Skip Navigation


Human Molecular Genetics Advance Access originally published online on June 13, 2007
Human Molecular Genetics 2007 16(16):1905-1920; doi:10.1093/hmg/ddm138
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/16/1905    most recent
ddm138v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (8)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lumsden, A. L.
Right arrow Articles by Richards, R. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lumsden, A. L.
Right arrow Articles by Richards, R. I.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Huntingtin-deficient zebrafish exhibit defects in iron utilization and development

Amanda L. Lumsden, Tanya L. Henshall, Sonia Dayan, Michael T. Lardelli and Robert I. Richards*

ARC Special Research Centre for the Molecular Genetics of Development and Discipline of Genetics, School of Molecular and Biomedical Science, The University of Adelaide, Adelaide SA 5005, Australia

* To whom correspondence should be addressed. Tel: +61 883037541; Fax: +61 883037534; Email: robert.richards{at}adelaide.edu.au

Received April 2, 2007; Accepted May 21, 2007


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Huntington's disease (HD) is one of nine neurodegenerative disorders caused by expansion of CAG repeats encoding polyglutamine in their respective, otherwise apparently unrelated proteins. Despite these proteins having widespread and overlapping expression patterns in the brain, a specific and unique subset of neurons exhibits particular vulnerability in each disease. It has been hypothesized that perturbation of normal protein function contributes to the specificity of neuronal vulnerability; however, the normal biological functions of many of these proteins including the HD gene product, Huntingtin (Htt), are unclear. To explore the roles of Htt, we have used antisense morpholino oligonucleotides to observe the effects of Htt deficiency in early zebrafish development. Knockdown of Htt expression resulted in a variety of developmental defects. Most notably, Htt-deficient zebrafish had hypochromic blood due to decreased hemoglobin production, despite the presence of iron within blood cells. Furthermore, transferrin receptor 1 transcripts were increased, suggesting cellular iron starvation. Provision of iron to the cytoplasm in a bio-available form restored hemoglobin production in Htt-deficient embryos. Since erythroid cells acquire iron via receptor-mediated endocytosis of transferrin, these results suggest a role for Htt in making endocytosed iron accessible for cellular utilization. Iron is required for oxidative energy production, and defects in iron homeostasis and energy metabolism are features of HD pathogenesis that are most pronounced in the major region of neurodegeneration. It is therefore plausible that perturbation of Htt's normal role in the iron pathway (by polyglutamine tract expansion) contributes to HD pathology, and particularly to its neuronal specificity.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Huntington's disease (HD) is a dominant, progressive neurodegenerative disorder characterized by cognitive deficits, choreic involuntary movements, mood disturbances and weight loss, despite adequate dietary intake. HD is caused by the expansion of an unstable CAG trinucleotide repeat within the coding region of the HD gene (also known as IT15), resulting in an expanded polyglutamine tract in the encoded protein, Huntingtin (Htt). HD is one of nine diseases caused by expansion of polyglutamine tracts in different proteins, the others being spinobulbar muscular atrophy (SBMA), dentatorubral pallidoluysian atrophy and spinocerebellar ataxias (SCAs) 1, 2, 3, 6, 7 and 17. Features common to these disorders include delayed onset neurodegeneration and dominant inheritance. Furthermore, the age of onset of clinical symptoms decreases with increasing repeat copy number. Largely due to the dominant inheritance of these diseases, it is generally believed that the expanded polyglutamine tract confers a toxic gain-of-function upon each affected protein. This notion has been supported by findings that expression of disease-length polyglutamine tracts within truncated Htt fragments or in isolation causes cellular dysfunction and/or cell death in a variety of model systems, including mouse (1), nematode (2), zebrafish (3,4), Drosophila (5,6), Saccharomyces (7) and cultured neurons (8).

However, in the human polyglutamine diseases, despite the proteins having widespread and overlapping patterns of endogenous expression, only a subset of neurons is most prone to degeneration. Furthermore, a different subset of neurons degenerates from one disease to the next, as reflected in variable clinical features. It is likely that the unique specificities of neuronal vulnerability in each of these diseases are mediated somehow by the different protein contexts in which the polyglutamine tracts reside. There is increasing evidence that unique attributes of the affected proteins, outside of the polyglutamine tract, are critical for neurodegeneration. For example, in SCA1, neurodegeneration is dependent upon the phosphorylation of a serine residue within the mutant protein, ataxin-1 (9). In SBMA, nuclear translocation of the mutant androgen receptor upon binding of its ligand, testosterone, is required for neurodegeneration (10). In SCA6, the polyglutamine expansion perturbs the normal function of the calcium channel subunit in which it resides (11,12) leading to symptoms that resemble those of other channelopathies unrelated to polyglutamine (13). Currently, the normal functions of many of the proteins affected in polyglutamine diseases (including Htt) are unclear. Further understanding of their normal functions and the biological processes in which they are involved is likely to provide further insight into the molecular pathway(s) underlying pathology in these diseases.

In HD, although the expanded Htt allele (like wild-type Htt) is expressed throughout the brain, a hierarchy of neuronal vulnerability to degeneration exists. Characteristically, HD neuropathology is most striking in the striatum, where medium spiny {gamma}-aminobutyric acid (GABA)-utilizing neurons that project to the substantia nigra and globus pallidus are gradually, and selectively, lost (14,15). Neurons in the deeper layers of the cerebral cortex are also vulnerable, and pathology has been observed to a lesser extent in other regions of the brain, while some areas, also expressing the mutant protein, seem relatively unaffected. What determines this hierarchy of sensitivity to expanded mutant Htt has not yet been established.

In the HD striatum, decreased glucose metabolism is observed prior to the bulk of cell loss (and clinical symptoms) (16–18), supporting the notion that cellular dysfunction precedes cell death. Signs of decreased oxidative respiration are evident in this region, including a reduction in activities of the citric acid cycle enzyme, aconitase (19), and mitochondrial respiratory complexes II–IV (20,21). Consistent with these findings, decreased striatal oxygen consumption (22) and increased lactate concentrations in the basal ganglia and occipital cortex have also been reported (23,24). Other abnormalities observed in the HD striatum include increased excitotoxicity (25), accumulation of iron (26–29) and markers of oxidative stress (30). The underlying mechanism by which expanded mutant Htt triggers these effects and why the striatum is most vulnerable is unknown.

Htt is a relatively large protein (~350 kDa) that has a widespread distribution throughout the human body suggesting that it plays a ubiquitous role that is not limited to neurons. Within the cell Htt is mostly found in the cytoplasm where it is concentrated in the perinuclear region (31,32), although it has also been detected in dendrites and nerve endings (33,34) and within the nucleus (35–38). Htt associates with a variety of cellular structures and organelles including the plasma membrane, clathrin-coated and non-coated vesicles, endosomes, endoplasmic reticulum, Golgi complex, mitochondria and microtubules (31,33,39–44). This wide variety of associations and lack of distinct compartmentalization has not made the role of Htt immediately clear.

Since the identification of the HD gene 14 years ago (45), Htt has been implicated in a large variety of cellular processes including apoptosis, endocytosis, vesicle trafficking, transcriptional regulation and dendrite formation (reviewed in 46,47). Studies in mouse have revealed a dose-dependent response to Htt depletion. While a single active allele of the mouse orthologue (Hdh) is sufficient for healthy development (48–50), a hypomorphic Hdh allele resulting in a reduction of Htt levels to one-third of wild-type levels produces severe cranial and brain abnormalities leading to lethality around the time of birth (51). Homozygous inactivation of the Hdh gene leads to early embryonic lethality (48–50) associated with increased apoptosis (48) and disrupted transport of maternal nutrients into the fetus (52). In a conditional mouse model, postnatal Hdh inactivation in the forebrain and testes results in cellular dysfunction and cell death in those regions (53). These findings indicate that Htt plays a vital role and is critical for cellular viability.

Past investigations of Htt function in vivo have been somewhat limited by the lack of a viable mouse model of Htt deficiency. Here a novel approach is taken by using antisense methodology [morpholino oligonucleotides (MOs)] to transiently ‘knock down’ hd gene function in early zebrafish development. A major advantage of using the zebrafish/MO system is that zebrafish produce optically transparent embryos that develop externally, allowing the morphological effects of Htt knockdown to be observed in live embryos, non-invasively, under the microscope. Furthermore, the MO method of gene knockdown enables the extent of inhibition to be adjusted by modifying the dose of MOs administered, thus allowing the effects of partial Htt depletion to be investigated. This study investigates the effects of Htt-deficiency in zebrafish, in the hope that characterization of the resulting phenotypes might provide further insight into the normal biological role of Htt, and provide some insight into whether perturbation of this normal function is capable of contributing to the specificity of neuronal vulnerability seen in HD. Our findings reveal a requirement for Htt in cellular iron utilization.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Expression pattern of the hd gene in early zebrafish development
The Htt protein encoded by the zebrafish orthologue of the HD gene (hd) has been detected at high levels in late embryonic development (54). To visualize the expression pattern of the hd gene in early zebrafish development, whole-mount in situ hybridization was performed on embryos of various stages from 1-cell to 48 h post-fertilization (hpf; Fig. 1A–F). Zebrafish hd transcript was detected at the 1-cell stage, prior to the onset of zygotic expression [which starts between 2.3 and 5.3 hpf (55)] and is therefore maternally deposited. Distribution of the hd transcripts was uniform throughout the embryo during gastrulation (Fig. 1B), but as development progressed, expression decreased in non-neural tissues and was strongest in the head. This pattern of zebrafish hd mRNA distribution is consistent with the early uniformity (49,52,56) and subsequent down-regulation in non-neuronal tissues (56) of Hdh mRNA expression in rodent development. It is also similar to that of many ‘housekeeping’ genes (57), normally associated with the maintenance of a basal cellular function (58).


Figure 1
View larger version (99K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 1. Whole-mount in situ hybridization of hd mRNA (stained purple) in early zebrafish development. (A) Zebrafish hd transcript was detected at the 1-cell stage, prior to the onset of zygotic expression, and is therefore maternally deposited. (B) Distribution of hd transcript was found to be uniform throughout gastrulation (10 hpf shown). (C–F) From 18 to 48 hpf expression was detected more strongly in the head, with weaker signal in the trunk/tail. In images (E) and (F), dark brown melanophores are visible.

 
Knockdown of zebrafish Htt function
Given the early expression of hd in zebrafish, and that Hdh knockout mice die during embryonic development (48–50), it was hypothesized that depleting, rather than eliminating, Htt protein in zebrafish embryos using antisense translation inhibitors (MOs) would have a detrimental, yet diminished, effect on zebrafish development and produce phenotypes that would provide insight into the normal role of Htt. Two non-overlapping MOs (hdMO1 and hdMO2) were designed to specifically target the hd translation initiation codon and 5'-UTR. As negative controls, either a standard negative control morpholino (cMO), or a mispair control morpholino (hdMO1 with 5 base modifications out of 25; mcMO1) were used. Neither of the control MOs produced any morphological consequences upon injection at the 1-cell stage zebrafish embryos, at the concentrations used in this study.

To test the effectiveness of the hdMOs at binding the hd transcript and blocking downstream translation, an EGFP reporter construct (hd(1.2):EGFP) driven by 1.2 kb of hd 5' sequence (encompassing the hdMO target region) was generated. Injection of hd(1.2):EGFP (0.2 ng) at the 1-cell stage, resulted in strong fluorescence at 10 hpf due to mosaic EGFP expression (100%, n = 45; Fig. 2A). Co-injection of cMO (21 ng) with hd(1.2):EGFP did not affect EGFP expression (100%, n = 28; Fig. 2B), but co-injection of a mixture of hd(1.2):EGFP and either hdMO1 or hdMO2 (21 ng) inhibited EGFP expression (hdMO1: 0%, n = 39; hdMO2: 0%, n = 27; Fig. 2C and D). These results showed that both hdMO1 and hdMO2 were each able to bind their hd-specific target sequence and prevent translation.


