Skip Navigation


Human Molecular Genetics Advance Access originally published online on December 22, 2006
Human Molecular Genetics 2007 16(2):199-209; doi:10.1093/hmg/ddl464
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/2/199    most recent
ddl464v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Schneikert, J.
Right arrow Articles by Behrens, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schneikert, J.
Right arrow Articles by Behrens, J.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Truncated APC regulates the transcriptional activity of ß-catenin in a cell cycle dependent manner

Jean Schneikert*, Annette Grohmann and Jürgen Behrens

Nikolaus-Fiebiger-Center for Molecular Medicine, University Erlangen-Nürnberg, Glückstrasse 6, 91054 Erlangen, Germany

* To whom correspondence should be addressed. Tel: +49 91318529110; Fax: +49 91318529111; Email: jschneik{at}molmed.uni-erlangen.de

Received October 9, 2006; Revised November 28, 2006; Accepted December 8, 2006


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Most colon cancer cells express truncated versions of the tumour suppressor Adenomatous Polyposis Coli (APC). These molecules are selected during tumourigenesis for impaired ß-catenin degrading activity. In this study, we describe that truncated APC can still control the activity of ß-catenin in colon cancer cell lines via its first 20 amino acid repeat. First, we show that both endogenous and ectopically expressed truncated APC molecules can bind to ß-catenin. Second, reduction of the levels of truncated APC by RNA interference increases the activity of a ß-catenin-dependent reporter gene and stimulates the expression of the ß-catenin target gene AXIN2/conductin. This occurs without alterations of the amounts of cytosolic ß-catenin. Conversely, ectopic expression of truncated APC decreases ß-catenin-dependent transcription without affecting the intensity of immunofluorescence staining of ß-catenin in transfected cells. Third, we reveal that the APC level increases when cells reach the G1-S boundary during cell cycle progression. Simultaneously, the amount of ß-catenin bound to APC increases and the transcriptional activity of ß-catenin drops in an APC-dependent manner. Again, this occurs independently of the amounts of either total or phosphorylated cytosolic ß-catenin. Together, these results indicate that truncated APC controls the ability of ß-catenin to activate transcription. As we also show that the inhibition involves the first 20 amino acid repeat of APC, our data suggest that colon cancer cells retain a truncated APC molecule containing at least the first 20 amino acid repeat to modulate the transcriptional activity of ß-catenin in a cell cycle-dependent manner.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Colon cancer is an important health problem in the western societies. The development of the disease is initiated by the aberrant outgrowth of adenomatous polyps from the colonic epithelium that ultimately evolve into aggressive carcinomas (1–3). The growth of the polyps is associated in most cases with alterations of both alleles of the Adenomatous Polyposis Coli (APC) gene. The analysis of the spectrum of APC mutations found in the familial adenomatous polyposis syndrome (FAP) and in sporadic cases of colon cancer allowed to distinguish two inter-dependent events (4–6). A first mutational hit occurs roughly in the middle of the open reading frame and leads to the synthesis of a truncated APC molecule lacking the C-terminal half. The various mutations corresponding to this situation are located in the so-called mutation cluster region (MCR) (Fig. 1). The second mutational hit involves either the deletion of the second allele or a mutation that also leads to the synthesis of a truncated product but almost never occurs after the MCR. Thus, colon cancer cells express at least a truncated APC molecule whose length is defined by the position of the MCR and, occasionally, an additional but shorter fragment.


Figure 4641
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 1. Schematic representation of the different APC isoforms that have been investigated. APC2843 is the human wild-type molecule. APC1417 and APC1338 are truncated products expressed by DLD1 and SW480 human colon cancer cells, respectively. FlagAPC1287 is a truncated mouse APC tagged at its N-terminus with the flag epitope. YFP–APCwt, YFP–APC1287, YFP–APC1247, YFP-APC959–1287, YFP-APC959–1247 and YFP-APC959–1287µ are human APC constructs fused to YFP. The numbers refer to the amino acid positions of the molecules. Shown are the Armadillo repeat (arm), the 15 (light grey) amino acid repeats, the wild-type (dark grey) and mutated (dots) 20 amino acid repeats at positions 1265–1284, the location of the MCR at positions 1286–1500 and the SAMP repeats (black).

 
Although it is becoming increasingly clear that APC is a multifunctional protein (7) involved in cell adhesion (8), polarity, migration, mitosis, apoptosis and neuronal differentiation, it is best understood as a component of the Wnt signalling pathway that translates extracellular mitogenic signals into changes of gene expression (9). The cytosolic protein ß-catenin is the effector of nuclear transmission. When the pathway is in its off-state, APC stimulates the degradation of ß-catenin in a destruction complex including axin/conductin (10,11). The phosphorylation of ß-catenin on residues 33 and 37 constitutes a signal for recognition by the protein ß-TrCP and subsequent degradation (12,13). When the pathway is activated, the destruction complex is inhibited. This leads to the stabilization of ß-catenin that translocates into the nucleus where it activates the transcription of specific target genes either together with members of the lymphoid enhancer factor (LEF/TCF) family of transcription factors (14–16) or independent of them (17). Importantly, ß-catenin is not transcriptionally competent when residues 33 and 37 are phosphorylated (18). The target genes comprise AXIN2/conductin that is transcribed as part of a negative feed-back regulatory loop (19,20). The 3'-border of the MCR lies upstream and very close to the first Ser-Ala-Met-Pro (SAMP) repeat (Fig. 1). Truncation of APC is thought to abolish the formation of a functional destruction complex by removing all SAMP repeats that are binding sites for axin/conductin (11,21,22). As a consequence, cells are permanently fed with a constitutive mitogenic signal.

