ophthalmol. Vis. Sci., September 1, 2008; 49(9): 3830 - 3838. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Trifunovic, M. Karali, D. Camposampiero, D. Ponzin, S. Banfi, and V. Marigo A High-Resolution RNA Expression Atlas of Retinitis Pigmentosa Genes in Human and Mouse Retinas Invest. Ophthalmol. Vis. Sci., June 1, 2008; 49(6): 2330 - 2336. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Gonzalez-Santos, H. Cao, R. C. Duan, and J. Hu Mutation in the splicing factor Hprp3p linked to retinitis pigmentosa impairs interactions within the U4/U6 snRNP complex Hum. Mol. Genet., January 15, 2008; 17(2): 225 - 239. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