Figure 2
View larger version (39K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 2. Specific knockdown of an EGFP reporter or endogenous Htt by hd-targeted morpholinos and the phenotype of Htt-deficient zebrafish. To test the effectiveness of the MOs at binding the transcript and blocking downstream translation, an EGFP reporter construct driven by DNA sequence upstream from the zebrafish hd coding region (hd(1.2):EGFP, encompassing the hdMO target region) was used. (A) Injection of hd(1.2):EGFP at the 1-cell stage, resulted in strong fluorescence at 10 hpf due to mosaic EGFP expression. (B) This expression was unaffected when hd(1.2):EGFP was co-injected with 21 ng of cMO. Co-injection of hd(1.2):EGFP with 21 ng of hdMO1 (C) or hdMO2 (D) inhibited EGFP expression. (E) To confirm a reduction in endogenous Htt levels, antibodies raised against the N-terminus of zebrafish Htt were used. Western blot analysis of Htt expression in lysates prepared from 48 hpf embryos shows that Htt is markedly reduced in embryos injected with 21 ng hdMO1 in comparison with uninjected, or 21 ng cMO-injected embryos. Actin loading control also shown. Zebrafish embryos injected at the 1-cell stage with 21 ng of either cMO (F, I, L, Q), hdMO1 (G, J, M, N, R, S) or hdMO2 (H, K, O, P, T, U) were examined at 24 hpf (F–H), 26 hpf (I–K), 48 hpf (L–P) and 96 hpf (Q–U). The cMO-injected embryos show normal embryonic development (F, I, L, Q). At 24 hpf embryos treated with hdMO1 or hdMO2 exhibit brain necrosis (G, H; arrowhead) and failure to enlarge ventricles (G, H; arrows) compared with cMO embryos (F). Visible regions of the brain are labeled in (F): cb, cerebellum; hv, hindbrain ventricle; fv, forebrain ventricle; me, mesencephalon; mv, midbrain ventricle; nc, neural crest; op, olfactory placode; ret, retina; te, telencephalon. At 26 hpf, the YE is pronounced in the control embryos (I) but thinner in Htt-deficient embryos (J, K). At 48 hpf, Htt-deficient embryos lack the YE and have delayed pigmentation and small eyes (M–P) in comparison with control embryos (L). The more strongly affected embryos exhibit tail abnormalities such as curling (N) or truncation (P). By 96 hpf, Htt-deficient embryos have small heads and eyes, and the normal alignment of melanophores along the trunk (Q, arrows) is disrupted (R–U). Pericardial edema is often seen (for example, R, arrowhead). The more severely affected embryos are shorter and ventrally curved (S, U). Images (F–H) are dorsal views of live embryos within their chorion. Images (I–U) are lateral views of live embryos that were manually dechorionated.

 
In addition, antibodies raised against the N-terminus of zebrafish Htt were used to confirm a reduction in endogenous Htt levels. Embryos were injected at the 1-cell stage with cMO or hdMO1 (21 ng) and extracts were prepared from these and wild-type uninjected embryos after 48 hpf. Western blot analysis with the antisera showed that Htt expression was greatly reduced in embryos injected with hdMO1 compared with uninjected or cMO-injected embryos (Fig. 2E).

Developmental consequences of Htt depletion in zebrafish
To investigate the normal role of Htt in development, hdMO1 or hdMO2 (21 ng) was injected into 1-cell embryos and examined during early development. The same spectrum of phenotypes was produced using either hdMO1 or hdMO2, indicating specificity of Htt knockdown. Early in development, throughout gastrulation, somitogenesis and early neurulation (formation of the neural plate, neural keel and notochord), Htt-deficient embryos appeared similar to cMO-injected embryos. By 18 hpf, Htt-deficient embryos often exhibited slight growth delay. Brain necrosis was seen at this time, and persisted at 24 hpf when it was also evident that the brain ventricles had not enlarged as they had in control embryos (Fig. F–H). At 26 hpf (Fig. 2I–K) the yolk extension (YE) was notably thinner than in control embryos and had disappeared in the majority of hdMO-injected embryos by 48 hpf (Fig. 2L–P). At this stage, Htt-deficient embryos were shorter, and had delayed or paler pigmentation of melanophores, small head and eyes and pale or colorless blood. In more severely affected embryos, the tail was often twisted and/or truncated (Fig. 2N and P). By 96 hpf, the melanophores had developed in color, but their patterning along the length of the body was obviously disrupted (Fig. 2Q–U). The body was also thinner than control embryos, and appeared necrotic. At this stage, the hdMO-injected embryos appeared to have poorly formed jaw and branchial arch structures and the swim bladder had not inflated as it had in cMO-injected embryos by this time. These phenotypes were often accompanied by pericardial edema (Fig. 2R).

Since Htt deficiency had such a global effect on zebrafish development it was difficult to ascertain which aspects of the morphant phenotype were primary effects of Htt depletion and which were secondary consequences. To address this issue, a lower morpholino dose (8.5 ng/embryo) was used. Injection of hdMO1 or hdMO2 at this lower dose produced milder effects in comparison to the higher dose (21 ng), indicating a dose-response to the hdMOs. When the lower dose was injected, pericardial edema, brain necrosis and tail curvature were very rarely observed among morphant embryos. While decreased eye size and disrupted pigment alignment were frequently seen at later stages (72–96 hpf) (Fig. 3L compared with H), the most common morphological defects among embryos injected with the lower morpholino dose were the thin YE (for example, Fig. 3H compared with I) and blood hypochromia (Fig. 3B compared with A). The hypochromic appearance of the blood was not due to a lack of red blood cells since similar cell numbers were seen circulating in Htt-deficient and wild-type embryos (Fig. 3C and D). Rather, the blood cells were lacking red pigment (Fig. 3B). All further morpholino experiments were performed using this lower dose (8.5 ng/embryo).


Figure 3
View larger version (126K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 3. hd mRNA is expressed in erythroid tissue, and Htt knockdown leads to blood hypochromia in early development due to transient suppression of hemoglobin production. (A and B) Blood flowing through the heart (he) of hdMO1-injected embryos (72 hpf) is pale (B), in comparison with wild-type blood (A). Lateral view shown, rostral to the left. (C and D) Similar numbers of blood cells are visible circulating across the yolk of wild-type uninjected embryos (C) and embryos treated with 8.5 ng hdMO1 (D), at 36 hpf. Boxed area in the insets indicates the magnified region. Arrows indicate an example of a single blood cell in each image. (E–G) In comparison with notch2 mRNA expression that is not detected in the ICM at 22 hpf (E), hd mRNA is expressed in the ICM (and throughout the tail) at 22 hpf (F). At 36 hpf hd mRNA expression is increased in the posterior ICM above basal expression throughout the rest of the tail (G). (H–O), Hb was detected by o-dianisidine staining in zebrafish embryos injected with 8.5 ng of cMO (H–K) or hdMO1 (L–O). At 33 hpf, Hb production was suppressed in hdMO1-injected embryos [lateral (L) and ventral (M) views of a representative embryo] in comparison with cMO-injected embryos (H, I). By 72 hpf, Hb levels in hdMO1-injected embryos (N, O) returned to a level similar to cMO-injected control embryos (J, K).

 
The various characteristics of the Htt morphant phenotype were compared with those of zebrafish genetic mutant phenotypes listed on the Zebrafish Information Network database (www.zfin.org). Aspects of the Htt morphant phenotype such as brain (or CNS) necrosis, pericardial edema, small head and eyes and thin YE were found to occur frequently among zebrafish genetic mutant strains with defects in housekeeping genes, and thus did not reveal any obvious hints as to Htt function. The blood hypochromia, however, is observed in mutants with deficits in hemoglobin (Hb) production (59,60) and is often caused by a disruption in iron metabolism (61–63). This phenotype of Htt morphant embryos was intriguing since wild-type Htt has been previously implicated in iron homeostasis and hematopoiesis in cultured cells (64,65), and also in the transport of nutrients such as iron across the visceral endoderm from maternal to embryonic tissues in the mouse fetus (52). Furthermore, expression of ß globin (embryonic ßH-1 and adult ß) has been shown to be increased in hematopoietic cells derived from an Hdh knockout mouse model (64), suggesting that the hypochromia phenotype in Htt-deficient zebrafish was unlikely to be caused by a defect in globin expression. Htt-deficient zebrafish also showed no evidence of porphyric blood photosensitivity or blood autofluorescence characteristic of zebrafish with mutations affecting enzymes downstream of the initial Alas2-catalyzed step in mitochondrial heme biosynthesis (66,67).

Expression of hd mRNA in zebrafish erythroid tissue
Zebrafish embryos hybridized with hd mRNA probe were examined to see if hd is normally expressed in erythroid cells that manufacture Hb, as this would be consistent with Htt having a role in these cells. Zebrafish hematopoiesis occurs in two successive waves, ‘primitive’ and ‘definitive’ as it does in other vertebrates (68). The primitive wave of hematopoiesis produces predominantly erythroid cells that begin to circulate at 24–26 hpf. It is this period of zebrafish hematopoiesis that was examined in the current study. The site of primitive zebrafish erythropoiesis is the intermediate cell mass (ICM), which is analogous to extraembryonic yolk sac blood islands of mammals and birds.

hd mRNA was detected ubiquitously throughout the tail, including the ICM at 22 hpf, prior to the onset of circulation of erythroid cells (Fig. 3F). Expression is shown in comparison to notch2 expression, which is detected in somites but is notably absent in the ICM (Fig. 3E). At 36 hpf hd mRNA was also detected in the posterior ICM (Fig. 3G) more strongly than the basal expression in the rest of the tail. By this time, the majority of circulating cells are of the erythroid lineage, although hematopoietic activity in the ICM tissue is not exclusively erythroid (68). Expression of hd mRNA in the ICM is consistent with Hdh gene products having also been detected in a range of mouse hematopoietic tissues (64).

Transient knockdown of hemoglobin production
While the color of embryonic erythroid cells gives a general indication of Hb levels, o-dianisidine staining is a more sensitive and definitive method for detecting Hb. The basis of this assay is that Hb catalyzes the H2O2-mediated oxidation of o-dianisidine, producing a dark red stain in Hb-positive cells. To assess Hb levels in Htt morphant zebrafish, embryos were injected with 8.5 ng of hdMO1 or cMO, and were collected at 33 or 72 hpf for o-dianisidine staining. At 33 hpf, a marked reduction in Hb production was observed in the blood cells of Htt-deficient embryos (Fig. 3L and M) when compared with control embryos (Fig. 3H and I). Very weak staining was detectable in the blood cells of the Htt morphants at this stage, however, confirming that the general low level of staining was not due to an absence of these cells. By 72 hpf, all morphant zebrafish exhibited strong o-dianisidine staining in the blood, similar to control embryos (Fig. 3J and K, compared with N and O), indicating that suppression of Hb production was transient.

Iron staining in whole embryos and isolated blood cells
In the zebrafish embryo, iron is absorbed from maternally derived stores in the yolk (63) and erythroid cells endocytose iron from the plasma as transferrin (Tf) via the Tf receptor (TfR) (61). To investigate the possibility that the decrease in Hb levels could be due to a disruption in iron transport, DAB-enhanced Prussian blue staining was used to detect the presence of ferric iron in morphant and control embryos (52, also see Materials and Methods) in order to assess any differences in iron distribution.