It is not clear why a selective pressure forces colon cancer cells to keep a truncated APC fragment of a minimal length rather than deleting the whole open reading frame. The truncated fragment may provide a dominant function not shared by the full-length APC. In favour of this hypothesis, it has been shown that truncated APC influences the migration of colon cancer cells (23), enhances chromosomal instability in a dominant manner (24–27) and counteracts the degradation of ß-catenin catalyzed by wild-type APC (28). Alternatively, the truncated APC fragment may fulfil an essential function and cells may not survive from a whole deletion of both APC alleles. Recently, it was shown that truncated APC is required for optimal cell proliferation and DNA replication (29). Interestingly, a strong selective pressure favours the retention of the first 20 amino acid repeat (25) that binds ß-catenin (Fig. 1) and is involved in its degradation in the full length version of APC. This observation defines the 5'-border of the MCR, located just downstream of the first 20 amino acid repeat. However, as it was also originally reported that truncated APC is lacking any ß-catenin degrading activity (30), the significance of the presence of the first 20 amino acid repeat in truncated APC fragments is unclear.

In this communication, we provide evidence that truncated APC still influences the transcriptional activity of ß-catenin through its first 20 amino acid repeat, despite the lack of any ß-catenin degrading activity. Our data suggest that the location of the 5'-border of the MCR is imposed by the necessity of controlling the activity of ß-catenin in a cell cycle-dependent manner.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Knock-down of truncated APC stimulates the transcriptional activity of ß-catenin but not its expression level
To study whether truncated APC might still control the transcriptional activity of ß-catenin, we used DLD1 and SW480 colon cancer cells that express different APC isoforms. DLD1 and SW480 cells contain only truncated APC products with the C-terminus lying downstream of the second and the first 20 amino acid repeat, respectively (Fig. 1). HCT116 cells express wild-type APC but a mutated ß-catenin isoform that cannot be phosphorylated and therefore not degraded in the destruction complex. These three cell lines were transiently transfected with an siRNA against APC (29), which led to the efficient down-regulation of the endogenous APC level (Fig. 2A). In parallel, cytosolic extracts were prepared to specifically determine the levels of cytosolic signalling ß-catenin. SiAPC did not affect the endogenous levels of either total cytosolic ß-catenin or ß-catenin phosphorylated at position 33 and 37. However, the removal of APC was accompanied by a rough 2-fold up-regulation of the activity of a specific ß-catenin-dependent reporter (Fig. 2A). Similarly, the endogenous levels of axin2/conductin, the product of a known ß-catenin target gene (19,20) increased in DLD1 and HCT116 cells upon APC depletion, and to a slighter degree also in SW480 cells. Thus, APC down-regulation stimulates ß-catenin-dependent transcription without affecting ß-catenin levels, indicating that APC depletion leads to an increase of transcriptionally active ß-catenin. The expression of axin2/conductin was only slightly affected in SW480 cells, probably because it nearly reached a maximum in these cells which produce relatively high amounts of ß-catenin. This does not apply to the reporter gene which is introduced in multiple copies upon transfection.


Figure 4642
View larger version (49K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 2. Truncated APC modulates the transcriptional activity of ß-catenin. (A) RNA interference of APC stimulates the transcriptional activity of ß-catenin without altering its levels. SW480 and DLD1 cells were transiently transfected with either siGFP as a control or siAPC targeting the APC messenger, together with a ß-catenin-dependent reporter gene (TOP) or a control reporter gene (FOP). Represented is the mean TOP/FOP ratio of three independent experiments. FOP activities were not significantly altered in different conditions. Triton-X100 cell extracts (Tx100) and cytosolic cell extracts (cytosolic) were submitted to western blotting analysis, using the indicated antibodies. The data are representative of three independent experiments. (B) Ectopic expression of flagAPC1287 inhibits the transcriptional activity of ß-catenin. SW480 and DLD1 cells were transiently transfected with either a ß-catenin-dependent reporter gene (TOP) or a control reporter gene (FOP) together with an empty vector or an expression vector for either wild-type APC or the truncated flagAPC1287, where indicated. Represented is the mean TOP/FOP ratio of three experiments. FOP activities were not significantly altered in different conditions. (C) flagAPC1287 interacts with ß-catenin. SW480 cells were transiently transfected with either the control vector pcDNAflag (C) or an expression vector for flagAPC1287 (1287). Immunoprecipitation was performed with an anti-flag antibody followed by a western blotting analysis using either the anti-APC antibody Ab1 or an anti-ß-catenin antibody. The asterisk indicates endogenous APC present in extracts. The data are representative of two independent experiments.