At 36 hpf, ferric iron was detected throughout the animal (non-yolk) part of Htt-deficient embryos at a level at least the same, and in many cases higher, than in wild-type embryos (Fig. 4A and B). In wild-type embryos, ferric iron was also present in the peripheral layer that surrounds the yolk sac, presumably representing the yolk iron stores (100%, n = 52/52; Fig. 4A, arrow). Embryos injected with hdMO1 frequently lacked staining in this region (Fig. 4B, arrow), with only 54% staining positively in the yolk syncytial layer (n = 32/59). All hdMO1-injected embryos that lacked iron staining in the yolk also had a thin YE. These results suggested that more iron was being absorbed from the maternally derived yolk stores in Htt morphant embryos, and indicated that hypochromia was not due to impaired uptake of iron from the yolk.


Figure 4
View larger version (61K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 4. Histochemical staining for ferric iron, detected by DAB-enhanced Prussian blue staining (reddish brown). Histochemical ferric iron staining was examined in 36 hpf wild-type embryos (A, C, D', D'') and embryos injected with 8.5 ng of hdMO1 (B, E, F', F''). Ferric iron was detected throughout wild-type (A) and Htt-deficient (B) embryos. Ferric iron present in the yolk syncytial layer in wild-type embryos (A, arrow) was frequently absent in hdMO1-injected embryos (B, arrow). Blood cells visible in the ventral tail region of hdMO1-injected embryos (E, arrowheads) appeared to stain more strongly for ferric iron than blood cells in wild-type embryos (C). At higher magnification, round basophilic blood cells identified by Nomarski optics (D' and F', arrowheads) stained positively for ferric iron, as viewed using bright-field optics (D'', F'', arrowheads). Blood cells extracted at 33 hpf from embryos injected with 8.5 ng of hdMO1 (H) appeared to contain at least as much ferric iron as blood cells from mcMO1-injected control embryos (G). Scalebars represent 10 µM.

 
Blood cells visible in the ventral tail region of morphant embryos (predominantly of the erythroid lineage at this stage) stained positively for ferric iron suggesting that iron was able to enter the Htt-deficient blood cells (Fig. 4C–F). To examine blood iron staining more closely, embryos were injected with hdMO1 or mcMO1 (mispair control MO), and blood cells were extracted at 33 hpf, for DAB-enhanced Prussian blue staining. The Prussian blue staining procedure detects ferric iron (Fe3+) which is the stable state of iron in most of its biological complexes (including when it is bound to Tf). Hb, however, utilizes ferrous iron, so Prussian blue staining ought not detect iron in Hb. Ferric iron was detected both in control and Htt-deficient blood cells, and staining did not appear to be decreased in Htt-deficient cells (Fig. 4G and H). Since erythrocytes acquire iron for Hb exclusively via TfR-mediated endocytosis of Tf (61), this placed the disruption of Hb production downstream of TfR-mediated endocytosis of iron in the Htt-deficient blood cells. This is consistent with the previous finding that Htt is not required for the endocytosis of TfR and Tf (65).

Rescue of hypochromia and thin YE phenotypes by provision of iron to the cytoplasm
Following the detection of iron within the blood cells of Htt-deficient embryos, it was hypothesized that Htt may be required for rendering this intracellular iron available for cellular use (perhaps by facilitating iron release from the endocytic compartment). If this were the case, then provision of bio-available iron to the cytoplasm ought to bypass the need for Htt, and thereby rescue the hypochromic phenotype of Htt-deficient embryos.

A ‘targeted rescue’ experiment was therefore performed, based on a technique used to rescue the hypochromic phenotype of chianti genetic mutant zebrafish (61). In zebrafish, gene duplication has given rise to two isoforms of TfR1: an erythroid specific isoform encoded by tfr1a and a ubiquitously expressed isoform encoded by tfr1b. In chianti mutants, hypochromia is caused by a mutation in the blood specific tfr1a gene resulting in the inability of blood cells to absorb iron (as Tf) from the plasma (61). Hb production is restored in these embryos by injection of iron-dextran into the cytoplasm at the 1-cell stage such that all cells of the developing chianti embryos contain bio-available iron in the cytoplasm, hence circumventing the need for trf1a function (61).

To test whether provision of bio-available iron to the cytoplasm would restore Hb production in Htt-deficient embryos, iron-dextran was co-injected with hdMO1 (8.5 ng) at the 1-cell stage. Uninjected control embryos, hdMO-injected embryos, and embryos co-injected with hdMO1 and 100 ng iron-dextran were stained with o-dianisidine at 33 hpf (Fig. 5A–F) and were scored with regards to Hb production and YE status (Fig. 5G, Experiment 1). All wild-type embryos (n = 20/20) had a normal YE and exhibited robust Hb staining. The number of embryos with normal Hb levels was reduced to 14% (n = 3/22) in hdMO1-injected embryos, and co-injection of iron-dextran rescued to 62% (n = 13/21). Interestingly, iron supplementation also rescued the YE phenotype from 5% normal YE in morphants (n = 1/22) to 71% normal YE (n = 15/21) in the rescue group (Fig. 5F).


Figure 5
View larger version (48K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 5. Provision of iron to the cytoplasm rescues hypochromia and reduced YE phenotypes in Htt-deficient embryos. Detection of Hb (by o-dianisidine) in 33 hpf embryos that were either uninjected (control) (A, ventral; B, lateral), injected with 8.5 ng of hdMO1 (knockdown) (C and D) or both hdMO1 and iron-dextran (Fe; rescue) (E and F). Representative embryos are shown. The thin YE of Htt-deficient embryos (D) is restored to normal size in iron-supplemented embryos (F). (G) Raw data from iron rescue experiments. In both experiments, hdMO1 dose was 8.5 ng. In Experiment 1, control embryos were uninjected; and 100 ng of iron-dextran was co-injected with hdMO1 in the rescue group. In Experiment 2, control embryos were injected with 8.5 ng of mcMO1, and 50 ng of iron-dextran was co-injected with hdMO1 in the rescue group.

 
Similar results were achieved in a second rescue experiment (Fig. 5G, Experiment 2), this time using greater population numbers, and using mcMO1-injected embryos as the control group. The MO dose was the same as the previous experiment (8.5 ng); however, the dose of iron-dextran used for the rescue was halved (50 ng). All control embryos (mcMO1-injected) had a normal YE and robust Hb staining (n = 47/47). The number of embryos with normal Hb levels was reduced to 20% (n = 10/49) in hdMO1-injected embryos, and co-injection of iron-dextran rescued to 66% (n = 29/44). Only 6% of hdMO1-injected embryos had a normal YE (n = 3/49), and iron supplementation was able to increase the number of embryos with a normal YE to 48% in the rescue group (n = 21/44). The ability of the addition of cytoplasmic iron to restore Hb production and rescue the thin YE phenotype supports the hypothesis that Htt knockdown causes cellular iron deficiency.

Morpholino effectiveness is not diminished by iron-dextran treatment
To ensure that iron-dextran did not decrease hdMO1 function, the hd(1.2):EGFP reporter construct (used earlier to demonstrate hdMO-mediated translation knockdown) was co-injected with 8.5 ng of either cMO, hdMO1 or both hdMO1 and iron-dextran (200 ng). All cMO+hd(1.2):EGFP embryos exhibited mosaic EGFP expression at 10 hpf (n = 29/29). No fluorescence was observed in either the hdMO1+hd(1.2):EGFP embryos (n = 0/20) or hdMO1+hd(1.2):EGFP+iron-dextran embryos (0/18), indicating that the ability of hdMO1 to bind the hd target sequence and prevent translation was not inhibited by the presence of iron-dextran (data not shown).

Htt-deficiency leads to an increase in TfR1 mRNAs
The results presented so far suggest that although iron is detected within the blood cells of Htt-deficient embryos, insufficient iron is available for cellular use, hence the decrease in Hb production. To further validate this model, quantitative real-time PCR (qPCR) methodology was used to examine the levels of TfR1 mRNA transcripts in Htt-deficient and control embryos. Since cells typically respond to iron starvation by up-regulating expression of TfR1 (69), it was predicted that levels of TfR1 mRNAs would be increased in Htt-deficient embryos. Levels of transcripts from both zebrafish paralogues of the TfR1 gene, tfr1a (erythroid specific) and tfr1b (ubiquitous) were each examined in embryos injected with 8.5 ng of hdMO1 or mcMO1 (mispair control MO), and wild-type uninjected control embryos, at 33 hpf. Levels of tfr1a and tfr1b transcripts were normalized to transcript levels of acta1 (GenBank accession no. NM_131591), encoding actin alpha 1. Normalized tfr1a and tfr1b triplicate values from three independent experiments are represented graphically in Figure 6. One hdMO1/tfr1b value was considered to be an obvious outlier (indicated in Fig. 6B), and was excluded from further statistical analyses.


Figure 6
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 6. Levels of tfr1a and tfr1b transcripts are increased in response to Htt knockdown. Quantitative PCR was used to compare the levels of tfr1a (A and C) and tfr1b (B and D) transcripts in zebrafish embryos injected with either mcMO1 or hdMO1, and uninjected embryos. Levels of tfr1a and tfr1b transcripts were normalized to the level of acta1 transcript. Normalized triplicate values from three independent experiments are graphically represented for tfr1a transcript levels (A) and tfr1b transcript levels (B). A data point that was considered an outlier is indicated (B). In (C and D), the same data shown in (A and B), excluding the outlier, is represented in box-plot format. The ‘box’ contains the middle 50% of the data (with the upper and lower edges representing the 75th and 25th percentiles, respectively), the ‘horizontal line’ within the box represents the median value. The dotted lines, or ‘whiskers’, indicate minimum and maximum data values for each embryo class, unless data points extend further than 1.5 times the inter-quartile range, in which case these values are represented as individual points, as in (C).

 
Increased levels of TfR1 transcripts were observed in hdMO1-treated embryos in each of the experiments. Statistical analyses were performed on the collated normalized data. Analysis of variance (ANOVA) revealed a significant effect (P < 0.001) due to different embryo treatments. Subsequent Student's t-tests indicated that in hdMO1-injected embryos, the level of erythroid specific tfr1a transcript was significantly increased in comparison to mcMO1-injected (P < 0.0002) and uninjected (P < 0.002) embryos. Furthermore, the level of ubiquitous tfr1b transcript was also significantly increased in hdMO1-injected embryos in comparison to mcMO1-injected (P = 0.032) and uninjected (P < 0.008) embryos, thus indicating that the role of Htt in intracellular iron homeostasis is not limited to erythroid cells. These findings offer strong support for cellular iron starvation in Htt knockdown embryos, and provide in vivo validation of a previous report that embryonic stem (ES) cells lacking Htt [derived from a homozygous knockout mouse model (49)] have increased TfR1 protein levels (65).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
HD and eight other late-onset neurodegenerative disorders are caused by the abnormal expansion of a polyglutamine repeat within their respective, otherwise unrelated disease proteins. A different subset of neurons is vulnerable in each disease despite mostly widespread and overlapping patterns of protein expression. It is suspected that the unique properties of the host proteins mediate the specificity of neuropathology in these diseases. In HD, the primary site of neurodegeneration is the striatum, even though Htt is expressed throughout the brain. Within the striatum, medium-sized spiny projection neurons are selectively lost. As yet, studies into Htt function have not revealed an explanation for the specificity and dominant inheritance of HD pathology.

To gain a new perspective into the normal function of Htt, we have examined the effects of Htt depletion in early zebrafish development. Knockdown of Htt produced symptoms of cellular iron deficiency, including decreased hemoglobin in the blood, increased erythroid and ubiquitous transferrin receptor transcript levels and exhausted maternal iron stores in the yolk. These findings implicate Htt in cellular iron acquisition, and since blood cells from Htt morphants stained positively for ferric iron, Htt is likely to act downstream of TfR-mediated endocytosis. Consistent with a role for Htt in cellular iron acquisition, wild-type ES cells have been shown previously to up-regulate Htt levels in response to iron chelation (65).

Provision of iron in a bio-available form to the cytoplasm restored hemoglobin production in Htt-deficient zebrafish embryos and also rescued the thin YE phenotype. The thin YE is a characteristic of previously described genetic mutant zebrafish lines that have defects in housekeeping genes, such as those encoding polymerases, ribosomal proteins, RNA processing factors and translation initiating factors (70) and is therefore likely to be a consequence of general cellular dysfunction. It is interesting to note, however, that while genetic mutation of the erythroid specific tfr1a gene in chianti zebrafish results in hypochromic blood, morpholino-mediated knockdown of the ubiquitous tfr1b isoform in zebrafish embryos causes phenotypes including thin YE, small head and eyes, CNS necrosis and an overall morphology that is similar to Htt morphants, indicating that these phenotypes can result from cellular iron deficiency.

Further studies are required in order to elucidate the exact role of Htt in making iron accessible for cellular use. However, since erythroid cells acquire iron for Hb production solely by TfR-mediated endocytosis (61), a plausible explanation for intracellular iron not being available for Hb production in Htt-deficient cells is that this iron has not been released from endocytic vesicles (Fig. 7). It could therefore be envisioned that Htt might play a role in the targeting, transport and/or fusion of iron-containing endocytic vesicles to acidic early endosomes for iron release into the cytosol. Recently, Htt has been shown to interact with the small GTPase Rab5 on early endosomes, via Htt binding partner, HAP40 (71). Interestingly, Rab5 is a key regulator of the targeting and fusion of endocytic vesicles to early endosomes, and the attachment of endosomes to, and transport along microtubules (72), thus supporting a role for Htt in these processes.


Figure 7
View larger version (33K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 7. Schematic model illustrating how disruption of hemoglobin production in Htt-deficient zebrafish blood cells is rescued by provision of bio-available iron (iron-dextran) to the cytoplasm. In normal cells, binding of iron-loaded transferrin (Tf) to the transferrin receptor (TfR) on the plasma membrane initiates clathrin-mediated endocytosis of the receptor/ligand complex into endocytic vesicles that then lose their clathrin coat and fuse to early endosomes (115). The decreased internal pH of the early endosome causes iron to disassociate from apo-Tf/TfR, facilitating its release into the cytoplasm via divalent metal transporter, DMT1 (116). Once released, iron enters the mitochondria where it is incorporated into haem (and iron–sulfur clusters). In erythroid cells, most haem is utilized (in conjunction with globin) as hemoglobin (Hb). When Htt levels are depleted by morpholino knockdown, the availability of iron endocytosed by the Tf/TfR pathway (for utilization in Hb) is compromised. Supplementing the cytoplasm with bio-available iron (iron-dextran) restored Hb production, suggesting a role for Htt in the release of iron from endocytic compartments.

 
Other known interactions and properties of Htt support a role for Htt in endocytic vesicle/endosome dynamics; Htt associates with clathrin-coated and non-coated vesicles, endosomes (32,33,40–42,71), and co-fractionates with TfR in density gradient studies (40,42). Many proteins that interact with Htt are involved in clathrin-mediated endocytosis, such as HIP1 (73,74), {alpha}-adaptin C (75), SH3GL3 (76), PACSIN1 (77) and HIP14 (78) and Htt also interacts with the plasma membrane directly, via a lipid-binding domain located within the N-terminus (43). Htt associates with microtubules (31,33,39) and is concentrated in the perinuclear region of cells (31,32). These findings are consistent with Htt having a role in the microtubule-dependent transport of vesicles and endosomes through the recycling pathway. Furthermore, Htt has been implicated in microtubule-mediated vesicle transport due to an interaction of Htt with dynactin subunit p150Glued, via HAP1 (79,80). Both HAP1 and Htt are transported in neurons (41). A role for Htt in vesicle transport is also supported by findings that over-expression of wild-type Htt enhances microtubule-mediated trafficking of vesicles containing brain-derived neurotrophic factor (BDNF) (81) and RNAi knockdown of Drosophila Htt reportedly disrupts vesicle trafficking in Drosophila nerve axons (82).

How could perturbation of Htt function contribute to dominant, iron-related phenotypes in HD?
Various signs of disrupted iron homeostasis have been observed in HD patients. Levels of serum ferritin are decreased (83,84), which is a common indication of iron deficiency reflecting a reduction in body iron stores (85). Also, reduced Hb levels have been observed in male HD patients (83). The activities of many iron-requiring enzymes are decreased in HD patients, including aconitase and mitochondrial complexes I–IV, each of which plays a key role in oxidative energy production (86,87). Decreased activities of aconitase (19) and complexes II–IV (19–21) have been observed selectively in HD-affected brain regions, and decreased complex I activity has been recorded in muscle samples (88). A number of studies have reported accumulation of iron specifically in the striatum of post-mortem HD brain samples (26,28,29) and a significant increase in ferritin iron has been detected in the striatum (and associated globus pallidus) of live HD patients, even in early symptomatic stages of disease (27,89).

How could a disruption of Htt's role in cellular iron utilization be connected to these dominant iron-related phenotypes in HD? HD does not appear to be caused by a simple loss of function of the affected allele (i.e. haploinsufficiency), since mice in which one Hdh allele is completely inactivated (Hdh+/–), and a human subject with a translocation interrupting one normal HD allele, do not develop HD symptoms (48,49,90). Furthermore, HD patients who are homozygous for an expanded disease allele do not exhibit the embryonic lethality of Hdh knockout mice, but instead survive birth and develop essentially as normal until the onset of symptoms (91,92). Therefore, in order for a disruption of Htt function to be responsible for the defects in iron homeostasis observed in HD, the expanded polyglutamine tract would have to alter Htt function in a manner that causes dominant, detrimental consequences in the Tf/TfR pathway. While it is unclear whether the embryonic lethality of Hdh knockout (Hdh–/–) mice is solely attributable to disruption of cellular iron utilization, demonstrations that a single allele expressing expanded Htt is functionally sufficient to rescue Hdh–/– mice from embryonic lethality (51,93,94), and the fact that HD is a late-onset disease, suggest that the polyglutamine expansion allows expanded Htt to retain at least some of its normal function, presumably including its role in cellular iron utilization.

In HD, the expanded polyglutamine tract could disrupt the Tf/TfR pathway by altering the affinities of Htt for its normal binding partners and/or by facilitating novel interactions that have detrimental consequences on the Tf/TfR pathway. The interactions of Htt with many binding partners involved in endocytic and vesicle trafficking pathways are modulated by polyglutamine expansion. For example, interactions of Htt with endocytic proteins HIP1 (74) and {alpha}-adaptin-C (75) are decreased by polyglutamine expansion, and the interaction of Htt with vesicle trafficking protein HAP1 is increased (95). Furthermore, the association of Htt with microtubules via HAP1 and p150Glued is reduced in the presence of expanded Htt (81), as is the efficiency of vesicle trafficking (71,81,82,96,97). Additionally, HAP40 is up-regulated in HD, leading to striking co-localization of Htt, HAP40 and Rab5 on early endosomes, an interaction that favors the binding of endosomes to actin rather than microtubules (71). Based on the evidence for interrupted vesicle transport in the presence of expanded Htt, it is appealing to speculate that the release of iron from endocytic compartments could be impaired in HD.

Support for the possibility that Htt's role in the iron pathway is altered in HD is provided by previous findings of increased TfR levels and altered intracellular distribution of TfR and Tf in cultured striatal cell lines (STHdhQ111/Q111 and STHdhQ111/Q7) established from a knock-in mouse model of HD (98,99). Notably, the fact that these defects in the Tf/TfR cycle were observed in heterozygous STHdhQ111/Q7 cells indicates that they are dominant effects of expanded Htt (99).

HD is one of a growing list of neurodegenerative disorders associated with iron accumulation in the respective regions of pathology. Others include neuroferritinopathy, Friedreich's ataxia, neurodegeneration with brain iron accumulation (NBIA; formerly Hallervorden–Spatz syndrome), Parkinson's disease and Alzheimer's disease (100). Neuroferritinopathy and Friedreich's ataxia are examples of monogenic diseases in which the affected protein has a known role in iron homeostasis.

Neuroferritinopathy is a rare, adult-onset neurodegenerative disorder that presents similar to HD but is caused by dominant negative mutations in ferritin L, one of the two ferritin subunits (101,102). Like HD, neuroferritinopathy is associated with low serum ferritin levels, accumulation of iron and ferritin in the basal ganglia, oxidative stress and signs of mitochondrial dysfunction (103).

Friedreich's ataxia is a relatively common autosomal recessive neurodegenerative disorder (affecting spinal cord and peripheral neurons) that is associated with mitochondrial accumulation of iron and oxidative stress (104). Friedreich's ataxia is caused by the expansion of a GAA trinucleotide repeat (within the first intron of the FRDA gene) that impairs transcription, leading to reduced expression of frataxin protein. Frataxin is a mitochondrial protein involved in ISC formation and accordingly, reduced activities of ISC enzymes (respiratory complexes I, II and III, and aconitase) have been observed in affected patient tissues (105), as they have in HD.

Further advancements in understanding of the sequence of events leading to pathology in these and other iron-related neurodegenerative disorders, may offer insight into HD pathology, and vice versa.

Conclusion
In this study, the zebrafish model organism has been used to examine the effects of Htt deficiency in early development, in order to gain new insight into the normal function of Htt. The most significant outcome of this work is the finding that Htt knockdown leads to signs of cellular iron deficiency, despite the presence of iron in the cell. Htt appears to act downstream of TfR-mediated endocytosis of iron, thus implicating Htt in the release of iron from endocytic compartments into the cytosol.

Iron is vital for the function of a variety of cellular proteins and enzymes, many of which play important roles in energy metabolism. Since defects in iron homeostasis (26–29,83,84,89) and energy metabolism (reviewed in 106) are features of HD pathogenesis, the results of the current study raise the possibility that these defects are dominant effects of a perturbation (by the expanded polyglutamine tract) of Htt's normal role in the iron pathway. Furthermore, since iron accumulation and defects in energy metabolism are most pronounced in the primary site of HD neurodegeneration (19–21,26–29,89), these findings provide a novel link between perturbation of normal Htt function, and the specificity of neuronal vulnerability in HD.

The hypothesis has been put forward that the normal function of Htt (and for that matter, each of the polyglutamine-containing disease proteins) is such that when perturbed this dysfunction contributes, in some way, to the specificity of the neurodegeneration seen in HD (and each of the other polyglutamine disorders). In order for this hypothesis to remain plausible, the normal function(s) of Htt need to be consistent with some process that is able to account for such specificity of pathogenesis. We have found a clear role for Htt in cellular iron utilization—a process that is entirely consistent with the specificity of HD neurodegeneration in the striatum.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Zebrafish maintenance and staging
Zebrafish were maintained at 28.5°C under standard conditions as described (107). Developmental stages were determined by using both hours post fertilization (hpf) and morphological features (108).