 
Truncated APC down-regulates the transcriptional activity of, and interacts with ß-catenin
The previous result predicts that up-regulation of truncated APC should be followed by a reduction of the ß-catenin-dependent transcriptional activity. To test this hypothesis, SW480 and DLD1 cells were transiently transfected with a ß-catenin reporter gene together with a mouse APC construct spanning amino acid 1–1287 (mflagAPC1287) and a wild-type APC construct as a positive control (APC2843) (Fig. 1). As expected, wild-type APC efficiently inhibited transcription from the reporter gene in both cell lines. In addition, mflagAPC1287 also exerted an inhibitory activity on the reporter gene (Fig. 2B). In parallel, immmunoprecipitation of transiently transfected mflagAPC1287 from SW480 cell extracts demonstrated its interaction with ß-catenin (Fig. 2C). Thus, these ectopic expression experiments revealed that truncated APC1287 can bind to ß-catenin and inhibit its transcriptional activity.

The 20 amino acid repeat of truncated APC is required to down-regulate the transcriptional activity of ß-catenin
Truncated APC as expressed by SW480 cells contains four 15 amino acid repeats (31) and only the first 20 amino acid repeat (Fig. 1), all of them being able to bind to ß-catenin, though with drastically different affinities (31–33). To identify the repeats responsible for the inhibition of the transcriptional activity associated with ß-catenin, progressive deletion mutants of APC were fused to the GFP variant YFP (34) (Fig. 1), containing either the four 15 amino acid repeats and the first 20 amino acid repeat (YFP–APC1287), or the four 15 amino acid repeats only (YFP–APC1247). These constructs and the full length APC sequence fused to YFP (YFP–APCwt) were transiently transfected into SW480 cells together with a ß-catenin-dependent reporter gene. As expected and in line with results of Figure 2B, YFP–APCwt and YFP-APC1287 repressed transcription from the reporter gene, although the latter construct was less efficient (Fig. 3A). In contrast, YFP–APC1247 was devoid of any repressing activity, although it was similarly expressed as YFP–APC1287 (Fig. 3B). As a control, transfected cells were observed under a fluorescence microscope to reveal the intracellular localization of the different YFP–APC fusion constructs (Fig. 3C). As expected, YFP–APCwt localized to filamentous structures that are probably microtubules, as previously described (10,35,36). In contrast, YFP–APC1287 and YFP–APC1247 localized diffusely in the cytoplasm and also in bright cytoplasmic punctuate structures, as previously reported (37). The origin of the latter is not clear, but as YFP–APC1287 and YFP–APC1247 displayed a very similar if not identical subcellular distribution, we concluded that the difference in their ability to down-regulate ß-catenin-dependent transcription was not due to a different intracellular localization. Consequently, the 20 amino acid repeat included in YFP–APC1287 was responsible for the down-regulation of ß-catenin-dependent transcription.


Figure 4643
View larger version (39K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 3. The 20 amino acid repeat of truncated APC mediates the inhibition of ß-catenin-dependent transcription. SW480 cells were transiently transfected with expression vectors encoding either YFP or the indicated YFP–APC fusions. (A, D) Cells were additionally co-transfected with either the ß-catenin-dependent TOP reporter gene or the control reporter FOP lacking any TCF binding site, together with a ß-galactosidase gene as an internal control. Results are expressed as the ratios of TOP and FOP values and are the mean of five independent experiments. FOP activities were not significantly altered in different conditions. (B, E) ß-catenin co-immunoprecipitates with truncated APC. Extracts (extracts) were submitted to immunoprecipitation using an anti-GFP antibody (IP-GFP) and the immunoprecipitates were probed with antibodies against GFP and ß-catenin. The data are representative of at least three independent experiments. (C) The intracellular localization of the YFP–APC constructs is shown and ß-catenin was revealed with a specific antibody. Hoechst, DNA staining. The data are representative of three independent experiments.

 
Efficient ß-catenin binding by truncated APC requires the 20 amino acid repeat
Next, we aimed to compare the amounts of ß-catenin interacting with YFP–APC1287 and YFP–APC1247. For that purpose, the different YFP–APC constructs were transiently transfected into SW480 cells, immunoprecipitation was performed using anti-GFP antibodies and the amount of ß-catenin bound to each YFP–APC mutant was revealed with an antibody against ß-catenin (Fig. 3B). The experiment showed that YFP–APC1247 was binding less efficiently to ß-catenin than YFP–APC1287. Together with the above results, it suggests that the down-regulation of ß-catenin-dependent transcription requires the ability for APC to bind efficiently to ß-catenin.

The ß-catenin binding region of truncated APC is sufficient to inhibit the transcriptional activity of ß-catenin
To delineate more precisely the regions of truncated APC sufficient to control the transcriptional activity of ß-catenin, the constructs YFP–APC1287 and YFP–APC1247 were deleted from amino acid 1 to 958, leaving short fragments called YFP-APC959–1287 and YFP-APC959–1247 and containing only the respective ß-catenin binding sites (Fig. 1). An additional construct derived from YFP-APC959–1287 was also created, YFP-APC959–1287µ, where serines 1271, 1275, 1276, 1278 and 1281 were exchanged for alanine. Phosphorylation of the four latter serine residues considerably increases the affinity of the 20 amino acid repeat for ß-catenin (32,33) and their replacement by alanine is expected to affect the interaction between APC and ß-catenin. After transient transfection into SW480 cells together with a ß-catenin reporter gene, only YFP-APC959–1287 displayed an inhibitory activity towards the reporter gene, whereas YFP-APC959–1247 and YFP-APC959–1287µ were inactive (Fig. 3D). The three constructs were expressed at a similar level (Fig. 3E) and their intracellular localizations were identical and indistinguishable from the localization of YFP (unpublished data). The experiment showed that an APC fragment containing the 15 amino acid repeats and the first 20 amino acid repeat is sufficient to down-regulate the activity of ß-catenin. In addition, in immunoprecipitation experiments using an anti-GFP antibody, YFP-APC959–1287 displayed a stronger ß-catenin binding activity than YFP-APC959–1247 and YFP-APC959–1287µ (Fig. 3E). Together, the data indicate that inhibition of ß-catenin signalling by truncated APC can be brought by the first 20 amino acid repeat which also exhibits strong binding to ß-catenin.

YFP–APC1287 does not target ß-catenin for degradation
To get some insight as to how truncated YFP–APC1287 leads to down-regulation of ß-catenin-dependent transcription, immunofluorescence experiments were performed, where SW480 cells transfected with the different YFP–APC constructs were probed with antibodies recognizing endogenous ß-catenin (Fig. 3C). YFP–APCwt stimulated the degradation of ß-catenin, as revealed by the weak ß-catenin staining associated with its expression. In contrast, the overall intensities of ß-catenin staining in cells transfected either with YFP–APC1287 or YFP–APC1247 were very similar to those observed with either untransfected cells (unpublished data) or cells transfected with YFP. However, nuclear and diffuse cytoplasmic staining of ß-catenin was reduced and ß-catenin co-localized with the bright dots generated by YFP–APC1287 and YFP–APC1247 constructs, as previously reported (37). Thus, there is no correlation between the nucleo-cytoplasmic distribution of ß-catenin and the ability of truncated APC to inhibit its transcriptional activity. This confirms also the observation (37) that the absolute concentration of ß-catenin in the nucleus does not correlate with its transcriptional potency. At confluency, the intracellular localizations of both APC1287 and APC1247 do not change, as well as co-localization of ß-catenin with these constructs. However, ß-catenin that does not co-localize with APC concentrates at adherens junctions (unpublished data), as previously reported (38). Altogether, these experiments indicated, therefore, that YFP–APC1287 is not able to target ß-catenin for degradation.

APC levels are regulated during cell cycle progression
We asked whether the amount of endogenous truncated APC was fluctuating during cell cycle progression. To investigate this possibility, SW480 cells were synchronized with the compound aphidicolin that inhibits DNA polymerases and thus blocks cells at the beginning of the S phase (39). After washing away aphidicolin, cells were allowed to resume replication and the amounts of APC were measured by western blotting (Fig. 4A). In parallel, progression through the S phase was monitored by fluorescence activated cell sorting (FACS) analysis (Fig. 4B). The experiment revealed that the amount of APC increases when cells enter the S phase. Further analysis indicated that the amount of APC returns to its original level when cells enter G2/M (unpublished data). To avoid any unspecific effect of aphidicolin, we also used mimosin as a blocking agent that interrupts the synthesis of desoxyribonucleotides and thus halt the cells at the G1-S boundary (40). Treatment with mimosin led to an increase of APC levels, similarly to aphidicolin. Note that cells incubated with mimosin resume replication with some delay, probably because they first need to reconstitute their pool of desoxyribonucleotides (Fig. 4B). We concluded that truncated APC is up-regulated when SW480 cells reach the S phase. Interestingly, the full-length APC was down-regulated in HEK293 cells under the same conditions (unpublished data), indicating a differential regulation of wild-type and mutated APC.


Figure 4644
View larger version (39K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 4. The levels of APC are up-regulated at the G1-S boundary. Asynchronous (AS) SW480 cells were synchronized with aphidicolin (A) or mimosin (M) and harvested 5 (A5 and M5) and 7 h (A7 and M7) after washing away the blocking agents. The data are representative of at least three independent experiments. (A) Western blotting analysis of Triton-X100 extracts using anti-APC (ALI) and anti-ß-actin antibodies. (B) FACS analysis showing the distribution of cells in the different phases of the cell cycle, as a function of DNA content.

 
High APC levels correlate with low ß-catenin-dependent transcription
We asked whether the transcriptional activity of ß-catenin was varying at the onset of the S phase (Fig. 5). To answer this question, SW480 cells, either asynchronous or blocked with aphidicolin or mimosin for 20 h were transiently transfected with either a ß-catenin-dependent reporter gene or a control reporter gene. Aphidicolin and mimosin were left on the cells during the whole time-course of the experiment (48 h). The cell cycle status of the cells was monitored in parallel cultures shortly before transfection as well as before luciferase measurements. The FACS analysis indicated that the transfection procedure was partially releasing the cells from the aphidicolin block, but most cells were still at the beginning of the S phase. In contrast, the transfection did not affect the mimosin-induced blockade (Fig. 5A). The experiment revealed that the ß-catenin-dependent transcription was reduced when cells were treated with either aphidicolin or mimosin (Fig. 5B). Similarly, the activity of the promoter of the ß-catenin target gene AXIN2/conductin was also repressed at the onset of the S phase. In contrast, the expression of ß-galactosidase was not significantly affected (Fig. 5C). As both aphidicolin and mimosin gave very similar results, we concluded that the transcriptional activity of ß-catenin is down-regulated at the G1-S boundary. Western blot analysis confirmed the up-regulation of truncated APC and the down-regulation of axin2/conductin upon aphidicolin and mimosin treatment (Fig. 5D). Meanwhile, the amounts of cytosolic ß-catenin were not affected, but the level of phosphorylated cytosolic ß-catenin was surprisingly reduced 48 h after the application of aphidicolin and mimosin. In contrast, the levels of phosphorylated cytosolic ß-catenin were not affected after 20 h of incubation with the compounds.