Whole-mount in situ hybridization
The template used to make the probe for in situ hybridization of hd mRNA corresponds to the first 1503 bp of zebrafish hd open-reading frame (ORF). This region was amplified from total cDNA from 72 hpf embryos using primers ZHD.F7+EcoRI (5'-CTGATGAATTCCATGGCCACCATGGAGAAGCTAA-3', start codon underlined) and ZHD.R7+XbaI (5'-GACTGTCTAGATGACATCTGGTTGGCATCGGTT-3'), and cloned into the eukaryotic expression vector pCS2+ (109) as an EcoRI/XbaI fragment. For synthesis of labeled antisense RNA probe, vector template was linearized at the 5' ClaI site and transcribed with T7 RNA polymerase in the presence of digoxigenin-labeled dUTP. notch2 (previously known as notch6) probe was prepared as described (110). Whole-mount in situ hybridization was performed as described (111). Proteinase K was used at a concentration of 10 µg/ml in PBST (0.1% Triton-X in PBS), to further permeabilize embryos aged 36 hpf (5 min) and 48 hpf (10 min). Following hybridization of the probe, alkaline phosphatase-conjugated anti-digoxigenin antibody and BCIP/NBT substrate were used for probe detection, as described (111). Embryos were stored in 80% glycerol for microscopy and photography.

Morpholino design
All MOs were designed and synthesized by Gene-Tools, LLC Ore. and were solubilized in water to create 2 mM stocks. Prior to microinjection, MO stock samples were diluted to the required concentration, in water. MO sequences antisense to the hd mRNA transcript were as follows: hdMO1, 5'-GCCATTTTAACAGAAGCTGTGATGA-3' (+5 to –20 with respect to the start of the hd ORF, first codon underlined) and hdMO2, 5'-GATATAATCTGATCGGAGATAGGGT-3' (–22 to –46). Two negative control MOs were used; a standard MO with no known target in zebrafish, cMO, 5'-CCTCTTACCTCAGTTACAATTTATA-3', and a mispair control MO representing hdMO1 with five base alterations (lower case), mcMO1, 5'-GCgATTTcAACAcAAcCTGTcATGA-3'.

Generation of hd(1.2):EGFP reporter construct
The published zebrafish hd cDNA sequence (54) (GenBank accession no AF052603 [GenBank] ) was used to perform a BLAST search of the Sanger Centre Zebrafish Sequencing Project genomic DNA database in order to obtain additional 5' sequence. A region of DNA sequence spanning ~1.25 kb 5' to, and including, the first 15 nucleotides of the hd ORF was amplified from zebrafish genomic DNA using primers ZHD.F8+SphI (5'-GATGCATGCTGACCTACCATCCCATCTGAGA-3') and ZHD.R8 + SacII (5'-GTACCGCGGCTCCATGGTGGCCATTTTAACAGAAG-3') and was ligated into the bacterial cloning vector pGem-T (Promega). The EGFP ORF and SV40 polyadenylation signal were amplified from expression vector pIRES2-EGFP (Clontech) using primers pI2EGFP.F2 (5'-TGGCCACAACCATGGTGAGCAA-3') and pI2EGFP.R2+NcoI (5'-GTCCATGGACAAACCACAACTAGAATGCA-3'), and ligated in frame as a NcoI fragment downstream of the hd sequence, utilizing the NcoI sites spanning both the fourth codon of the hd ORF and the start methionine of EGFP. The resulting vector (hd(1.2):EGFP) was linearized (XmnI) and purified using the QIAquick® PCR Purification Kit (QIAGEN) prior to injection.

Embryo microinjections
In preparation for experiments involving the injection of DNA, vector DNA was linearized (XmnI) and purified using the QIAquick PCR Purification Kit. For iron-rescue experiments, Ferroject iron-dextran injectable solution (Swift and Company Ltd) (referred to here as iron-dextran) was co-injected with MOs, as indicated. For all experiments involving microinjection, a sample volume of 2 or 5 nl was injected into the cytoplasm of zebrafish embryos at the 1-cell stage, using an MPPI-2 Pressure Injector (Applied Scientific Instrumentation Inc.). Sample doses are indicated in nanograms in the text.

Generation of polyclonal antibodies against the N-terminus of zebrafish Htt
Polyclonal antibodies were raised in rabbit against a synthetic peptide (Auspep) representing the first 17 amino acids of the zebrafish Htt protein (MATMEKLMKAFESLKSF), conjugated to keyhole limpet hemocyanin via a C-terminal cysteine residue. This sequence differs from the conserved N-terminal of mammalian Htt by only one amino acid, the fourth residue being lysine in mammals.

Western blot analysis
Dechorionated and deyolked embryos (48 hpf) were lysed in 2 x SDS sample buffer (107) at a concentration of 1 µl per embryo and homogenized with a pestle, on ice. Lysates were boiled for 5 min and centrifuged at 55 000g for 20 min at 4°C in a TL-100 Ultracentrifuge (Beckman). The supernatant was removed and stored at –80°C. Equal quantities of protein were separated by electrophoresis on a 4–12% Bis–Tris acrylamide gel (Invitrogen) at 200 V, and transferred to a nitrocellulose membrane in transfer buffer (25 mM Tris, 192 mM glycine). Transfer was carried out in a mini-PROTEAN 3 apparatus (Bio-Rad), at 30 V overnight (4°C). The membrane was blocked for 3 h at room temperature with blocking buffer [5% skim milk powder in 1 x TBS-T (10 mM Tris pH 7.5, 100 mM NaCl, 0.1% Tween-20)] prior to overnight incubation at 4°C with polyclonal anti-Htt antibodies (described earlier) diluted in the same buffer. After three 15-min washes in blocking buffer, the membrane was incubated for 1 h with horseradish peroxidase-conjugated donkey anti-rabbit IgG secondary antibody (Rockland). The membrane was then washed three times in 1 x TBS-T before detection of the Htt band by chemiluminescence using Super Signal West Dura ECL Substrate (Pierce). Immediately following Htt detection, ß-actin was detected on the same membrane, as a protein loading control, using the same western blot method as described earlier. Anti-beta Actin (Abcam) primary antibody and horseradish peroxidase-conjugated donkey anti-mouse IgG secondary antibody (Rockland) were used.

Histochemical staining for hemoglobin
Hb activity was detected in whole embryos by performing o-dianisidine staining using methods previously described (112). The basis of this assay is that Hb catalyzes the H2O2-mediated oxidation of o-dianisidine, producing a dark red color in Hb-positive cells. Embryos were post-fixed in 4% formaldehyde (in PBS) overnight at 4°C and stored in 80% glycerol for microscopy.

Histochemical staining for ferric iron
For detection of ferric iron in whole zebrafish embryos, a 3,3-diaminobenzidine (DAB)-enhanced Prussian blue staining method was used, as follows. Fixed embryos were immersed in a freshly prepared working solution containing 2.5% potassium ferrocyanide and 0.25 M HCl, for 30 min at room temperature, then rinsed three times in PBST. Potassium ferrocyanide reacts with ferric ions in the embryo, producing ferric ferrocyanide (Prussian blue). In preparation for stain enhancement, endogenous peroxidase activity was quenched by incubating the embryos in 0.3% H2O2 (in methanol) for 20 min at room temperature. Following two rinses in PBST, embryos were incubated for 7 min in DAB substrate using PBS-dissolved SigmaFast DAB/urea (H2O2) tablets (Sigma-Aldrich). Ferric ferrocyanide catalyses the H2O2-mediated oxidation of DAB, producing a reddish brown color. Finally, embryos were rinsed three times in PBST, and stored in 80% glycerol for microscopy.

To obtain blood cells, live embryos (33 hpf) were placed in a solution of PBS, containing tricaine. Blood cells were released by cardiac puncture onto a poly-L-lysine-coated slide. Embryo debris was removed and blood cells were allowed to settle and adhere to the slide for 30 min. The cells were then fixed in 4% formaldehyde (in PBS) for 30 min. Ferric iron was detected using a DAB-enhanced Prussian blue staining method similar to that used for whole embryos described earlier, with a few modifications, as follows. Cells were incubated in a working solution of 0.5% potassium ferrocyanide and 0.75% HCl (conditions previously described for staining blood cells [113)] for 30 min. The cells were then rinsed three times in PBST. Endogenous peroxidase activity was quenched by incubating the cells in 0.3% H2O2 (in methanol) for 20 min. Following two rinses in PBST, embryos were incubated for 4 min in DAB substrate using PBS-dissolved SigmaFast DAB/urea (H2O2) tablets (Sigma-Aldrich). Finally, cells were rinsed three times in PBST, and air-dried before being covered with 80% glycerol and a coverslip for microscopy.

Quantitative PCR
Total RNA was extracted from zebrafish embryos (~30 embryos per sample) using the RNeasy mini kit (QIAGEN). From this RNA, cDNA was synthesized using Superscript II RNase H-Reverse Transcriptase (Invitrogen). Quantitative real-time PCR (qPCR) was performed on an ABI 7000 sequence detection system (Applied Biosciences), using the relative standard curve method for quantification (as set out by the manufacturers) to generate raw values representing arbitrary units of RNA transcript. The experiment was performed on three independent occasions. In every experiment, each embryo sample was run in triplicate. Triplicate values for acta1 were averaged, and each triplicate tfr1a and tfr1b value was then normalized to the average acta1 value for that sample. One hdMO1/tfr1b value was omitted from statistical analyses as it was >2.5 standard deviations from the mean value observed for that embryo class and was therefore considered an outlier. Statistical analyses on normalized data were performed using R software (114) and included ANOVA and Student's t-tests. The following primers were used: tfr1a (fwd: AATCGCATTATGAGGGTGGAA and rev: GGGAGACACGTATGGAGAGAGC); tfr1b (fwd: AAGAATAGTGACCTGGAAGACATGG and rev: AATGAGACGTAAGGAGAGAGGAAATT); and acta1 (fwd: TGCCCAGAGGCCCTGTT and rev: ACCGCAAGATTCCATACCCA).


   ACKNOWLEDGEMENTS
 
We wish to thank the members of the Richards lab and also G. Lieschke, K. Jensen, D. Peet, S. Pederson and S. Polyak outside of our group, who have read drafts of this manuscript and made valuable contributions. We also acknowledge S. Wells and S. Nornes, and J. Mackrill for their technical assistance with embryo injections and antibody production, respectively. This work was supported by the ARC Special Research Centre for the Molecular Genetics of Development (CMGD) and the ARC/NHMRC Research Network in Genes and Environment in Development (NGED). A.L.L. was the recipient of a joint CMGD and Faculty of Sciences Divisional PhD Scholarship from The University of Adelaide.

Conflict of Interest statement. None declared.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Mangiarini L., Sathasivam K., Seller M., Cozens B., Harper A., Hetherington C., Lawton M., Trottier Y., Lehrach H., Davies S.W., et al. Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell (1996) 87:493–506.[CrossRef][Web of Science][Medline]

  2. Faber P.W., Alter J.R., MacDonald M.E., Hart A.C. Polyglutamine-mediated dysfunction and apoptotic death of a Caenorhabditis elegans sensory neuron. Proc. Natl Acad. Sci. USA (1999) 96:179–184.[Abstract/Free Full Text]

  3. Miller V.M., Nelson R.F., Gouvion C.M., Williams A., Rodriguez-Lebron E., Harper S.Q., Davidson B.L., Rebagliati M.R., Paulson H.L. CHIP suppresses polyglutamine aggregation and toxicity in vitro and in vivo. J. Neurosci. (2005) 25:9152–9161.[Abstract/Free Full Text]

  4. Schiffer N.W., Broadley S.A., Hirschberger T., Tavan P., Kretzschmar H.A., Giese A., Haass C., Hartl U.F., Schmid B. Identification of anti-prion compounds as efficient inhibitors of polyglutamine protein aggregation in a zebrafish model. J. Biol. Chem. (2007) 282:9195–9203.[Abstract/Free Full Text]

  5. Jackson G.R., Salecker I., Dong X., Yao X., Arnheim N., Faber P.W., MacDonald M.E., Zipursky S.L. Polyglutamine-expanded human huntingtin transgenes induce degeneration of Drosophila photoreceptor neurons. Neuron (1998) 21:633–642.[CrossRef][Web of Science][Medline]

  6. Warrick J.M., Paulson H.L., Gray-Board G.L., Bui Q.T., Fischbeck K.H., Pittman R.N., Bonini N.M. Expanded polyglutamine protein forms nuclear inclusions and causes neural degeneration in Drosophila. Cell (1998) 93:939–949.[CrossRef][Web of Science][Medline]

  7. Meriin A.B., Zhang X., He X., Newnam G.P., Chernoff Y.O., Sherman M.Y. Huntingtin toxicity in yeast model depends on polyglutamine aggregation mediated by a prion-like protein Rnq1. J. Cell Biol. (2002) 157:997–1004.[Abstract/Free Full Text]

  8. Arrasate M., Mitra S., Schweitzer E.S., Segal M.R., Finkbeiner S. Inclusion body formation reduces levels of mutant huntingtin and the risk of neuronal death. Nature (2004) 431:805–810.[CrossRef][Medline]

  9. Emamian E.S., Kaytor M.D., Duvick L.A., Zu T., Tousey S.K., Zoghbi H.Y., Clark H.B., Orr H.T. Serine 776 of ataxin-1 is critical for polyglutamine-induced disease in SCA1 transgenic mice. Neuron (2003) 38:375–387.[CrossRef][Web of Science][Medline]

  10. Katsuno M., Adachi H., Kume A., Li M., Nakagomi Y., Niwa H., Sang C., Kobayashi Y., Doyu M., Sobue G. Testosterone reduction prevents phenotypic expression in a transgenic mouse model of spinal and bulbar muscular atrophy. Neuron (2002) 35:843–854.[CrossRef][Web of Science][Medline]

  11. Matsuyama Z., Wakamori M., Mori Y., Kawakami H., Nakamura S., Imoto K. Direct alteration of the P/Q-type Ca2 + channel property by polyglutamine expansion in spinocerebellar ataxia 6. J. Neurosci. (1999) 19:RC14.[Abstract/Free Full Text]

  12. Restituito S., Thompson R.M., Eliet J., Raike R.S., Riedl M., Charnet P., Gomez C.M. The polyglutamine expansion in spinocerebellar ataxia type 6 causes a beta subunit-specific enhanced activation of P/Q-type calcium channels in Xenopus oocytes. J. Neurosci. (2000) 20:6394–6403.[Abstract/Free Full Text]

  13. Frontali M. Spinocerebellar ataxia type 6: channelopathy or glutamine repeat disorder? Brain Res. Bull. (2001) 56:227–231.[CrossRef][Web of Science][Medline]

  14. Graveland G.A., Williams R.S., DiFiglia M. Evidence for degenerative and regenerative changes in neostriatal spiny neurons in Huntington's disease. Science (1985) 227:770–773.[Abstract/Free Full Text]

  15. Vonsattel J.P., Myers R.H., Stevens T.J., Ferrante R.J., Bird E.D., Richardson E.P. Jr. Neuropathological classification of Huntington's disease. J. Neuropathol. Exp. Neurol. (1985) 44:559–577.[Web of Science][Medline]

  16. Antonini A., Leenders K.L., Spiegel R., Meier D., Vontobel P., Weigell-Weber M., Sanchez-Pernaute R., de Yebenez J.G., Boesiger P., Weindl A., et al. Striatal glucose metabolism and dopamine D2 receptor binding in asymptomatic gene carriers and patients with Huntington's disease. Brain (1996) 119:2085–2095.[Abstract/Free Full Text]

  17. Grafton S.T., Mazziotta J.C., Pahl J.J., St George-Hyslop P., Haines J.L., Gusella J., Hoffman J.M., Baxter L.R., Phelps M.E. Serial changes of cerebral glucose metabolism and caudate size in persons at risk for Huntington's disease. Arch. Neurol. (1992) 49:1161–1167.[Abstract/Free Full Text]

  18. Kuwert T., Lange H.W., Boecker H., Titz H., Herzog H., Aulich A., Wang B.C., Nayak U., Feinendegen L.E. Striatal glucose consumption in chorea-free subjects at risk of Huntington's disease. J. Neurol. (1993) 241:31–36.[CrossRef][Web of Science][Medline]

  19. Tabrizi S.J., Cleeter M.W., Xuereb J., Taanman J.W., Cooper J.M., Schapira A.H. Biochemical abnormalities and excitotoxicity in Huntington's disease brain. Ann. Neurol. (1999) 45:25–32.[CrossRef][Web of Science][Medline]

  20. Gu M., Gash M.T., Mann V.M., Javoy-Agid F., Cooper J.M., Schapira A.H. Mitochondrial defect in Huntington's disease caudate nucleus. Ann. Neurol. (1996) 39:385–389.[CrossRef][Web of Science][Medline]

  21. Browne S.E., Bowling A.C., MacGarvey U., Baik M.J., Berger S.C., Muqit M.M., Bird E.D., Beal M.F. Oxidative damage and metabolic dysfunction in Huntington's disease: selective vulnerability of the basal ganglia. Ann. Neurol. (1997) 41:646–653.[CrossRef][Web of Science][Medline]

  22. Butterworth J., Yates C.M., Reynolds G.P. Distribution of phosphate-activated glutaminase, succinic dehydrogenase, pyruvate dehydrogenase and gamma-glutamyl transpeptidase in post-mortem brain from Huntington's disease and agonal cases. J. Neurol. Sci. (1985) 67:161–171.[CrossRef][Web of Science][Medline]

  23. Jenkins B.G., Koroshetz W.J., Beal M.F., Rosen B.R. Evidence for impairment of energy metabolism in vivo in Huntington's disease using localized 1H NMR spectroscopy. Neurology (1993) 43:2689–2695.[Abstract/Free Full Text]

  24. Jenkins B.G., Rosas H.D., Chen Y.C., Makabe T., Myers R., MacDonald M., Rosen B.R., Beal M.F., Koroshetz W.J. 1H NMR spectroscopy studies of Huntington's disease: correlations with CAG repeat numbers. Neurology (1998) 50:1357–1365.[Abstract/Free Full Text]

  25. Beal M.F. Huntington's disease, energy, and excitotoxicity. Neurobiol. Aging (1994) 15:275–276.[CrossRef][Web of Science][Medline]

  26. Chen J.C., Hardy P.A., Kucharczyk W., Clauberg M., Joshi J.G., Vourlas A., Dhar M., Henkelman R.M. MR of human postmortem brain tissue: correlative study between T2 and assays of iron and ferritin in Parkinson and Huntington disease. AJNR Am. J. Neuroradiol. (1993) 14:275–281.[Abstract]

  27. Bartzokis G., Cummings J., Perlman S., Hance D.B., Mintz J. Increased basal ganglia iron levels in Huntington disease. Arch. Neurol. (1999) 56:569–574.[Abstract/Free Full Text]

  28. Dexter D.T., Carayon A., Javoy-Agid F., Agid Y., Wells F.R., Daniel S.E., Lees A.J., Jenner P., Marsden C.D. Alterations in the levels of iron, ferritin and other trace metals in Parkinson's disease and other neurodegenerative diseases affecting the basal ganglia. Brain (1991) 114:1953–1975.[Abstract/Free Full Text]

  29. Dexter D.T., Jenner P., Schapira A.H., Marsden C.D. Alterations in levels of iron, ferritin, and other trace metals in neurodegenerative diseases affecting the basal ganglia.The Royal Kings and Queens Parkinson's Disease Research Group. Ann. Neurol. (1992) 32(suppl.):S94–S100.[CrossRef][Web of Science][Medline]

  30. Browne S.E., Ferrante R.J., Beal M.F. Oxidative stress in Huntington's disease. Brain Pathol. (1999) 9:147–163.[Web of Science][Medline]

  31. Hoffner G., Kahlem P., Djian P. Perinuclear localization of huntingtin as a consequence of its binding to microtubules through an interaction with beta-tubulin: relevance to Huntington's disease. J. Cell Sci. (2002) 115:941–948.[Abstract/Free Full Text]

  32. Tao T., Tartakoff A.M. Nuclear relocation of normal huntingtin. Traffic (2001) 2:385–394.[CrossRef][Web of Science][Medline]

  33. Gutekunst C.A., Levey A.I., Heilman C.J., Whaley W.L., Yi H., Nash N.R., Rees H.D., Madden J.J., Hersch S.M. Identification and localization of huntingtin in brain and human lymphoblastoid cell lines with anti-fusion protein antibodies. Proc. Natl Acad. Sci. USA (1995) 92:8710–8714.[Abstract/Free Full Text]

  34. Trottier Y., Devys D., Imbert G., Saudou F., An I., Lutz Y., Weber C., Agid Y., Hirsch E.C., Mandel J.L. Cellular localization of the Huntington's disease protein and discrimination of the normal and mutated form. Nat. Genet. (1995) 10:104–110.[CrossRef][Web of Science][Medline]

  35. Kegel K.B., Meloni A.R., Yi Y., Kim Y.J., Doyle E., Cuiffo B.G., Sapp E., Wang Y., Qin Z.H., Chen J.D., et al. Huntingtin is present in the nucleus, interacts with the transcriptional corepressor C-terminal binding protein, and represses transcription. J. Biol. Chem. (2002) 277:7466–7476.[Abstract/Free Full Text]

  36. Sapp E., Schwarz C., Chase K., Bhide P.G., Young A.B., Penney J., Vonsattel J.P., Aronin N., DiFiglia M. Huntingtin localization in brains of normal and Huntington's disease patients. Ann. Neurol. (1997) 42:604–612.[CrossRef][Web of Science][Medline]

  37. Hoogeveen A.T., Willemsen R., Meyer N., de Rooij K.E., Roos R.A., van Ommen G.J., Galjaard H. Characterization and localization of the Huntington disease gene product. Hum. Mol. Genet. (1993) 2:2069–2073.[Abstract/Free Full Text]

  38. De Rooij K.E., Dorsman J.C., Smoor M.A., Den Dunnen J.T., Van Ommen G.J. Subcellular localization of the Huntington's disease gene product in cell lines by immunofluorescence and biochemical subcellular fractionation. Hum. Mol. Genet. (1996) 5:1093–1099.[Abstract/Free Full Text]

  39. Tukamoto T., Nukina N., Ide K., Kanazawa I. Huntington's disease gene product, huntingtin, associates with microtubules in vitro. Brain Res. Mol. Brain Res. (1997) 51:8–14.[Medline]

  40. DiFiglia M., Sapp E., Chase K., Schwarz C., Meloni A., Young C., Martin E., Vonsattel J.P., Carraway R., Reeves S.A., et al. Huntingtin is a cytoplasmic protein associated with vesicles in human and rat brain neurons. Neuron (1995) 14:1075–1081.[CrossRef][Web of Science][Medline]

  41. Block-Galarza J., Chase K.O., Sapp E., Vaughn K.T., Vallee R.B., DiFiglia M., Aronin N. Fast transport and retrograde movement of huntingtin and HAP 1 in axons. Neuroreport (1997) 8:2247–2251.[Web of Science][Medline]