Figure 4645
View larger version (36K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 5. The transcriptional activity of ß-catenin is down-regulated at the G1-S boundary. Asynchronous (AS) SW480 cells were synchronized for 20 h with aphidicolin (A) or mimosin (M) and subsequently transiently transfected with either a ß-catenin-dependent reporter gene (TOPglow) or a control reporter gene lacking any TCF binding site (FOPglow) together with an internal control encoding the ß-galactosidase. Cells were kept in the presence of aphidicolin and mimosin until harvesting them. (A) FACS analysis showing the distribution of cells as a function of DNA content shortly before plasmid transfection (before transfection) and luciferase measurements (after transfection). (B) ß-catenin-dependent transcriptional activity measured 24 h after plasmid transfection. Results are expressed as the ratios of TOPglow and FOPglow values and are the mean of four independent experiments. FOP activities were not significantly altered in different conditions. Similar but weaker effects were obtained when cells were transfected first and then treated with the blocking agents. (C) As in (B) except that the luciferase reporter gene is under the control of the AXIN2/conductin promoter. Results are expressed as the ratios of the luciferase and ß-galactosidase values and are the mean of three independent experiments. The ß-galactosidase values are also shown. (D) Triton-X100 cell extracts (T-X100) and cytosolic cell extracts (cytosolic) prepared from either asynchronous SW480 cells or cells synchronized for either 20 or 48 h with either aphidicolin or mimosin were submitted to western blotting analysis using the indicated antibodies. The data are representative of at least three independent experiments.

 
The reduction of ß-catenin activity at the onset of the S phase involves APC
Next, we asked whether reducing the APC level at the G1-S boundary would affect the transcriptional activity of ß-catenin. Therefore, SW480 cells incubated with either aphidicolin or mimosin were transiently transfected with either siAPC or siGFP as a control, followed by transient transfection of either a ß-catenin-dependent reporter gene or a control reporter gene. Aphidicolin and mimosin were left on the cells during the whole time-course of the experiment (48 h). The efficiencies of aphidicolin and mimosin blockades were monitored at the time of luciferase measurements (Fig. 6A). In parallel, cell extracts were prepared and western blot analysis confirmed the reduction of APC levels after transient transfection of siAPC (Fig. 6B, upper panel). As shown above, the transcriptional activity of ß-catenin was reduced when cells were stopped at the beginning of the S phase (Fig. 6B, middle panel). Also, the luciferase activity increased when asynchronous cells were treated with siAPC; the effect was lower than what is shown in Figure 1A and this likely reflects the differences in RNAi efficiency. SiAPC led to a stimulation of ß-catenin activity in cells cultured in the presence of either aphidicolin or mimosin. This increase was even higher than in asynchronous cells. Thus, we conclude that APC inhibits the transcriptional activity of ß-catenin at the onset of the S phase. The stimulation of ß-catenin transcriptional activity resulting from the reduction of APC levels occurs without an overall increase of the amount of cytosolic ß-catenin and without any significant decrease of phosphorylated cytosolic ß-catenin (Fig. 6B, lower panel).


Figure 4646
View larger version (29K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 6. Truncated APC inhibits the transcriptional activity of ß-catenin at the G1-S boundary. Asynchronous (AS) SW480 cells were synchronized for 20 h with aphidicolin (A) or mimosin (M) and simultaneously transiently transfected with either siGFP as a control or siAPC targeting the APC messenger. The next day, cells were washed and transiently transfected with either a ß-catenin-dependent reporter gene (TOPglow) or a control reporter gene lacking any TCF binding site (FOPglow) together with an internal control encoding the ß-galactosidase. Cells were kept in the presence of aphidicolin and mimosin until harvesting. All cells were harvested 24 h after plasmid transfection. The data are representative of at least three independent experiments. (A) FACS analysis showing the distribution of cells as a function of DNA content. Shown is the overlay of the curves corresponding to siGFP and siAPC transfected cells, shortly before luciferase measurements performed in parallel. (B, upper panel) Triton-X100 cell extracts (T-X100) were submitted to western blotting analysis, using the indicated antibodies. Note here that asynchronous cells cannot be directly compared with either aphidicolin- or mimosin-treated cells, as reflected by ß-actin levels. (Middle panel) ß-Catenin-dependent transcriptional activity. Results are expressed as the ratios of TOPglow and FOPglow values corrected for the ß-galactosidase values and are the mean of four independent experiments. (Lower panel) Cytosolic cell extracts (hypotonic) were submitted to western blotting analysis, using the indicated antibodies.