  42. Velier J., Kim M., Schwarz C., Kim T.W., Sapp E., Chase K., Aronin N., DiFiglia M. Wild-type and mutant huntingtins function in vesicle trafficking in the secretory and endocytic pathways. Exp. Neurol. (1998) 152:34–40.[CrossRef][Web of Science][Medline]

  43. Kegel K.B., Sapp E., Yoder J., Cuiffo B., Sobin L., Kim Y.J., Qin Z.H., Hayden M.R., Aronin N., Scott D.L., et al. Huntingtin associates with acidic phospholipids at the plasma membrane. J. Biol. Chem. (2005) 280:36464–36473.[Abstract/Free Full Text]

  44. Choo Y.S., Johnson G.V., MacDonald M., Detloff P.J., Lesort M. Mutant huntingtin directly increases susceptibility of mitochondria to the calcium-induced permeability transition and cytochrome c release. Hum. Mol. Genet (2004) 13:1407–1420.[Abstract/Free Full Text]

  45. Huntington's Disease Collaborative Research Group. A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. Cell (1993) 72:971–983.[CrossRef][Web of Science][Medline]

  46. Cattaneo E., Zuccato C., Tartari M. Normal huntingtin function: an alternative approach to Huntington's disease. Nat. Rev. Neurosci. (2005) 6:919–930.[Medline]

  47. Harjes P., Wanker E.E. The hunt for huntingtin function: interaction partners tell many different stories. Trends Biochem. Sci. (2003) 28:425–433.[CrossRef][Web of Science][Medline]

  48. Zeitlin S., Liu J.P., Chapman D.L., Papaioannou V.E., Efstratiadis A. Increased apoptosis and early embryonic lethality in mice nullizygous for the Huntington's disease gene homologue. Nat. Genet. (1995) 11:155–163.[CrossRef][Web of Science][Medline]

  49. Duyao M.P., Auerbach A.B., Ryan A., Persichetti F., Barnes G.T., McNeil S.M., Ge P., Vonsattel J.P., Gusella J.F., Joyner A.L., et al. Inactivation of the mouse Huntington's disease gene homolog Hdh. Science (1995) 269:407–410.[Abstract/Free Full Text]

  50. Nasir J., Floresco S.B., O_Kusky J.R., Diewert V.M., Richman J.M., Zeisler J., Borowski A., Marth J.D., Phillips A.G., Hayden M.R. Targeted disruption of the Huntington's disease gene results in embryonic lethality and behavioral and morphological changes in heterozygotes. Cell (1995) 81:811–823.[CrossRef][Web of Science][Medline]

  51. White J.K., Auerbach W., Duyao M.P., Vonsattel J.P., Gusella J.F., Joyner A.L., MacDonald M.E. Huntingtin is required for neurogenesis and is not impaired by the Huntington's disease CAG expansion. Nat. Genet. (1997) 17:404–410.[CrossRef][Web of Science][Medline]

  52. Dragatsis I., Efstratiadis A., Zeitlin S. Mouse mutant embryos lacking huntingtin are rescued from lethality by wild-type extraembryonic tissues. Development (1998) 125:1529–1539.[Abstract]

  53. Dragatsis I., Levine M.S., Zeitlin S. Inactivation of Hdh in the brain and testis results in progressive neurodegeneration and sterility in mice. Nat. Genet. (2000) 26:300–306.[CrossRef][Web of Science][Medline]

  54. Karlovich C.A., John R.M., Ramirez L., Stainier D.Y., Myers R.M. Characterization of the Huntington's disease (HD) gene homologue in the zebrafish Danio rerio. Gene (1998) 217:117–125.[CrossRef][Web of Science][Medline]

  55. Detrich H.W. III, Westerfield M., Zon L.I. The Zebrafish: Biology (1999) San Diego: Academic Press.

  56. Schmitt I., Bachner D., Megow D., Henklein P., Hameister H., Epplen J.T., Riess O. Expression of the Huntington disease gene in rodents: cloning the rat homologue and evidence for downregulation in non-neuronal tissues during development. Hum. Mol. Genet. (1995) 4:1173–1182.[Abstract/Free Full Text]

  57. Thisse B., Heyer V., Lux A., Alunni V., Degrave A., Seiliez I., Kirchner J., Parkhill J.P., Thisse C. Spatial and temporal expression of the zebrafish genome by large-scale in situ hybridization screening. Methods Cell Biol. (2004) 77:505–519.[Web of Science][Medline]

  58. Eisenberg E., Levanon E.Y. Human housekeeping genes are compact. Trends Genet. (2003) 19:362–365.[CrossRef][Web of Science][Medline]

  59. Ransom D.G., Haffter P., Odenthal J., Brownlie A., Vogelsang E., Kelsh R.N., Brand M., van Eeden F.J., Furutani-Seiki M., Granato M., et al. Characterization of zebrafish mutants with defects in embryonic hematopoiesis. Development (1996) 123:311–319.[Abstract]

  60. Weinstein B.M., Schier A.F., Abdelilah S., Malicki J., Solnica-Krezel L., Stemple D.L., Stainier D.Y., Zwartkruis F., Driever W., Fishman M.C. Hematopoietic mutations in the zebrafish. Development (1996) 123:303–309.[Abstract]

  61. Wingert R.A., Brownlie A., Galloway J.L., Dooley K., Fraenkel P., Axe J.L., Davidson A.J., Barut B., Noriega L., Sheng X., et al. The chianti zebrafish mutant provides a model for erythroid-specific disruption of transferrin receptor 1. Development (2004) 131:6225–6235.[Abstract/Free Full Text]

  62. Donovan A., Brownlie A., Dorschner M.O., Zhou Y., Pratt S.J., Paw B.H., Phillips R.B., Thisse C., Thisse B., Zon L.I. The zebrafish mutant gene chardonnay (cdy) encodes divalent metal transporter 1 (DMT1). Blood (2002) 100:4655–4659.[Abstract/Free Full Text]

  63. Donovan A., Brownlie A., Zhou Y., Shepard J., Pratt S.J., Moynihan J., Paw B.H., Drejer A., Barut B., Zapata A., et al. Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter. Nature (2000) 403:776–781.[CrossRef][Medline]

  64. Metzler M., Helgason C.D., Dragatsis I., Zhang T., Gan L., Pineault N., Zeitlin S.O., Humphries R.K., Hayden M.R. Huntingtin is required for normal hematopoiesis. Hum. Mol. Genet. (2000) 9:387–394.[Abstract/Free Full Text]

  65. Hilditch-Maguire P., Trettel F., Passani L.A., Auerbach A., Persichetti F., MacDonald M.E. Huntingtin: an iron-regulated protein essential for normal nuclear and perinuclear organelles. Hum. Mol. Genet. (2000) 9:2789–2797.[Abstract/Free Full Text]

  66. Childs S., Weinstein B.M., Mohideen M.A., Donohue S., Bonkovsky H., Fishman M.C. Zebrafish dracula encodes ferrochelatase and its mutation provides a model for erythropoietic protoporphyria. Curr. Biol. (2000) 10:1001–1004.[CrossRef][Web of Science][Medline]

  67. Wang H., Long Q., Marty S.D., Sassa S., Lin S. A zebrafish model for hepatoerythropoietic porphyria. Nat. Genet. (1998) 20:239–243.[CrossRef][Web of Science][Medline]

  68. de Jong J.L., Zon L.I. Use of the zebrafish system to study primitive and definitive hematopoiesis. Annu. Rev. Genet. (2005) 39:481–501.[CrossRef][Web of Science][Medline]

  69. Aisen P., Enns C., Wessling-Resnick M. Chemistry and biology of eukaryotic iron metabolism. Int. J. Biochem. Cell Biol. (2001) 33:940–959.[CrossRef][Web of Science][Medline]

  70. Amsterdam A., Nissen R.M., Sun Z., Swindell E.C., Farrington S., Hopkins N. Identification of 315 genes essential for early zebrafish development. Proc. Natl Acad. Sci. USA (2004) 101:12792–12797.[Abstract/Free Full Text]

  71. Pal A., Severin F., Lommer B., Shevchenko A., Zerial M. Huntingtin-HAP40 complex is a novel Rab5 effector that regulates early endosome motility and is up-regulated in Huntington's disease. J. Cell Biol. (2006) 172:605–618.[Abstract/Free Full Text]

  72. Zerial M., McBride H. Rab proteins as membrane organizers. Nat. Rev. Mol. Cell Biol. (2001) 2:107–117.[CrossRef][Web of Science][Medline]

  73. Wanker E.E., Rovira C., Scherzinger E., Hasenbank R., Walter S., Tait D., Colicelli J., Lehrach H. HIP-I: a huntingtin interacting protein isolated by the yeast two-hybrid system. Hum. Mol. Genet. (1997) 6:487–495.[Abstract/Free Full Text]

  74. Kalchman M.A., Koide H.B., McCutcheon K., Graham R.K., Nichol K., Nishiyama K., Kazemi-Esfarjani P., Lynn F.C., Wellington C., Metzler M., et al. HIP1, a human homologue of S. cerevisiae Sla2p, interacts with membrane-associated huntingtin in the brain. Nat. Genet. (1997) 16:44–53.[CrossRef][Web of Science][Medline]

  75. Faber P.W., Barnes G.T., Srinidhi J., Chen J., Gusella J.F., MacDonald M.E. Huntingtin interacts with a family of WW domain proteins. Hum. Mol. Genet. (1998) 7:1463–1474.[Abstract/Free Full Text]

  76. Sittler A., Walter S., Wedemeyer N., Hasenbank R., Scherzinger E., Eickhoff H., Bates G.P., Lehrach H., Wanker E.E. SH3GL3 associates with the Huntingtin exon 1 protein and promotes the formation of polygln-containing protein aggregates. Molecular Cell (1998) 2:427–436.[CrossRef][Web of Science][Medline]

  77. Modregger J., DiProspero N.A., Charles V., Tagle D.A., Plomann M. PACSIN 1 interacts with huntingtin and is absent from synaptic varicosities in presymptomatic Huntington's disease brains. Hum. Mol. Genet. (2002) 11:2547–2558.[Abstract/Free Full Text]

  78. Singaraja R.R., Hadano S., Metzler M., Givan S., Wellington C.L., Warby S., Yanai A., Gutekunst C.A., Leavitt B.R., Yi H., et al. HIP14, a novel ankyrin domain-containing protein, links huntingtin to intracellular trafficking and endocytosis. Hum. Mol. Genet. (2002) 11:2815–2828.[Abstract/Free Full Text]

  79. Engelender S., Sharp A.H., Colomer V., Tokito M.K., Lanahan A., Worley P., Holzbaur E.L., Ross C.A. Huntingtin-associated protein 1 (HAP1) interacts with the p150Glued subunit of dynactin. Hum. Mol. Genet. (1997) 6:2205–2212.[Abstract/Free Full Text]

  80. Li S.H., Gutekunst C.A., Hersch S.M., Li X.J. Interaction of huntingtin-associated protein with dynactin P150Glued. J. Neurosci. (1998) 18:1261–1269.[Abstract/Free Full Text]

  81. Gauthier L.R., Charrin B.C., Borrell-Pages M., Dompierre J.P., Rangone H., Cordelieres F.P., De Mey J., MacDonald M.E., Lessmann V., Humbert S., et al. Huntingtin controls neurotrophic support and survival of neurons by enhancing BDNF vesicular transport along microtubules. Cell (2004) 118:127–138.[CrossRef][Web of Science][Medline]