 
APC titrates ß-catenin during cell cycle progression
Next, we assessed, in immunoprecipitation experiments, the amount of ß-catenin bound to APC when cells enter the S phase. Endogenous APC was immunoprecipitated from hypotonic cell extracts prepared from either control cells or cells synchronized with either aphidicolin or mimosin (Fig. 7). Subsequent western blotting analysis indicated that ß-catenin co-immunoprecipitates in rough proportion to the increase of the amount of APC when cells are treated with either aphidicolin or mimosin. We conclude that APC is titrating ß-catenin, at least partially, while cells are reaching the S phase.


Figure 4647
View larger version (34K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 7. Truncated APC titrates ß-catenin at the G1-S boundary. Asynchronous (AS) SW480 cells were synchronized for 20 h with aphidicolin (A) or mimosin (M) and cytosolic cell extracts (hypotonic) were submitted to immunoprecipitation using an anti-APC antibody. This was followed by a western blotting analysis using either an anti-APC antibody or an anti-ß-catenin antibody. The data are representative of three independent experiments.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
It is well established that the truncation of APC hampers its capacity to target ß-catenin for degradation (30). This loss of function results from the removal of the SAMP repeats that are binding sites for axin/conductin (11,21,22). However, it was discussed that truncated APC might display some residual ß-catenin down-regulating activity (41), despite the lack of any axin/conductin binding site. Therefore, we investigated the possible role of truncated APC in the control of ß-catenin. Our data indicate that truncated APC still modulates the transcriptional activity of ß-catenin. Depletion of endogenous truncated APC in colon cancer cell lines and ectopic expression of equivalent constructs were stimulating and repressing the transcriptional activity of ß-catenin, respectively. In addition, we have also shown that the levels of truncated APC vary during cell cycle progression in SW480 cells, i.e. they increase when the cells reach the G1-S boundary. RNAi allowed us to demonstrate that this increase of truncated APC was responsible for the subsequent inhibition of the transcriptional activity of ß-catenin at the onset of the S phase.

Our experiments did not reveal any enhanced stabilization of ß-catenin upon APC depletion by RNAi, either in asynchronous cells or cells synchronized at the onset of the S phase, though the transcriptional activity of ß-catenin was increasing at the same time. Similarly, depletion of APC in HCT116 cells containing a ß-catenin stabilizing mutation was also accompanied by a stimulation of the transcriptional activity of ß-catenin. In addition, ectopic expression of a GFP–APC1287 fusion construct similar to natural truncated APC variants was not affecting the intensity of the immunofluorescence staining of ß-catenin. Finally, variations of the endogenous APC levels during cell cycle progression were not paralleled by changes in the amounts of cytosolic ß-catenin. Altogether, our data indicate that the control elicited by truncated APC over the transcriptional activity of ß-catenin does not involve a degradation process, since the cytosolic levels of ß-catenin stay constant in all instances where the transcriptional activity is altered.

Similarly, a catalytic mechanism involving the phosphorylation of ß-catenin on Ser33 and Ser37 cannot be invoked to explain how truncated APC controls the transcriptional activity of ß-catenin. It is known that ß-catenin phosphorylated on these residues is unable to stimulate transcription (18). Our data indicate that APC depletion by RNAi does not lead to a modification of the phosphorylation state of ß-catenin. Moreover, the increase of endogenous APC level at the beginning of replication was not accompanied by an increase of the amount of phosphorylated ß-catenin, though the associated transcriptional activity was repressed. Altogether, there is no correlation between an increase of the transcriptional activity of ß-catenin and a reduction of its phosphorylation state on Ser33 and Ser37, and vice versa. Thus, we excluded the possibility that truncated APC might catalyze the phosphorylation of ß-catenin on these residues.

Protein kinase A (PKA) can also contribute to the modulation of the transcriptional activity of ß-catenin, as phosphorylation of Ser675 by PKA was shown to stimulate the transcriptional activity of ß-catenin (42,43). However, neither H89 nor forskolin, an inhibitor and an activator of PKA, respectively, were decreasing or increasing the transcriptional activity of ß-catenin, both in asynchronous SW480 cells and in cells arrested at the onset of replication (unpublished data). Therefore, we can rule out that truncated APC was inhibiting the transcriptional activity of ß-catenin through its connection with the PKA pathway.

The down-regulation of ß-catenin activity appears to require efficient ß-catenin binding activity because ectopic expression of GFP–APC fusion constructs with low ß-catenin binding activity cannot inhibit its transcriptional activity (Fig. 3). Thus, the interaction between truncated APC and ß-catenin appears important for the inhibition. When cycling cells reach the G1-S boundary, the amount of endogenous truncated APC increases (Fig. 4), coinciding with elevated ß-catenin binding to APC (Fig. 7). This supports an APC-mediated titration mechanism for the inhibition of ß-catenin, i.e. APC might retain ß-catenin from interacting with other components, including those of the transcriptional machinery (44). For instance, the interaction of truncated APC with ß-catenin is expected to decrease the amount of free ß-catenin available for TCF because the binding sites of APC and TCF on ß-catenin overlap (32,33,45,46). In addition, the inhibition might be related to the nuclear export of ß-catenin attributed to APC. Nuclear export signals located at the N-terminus of APC are retained in truncated versions (47,48) and the up-regulation of the APC levels might enhance nuclear export of ß-catenin and, as a consequence, inhibit its transcriptional activity. Similarly, although disputing the nuclear export function attributed to APC, the recently described passive retention mechanism of ß-catenin by APC (49) might also explain our observations. Of note, however, YFP–APC1287 and YFP–APC1247 which differed in their competence for inhibiting ß-catenin-dependent transcription kept ß-catenin in the cytoplasm in a similar manner (Fig. 3C), indicating that retention is not the main mechanism by which truncated APC functions. Alternatively, it is also possible that a third component, yet to be identified, contributes in an APC-dependent manner to the hijacking of ß-catenin from its transcriptional competence.

APC binds to ß-catenin through two types of motifs, the so-called 15 and 20 amino acid repeats. The former are thought to bind ß-catenin constitutively with a low affinity (31). In contrast, the 20 amino acid repeats can bind to ß-catenin with a very high affinity when they are phosphorylated (32,33). The first 20 amino acid repeat is absent in very few colon cancers displaying APC mutations (6). Truncated APC constructs lacking all 20 amino acid repeats were drastically hampered in their ability to bind ß-catenin and importantly, they could not influence its transcriptional activity anymore (Fig. 3). Thus, the most N-terminal 20 amino acid repeat of APC is required to modulate the activity of ß-catenin. It was suggested that selection for APC mutations may correlate with the stability of the resulting fragment (50), but a GFP-APC fusion recombinant lacking the first 20 amino acid repeat turned out to be more stable than the counterpart containing it (Fig. 3A). Therefore, we propose that in addition to being stable, truncated APC molecules retain at least one 20 amino acid repeat because it provides the cell with a mechanism to modulate the concentration of ß-catenin available for transcription. This function might be critical for colon cancer cells because the presence of at least the first 20 amino acid repeat is strongly selected during tumourigenesis. Interestingly, the second amino acid repeat cannot bind ß-catenin (32,33,51) and the 3'-border of the MCR at position 1500 falls in the middle of the third 20 amino acid repeat, probably inactivating it (32,33). This suggests that the basis for the selection of truncated APC molecules might be the retention of just one unique functional 20 amino acid repeat.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Materials
Aphidicolin and mimosin were obtained from Sigma (Taufkirchen, Germany). ProtA/G-sepharose was from Santa Cruz Biotechnologies (Heidelberg, Germany).

Cells
SW480, DLD1 and HCT116 colon cancer cells were maintained in DMEM medium (PAA Laboratories, Cölbe, Germany) supplemented with 10% fetal calf serum (Perbio Laboratories, Frankfurt am Main, Germany) and 1% penicillin and 1% streptomycin (PAA Laboratories). In SW480 cells, one allele of the APC gene contains a CAG to TAG transition at codon 1338. In DLD1 cells, which have the same origin as HCT15 cells, the C in codon 1417 GGC is deleted, creating a frameshift. In both cell lines, the second allele is deleted (52). HCT116 cells contain wild-type alleles of APC, but codon 45 in one allele of the ß-catenin gene is deleted, resulting in the synthesis of a stable product (53).

Antibodies
The anti-APC antibody ALI was a kind gift of I. Näthke. The anti-APC antibody Ab1 was from Calbiochem (San Diego, USA). The rabbit antibody against ß-catenin was purchased from BD Biosciences (Heidelberg, Germany). The mouse antibody against ß-catenin phosphorylated on Ser33 and Ser37 (54) was from Sigma (Taufkirchen, Germany). Secondary antibodies coupled to either horseradish peroxidase or Cy3 were from Dianova (Hamburg, Germany), anti-ß-actin from Santa Cruz Biotechnologies (Heidelberg, Germany) and anti-GFP from Roche (Mannheim, Germany). The anti-conductin antibody C/G7 was described earlier (20). The anti-flag antibody was from Sigma.

Plasmids
The plasmids expressing YFP and mouse APC truncated at amino acid 1287 (flagAPC 1287) were kind gifts of B. Mayr (34) and R. Fodde, respectively. pUHC16.1 encodes the ß-galactosidase (21). pcDNAflag was described earlier (21). pCMV-APC2843 encodes human APC (amino acid 2–2843) (35). The construction of YFP–APC was described recently (49). YFP–APC1287 and YFP–APC1247 were obtained by replacing the BstX1–BamH fragment of YFP–APC by a BstX1–BamH1 PCR product containing a stop codon immediately after either codon 1287 or codon 1247, respectively. YFP-APC959–1287 and YFP-APC959–1247 were derived from YFP–APC1287 and YFP–APC1247, respectively, by deleting the internal Bgl2 fragment. YFP-APC959–1287µ was created by replacing the Bgl2–BamH1 fragment of YFP-APC959–1287 by a Bgl2–BamH1 PCR product synthesized with the oligonucleotides GCCGCCAGATCTTCAAATGATAG and TACAAGGATCCTCAACATCCTAT TTCATCTTCAGCTGATGCCAAAGATGCTAATGCAGCA CATCTTGCAAAACATATTG. The plasmid pGL3Ax2Luc encodes the luciferase under the control of the AXIN2 promoter (19).

siRNAs
siAPC (gacgttgcgagaagttgga tt) and the control siGFP (gctacctgttccatggcca tt), were used in this study. The sequences are from the coding strand.