  82. Gunawardena S., Her L.S., Brusch R.G., Laymon R.A., Niesman I.R., Gordesky-Gold B., Sintasath L., Bonini N.M., Goldstein L.S. Disruption of axonal transport by loss of huntingtin or expression of pathogenic polyQ proteins in Drosophila. Neuron (2003) 40:25–40.[CrossRef][Web of Science][Medline]

  83. Bonilla E., Estevez J., Suarez H., Morales L.M., Chacin de Bonilla L., Villalobos R., Davila J.O. Serum ferritin deficiency in Huntington's disease patients. Neurosci. Lett. (1991) 129:22–24.[CrossRef][Web of Science][Medline]

  84. Morrison P.J., Nevin N.C. Serum iron, total iron binding capacity and ferritin in early Huntington disease patients. Ir. J. Med. Sci. (1994) 163:236–237.[Web of Science][Medline]

  85. Lipschitz D.A., Cook J.D., Finch C.A. A clinical evaluation of serum ferritin as an index of iron stores. N. Engl. J. Med. (1974) 290:1213–1216.[Web of Science][Medline]

  86. Brzoska K., Meczynska S., Kruszewski M. Iron–sulfur cluster proteins: electron transfer and beyond. Acta Biochim. Pol. (2006) 53:685–691.[Web of Science][Medline]

  87. Atamna H., Walter P.B., Ames B.N. The role of heme and iron–sulfur clusters in mitochondrial biogenesis, maintenance, and decay with age. Arch. Biochem. Biophys. (2002) 397:345–353.[CrossRef][Web of Science][Medline]

  88. Arenas J., Campos Y., Ribacoba R., Martin M.A., Rubio J.C., Ablanedo P., Cabello A. Complex I defect in muscle from patients with Huntington's disease. Ann. Neurol. (1998) 43:397–400.[CrossRef][Web of Science][Medline]

  89. Bartzokis G., Tishler T.A. MRI evaluation of basal ganglia ferritin iron and neurotoxicity in Alzheimer's and Huntingon's disease. Cell. Mol. Biol. (Noisy-le-grand) (2000) 46:821–833.[Web of Science][Medline]

  90. Ambrose C.M., Duyao M.P., Barnes G., Bates G.P., Lin C.S., Srinidhi J., Baxendale S., Hummerich H., Lehrach H., Altherr M. Structure and expression of the Huntington's disease gene: evidence against simple inactivation due to an expanded CAG repeat. Somat. Cell. Mol. Genet. (1994) 20:27–38.[CrossRef][Web of Science][Medline]

  91. Myers R.H., Leavitt J., Farrer L.A., Jagadeesh J., McFarlane H., Mastromauro C.A., Mark R.J., Gusella J.F. Homozygote for Huntington disease. Am. J. Hum. Genet. (1989) 45:615–618.[Web of Science][Medline]

  92. Wexler N.S., Young A.B., Tanzi R.E., Travers H., Starosta-Rubinstein S., Penney J.B., Snodgrass S.R., Shoulson I., Gomez F., Ramos Arroyo M.A., et al. Homozygotes for Huntington's disease. Nature (1987) 326:194–197.[CrossRef][Medline]

  93. Van Raamsdonk J.M., Pearson J., Rogers D.A., Bissada N., Vogl A.W., Hayden M.R., Leavitt B.R. Loss of wild-type huntingtin influences motor dysfunction and survival in the YAC128 mouse model of Huntington disease. Hum. Mol. Genet. (2005) 14:1379–1392.[Abstract/Free Full Text]

  94. Leavitt B.R., Guttman J.A., Hodgson J.G., Kimel G.H., Singaraja R., Vogl A.W., Hayden M.R. Wild-type huntingtin reduces the cellular toxicity of mutant huntingtin in vivo. Am. J. Hum. Genet. (2001) 68:313–324.[CrossRef][Web of Science][Medline]

  95. Li X.J., Li S.H., Sharp A.H., Nucifora F.C. Jr, Schilling G., Lanahan A., Worley P., Snyder S.H., Ross C.A. A huntingtin-associated protein enriched in brain with implications for pathology. Nature (1995) 378:398–402.[CrossRef][Medline]

  96. Szebenyi G., Morfini G.A., Babcock A., Gould M., Selkoe K., Stenoien D.L., Young M., Faber P.W., MacDonald M.E., McPhaul M.J., et al. Neuropathogenic forms of huntingtin and androgen receptor inhibit fast axonal transport. Neuron (2003) 40:41–52.[CrossRef][Web of Science][Medline]

  97. Trushina E., Dyer R.B., Badger J.D. II, Ure D., Eide L., Tran D.D., Vrieze B.T., Legendre-Guillemin V., McPherson P.S., Mandavilli B.S., et al. Mutant huntingtin impairs axonal trafficking in mammalian neurons in vivo and in vitro. Mol. Cell. Biol. (2004) 24:8195–8209.[Abstract/Free Full Text]

  98. Wheeler V.C., White J.K., Gutekunst C.A., Vrbanac V., Weaver M., Li X.J., Li S.H., Yi H., Vonsattel J.P., Gusella J.F., et al. Long glutamine tracts cause nuclear localization of a novel form of huntingtin in medium spiny striatal neurons in HdhQ92 and HdhQ111 knock-in mice. Hum. Mol. Genet. (2000) 9:503–513.[Abstract/Free Full Text]

  99. Trettel F., Rigamonti D., Hilditch-Maguire P., Wheeler V.C., Sharp A.H., Persichetti F., Cattaneo E., MacDonald M.E. Dominant phenotypes produced by the HD mutation in STHdh(Q111) striatal cells. Hum. Mol. Genet. (2000) 9:2799–2809.[Abstract/Free Full Text]

  100. Ke Y., Ming Qian Z. Iron misregulation in the brain: a primary cause of corpneurodegenerative disorders. Lancet Neurol. (2003) 2:246–253.[CrossRef][Web of Science][Medline]

  101. Mancuso M., Davidzon G., Kurlan R.M., Tawil R., Bonilla E., Di Mauro S., Powers J.M. Hereditary ferritinopathy: a novel mutation, its cellular pathology, and pathogenic insights. J. Neuropathol. Exp. Neurol. (2005) 64:280–294.[Web of Science][Medline]

  102. Curtis A.R., Fey C., Morris C.M., Bindoff L.A., Ince P.G., Chinnery P.F., Coulthard A., Jackson M.J., Jackson A.P., McHale D.P., Hay D., Barker W.A., et al. Mutation in the gene encoding ferritin light polypeptide causes dominant adult-onset basal ganglia disease. Nat. Genet. (2001) 28:350–354.[CrossRef][Web of Science][Medline]

  103. Levi S., Cozzi A., Arosio P. Neuroferritinopathy: a neurodegenerative disorder associated with L-ferritin mutation. Best Prac. Res. Clin. Haematol. (2005) 18:265–276.[CrossRef]

  104. Pandolfo M. Iron metabolism and mitochondrial abnormalities in Friedreich ataxia. Blood Cells Mol. Dis. (2002) 29:536–552.[CrossRef][Web of Science][Medline]

  105. Rotig A., de Lonlay P., Chretien D., Foury F., Koenig M., Sidi D., Munnich A., Rustin P. Aconitase and mitochondrial iron-sulphur protein deficiency in Friedreich ataxia. Nat. Genet. (1997) 17:215–217.[CrossRef][Web of Science][Medline]

  106. Browne S.E., Beal M.F. The energetics of Huntington's disease. Neurochem. Res. (2004) 29:531–546.[CrossRef][Web of Science][Medline]

  107. Westerfield M. The Zebrafish Book: A guide to the laboratory use of Zebrafish (Danio rerio), 3rd edn. University of Oregon Press, Eugene. (1995).

  108. Kimmel C.B., Ballard W.W., Kimmel S.R., Ullmann B., Schilling T.F. Stages of embryonic development of the zebrafish. Dev. Dyn. (1995) 203:253–310.[Web of Science][Medline]

  109. Turner D.L., Weintraub H. Expression of achaete-scute homolog 3 in Xenopus embryos converts ectodermal cells to a neural fate. Genes Dev. (1994) 8:1434–1447.[Abstract/Free Full Text]

  110. Westin J., Lardelli M. Three novel Notch genes in zebrafish: implications for vertebrate Notch gene evolution and function. Dev. Genes Evol. (1997) 207:51–63.[CrossRef][Web of Science]

  111. Jowett T. Tissue in Situ Hybridization: Methods in Animal Development. Wiley, New York. (1997).

  112. Lieschke G.J., Oates A.C., Crowhurst M.O., Ward A.C., Layton J.E. Morphologic and functional characterization of granulocytes and macrophages in embryonic and adult zebrafish. Blood (2001) 98:3087–3096.[Abstract/Free Full Text]

  113. Sundberg R.D., Broman H. The application of the Prussian blue stain to previously stained films of blood and bone marrow. Blood (1955) 10:160–166.[Abstract/Free Full Text]

  114. Team R.D.C. R: A Language and Environment for Statistical Computing (2006) 2.4.1 edn. Vienna, Austria: R Foundation for Statistical Computing.

  115. Dautry-Varsat A. Receptor-mediated endocytosis: the intracellular journey of transferrin and its receptor. Biochimie (1986) 68:375–381.[Medline]

  116. Fleming M.D., Romano M.A., Su M.A., Garrick L.M., Garrick M.D., Andrews N.C. Nramp2 is mutated in the anemic Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron transport. Proc. Natl Acad. Sci. USA (1998) 95:1148–1153.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Hum Mol GenetHome page
T. L. Henshall, B. Tucker, A. L. Lumsden, S. Nornes, M. T. Lardelli, and R. I. Richards
Selective neuronal requirement for huntingtin in the developing zebrafish
Hum. Mol. Genet., December 15, 2009; 18(24): 4830 - 4842.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
M Futter, H Diekmann, E Schoenmakers, O Sadiq, K Chatterjee, and D C Rubinsztein
Wild-type but not mutant huntingtin modulates the transcriptional activity of liver X receptors
J. Med. Genet., July 1, 2009; 46(7): 438 - 446.
[Abstract] [Full Text] [PDF]

Home page
 DMMHome page
S. Zhang, M. B. Feany, S. Saraswati, J. T. Littleton, and N. Perrimon
Inactivation of Drosophila Huntingtin affects long-term adult functioning and the pathogenesis of a Huntington's disease model
Dis. Model. Mech., May 1, 2009; 2(5-6): 247 - 266.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
P. G. Fraenkel, Y. Gibert, J. L. Holzheimer, V. J. Lattanzi, S. F. Burnett, K. A. Dooley, R. A. Wingert, and L. I. Zon
Transferrin-a modulates hepcidin expression in zebrafish embryos
Blood, March 19, 2009; 113(12): 2843 - 2850.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
H. Diekmann, O. Anichtchik, A. Fleming, M. Futter, P. Goldsmith, A. Roach, and D. C. Rubinsztein
Decreased BDNF Levels Are a Major Contributor to the Embryonic Phenotype of Huntingtin Knockdown Zebrafish
J. Neurosci., February 4, 2009; 29(5): 1343 - 1349.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Goytain, R. M. Hines, and G. A. Quamme
Huntingtin-interacting Proteins, HIP14 and HIP14L, Mediate Dual Functions, Palmitoyl Acyltransferase and Mg2+ Transport
J. Biol. Chem., November 28, 2008; 283(48): 33365 - 33374.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/16/1905    most recent
ddm138v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (8)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lumsden, A. L.
Right arrow Articles by Richards, R. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lumsden, A. L.
Right arrow Articles by Richards, R. I.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?