Transfection
Plasmids and siRNAs (50 nM final concentration) were transfected into cells overnight using 5 µl ESCORTTM IV (Sigma, Taufkirchen, Germany) per µg of DNA and 1 µl Transit TKO (MoBiTec, Göttingen, Germany) per µl of siRNA (20µM), respectively. For transient transfection of plasmids, 2 µg total DNA/200 000 cells/35 mm dish were used. Cytosolic cell extracts were prepared as described previously (20). Western blotting was performed according to Behrens et al. (21), except for the detection of full-length APC, where extracts were resolved in a 4% polyacrylamide gel without stacking gel. The blots were developed using the chemiluminescence reagents Western LightningTM (Perkin-Elmer Life Sciences, Boston, MA, USA) and the signals were detected under an LAS-3000-Fuji camera from Raytest (Straubenhardt, Germany). Immunoprecipitations were performed as described by Behrens et al. (21).

TOP/FOP reporter assays
The TOPflash reporter consists of a tandem repeat of four TCF/LEF1 binding sites inserted in front of a minimal c-fos promoter, driving the expression of luciferase in a ß-catenin-dependent manner (16). In the FOPflash reporter, the four binding sites are mutated to abolish the binding of TCF/LEF1. In the TOPglow and FOPglow reporters, the c-fos promoter is replaced by a TATA box (18). The internal control pUHC16.1 encoding the ß-galactosidase was transiently transfected together with either FOP or TOP plasmids in a ratio of 1:2. The ratio of pUHC16.1 to any additional plasmid was 1:4. The transcriptional activity measured 20 h post-transfection is defined as the ratio of TOP and FOP luciferase values normalized to the ß-galactosidase values.


   ACKNOWLEDGEMENTS
 
We thank G. Daum for technical, and A. Doebler for secretarial assistances. We are grateful to F. Costantini for the PGL3Ax2Luc reporter, R. Fodde for the flagAPC1287 expression vector, E. Krieghoff for the YFP–APC expression vector, B. Mayr for the YFP expression vector and Inke Näthke for the anti-APC antibody. This work was supported by a grant from the Nationales Genomforschungsnetzwerk 2 to J.B.

Conflict of Interest statement: none declared.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Kinzler K.W. and Vogelstein B. (1996) Lessons from hereditary colorectal cancer. Cell 87:159–170.[CrossRef][ISI][Medline]

  2. Nathke I.S. (2004) The adenomatous polyposis coli protein: the Achilles heel of the gut epithelium. Annu. Rev. Cell Dev. Biol. 20:337–366.[CrossRef][ISI][Medline]

  3. Radtke F. and Clevers H. (2005) Self-renewal and cancer of the gut: two sides of a coin. Science 307:1904–1909.[Abstract/Free Full Text]

  4. Beroud C. and Soussi T. (1996) APC gene: database of germline and somatic mutations in human tumors and cell lines. Nucleic Acids Res. 24:121–124.[Abstract/Free Full Text]

  5. Polakis P. (2000) Wnt signaling and cancer. Genes Dev. 14:1837–1851.[Free Full Text]

  6. Fearnhead N.S., Britton M.P., Bodmer W.F. (2001) The ABC of APC. Hum. Mol. Genet. 10:721–733.[Abstract/Free Full Text]

  7. Hanson C.A. and Miller J.R. (2005) Non-traditional roles for the Adenomatous Polyposis Coli (APC) tumor suppressor protein. Gene 361:1–12.[CrossRef][ISI][Medline]

  8. Bienz M. and Hamada F. (2004) Adenomatous polyposis coli proteins and cell adhesion. Curr. Opin. Cell Biol. 16:528–535.[CrossRef][ISI][Medline]

  9. Behrens J. and Lustig B. (2004) The Wnt connection to tumorigenesis. Int. J. Dev. Biol. 48:477–487.[CrossRef][ISI][Medline]

  10. Munemitsu S., Souza B., Muller O., Albert I., Rubinfeld B., Polakis P. (1994) The APC gene product associates with microtubules in vivo and promotes their assembly in vitro. Cancer Res. 54:3676–3681.[Abstract/Free Full Text]

  11. Kielman M.F., Rindapaa M., Gaspar C., van Poppel N., Breukel C., van Leeuwen S., Taketo M.M., Roberts S., Smits R., Fodde R. (2002) Apc modulates embryonic stem-cell differentiation by controlling the dosage of beta-catenin signaling. Nat. Genet. 32:594–605.[CrossRef][ISI][Medline]

  12. Hart M.J., de los Santos R., Albert I.N., Rubinfeld B., Polakis P. (1998) Downregulation of beta-catenin by human Axin and its association with the APC tumor suppressor, beta-catenin and GSK3 beta. Curr. Biol. 8:573–581.[CrossRef][ISI][Medline]

  13. Winston J.T., Strack P., Beer-Romero P., Chu C.Y., Elledge S.J., Harper J.W. (1999) The SCFbeta–TRCP–ubiquitin ligase complex associates specifically with phosphorylated destruction motifs in IkappaBalpha and beta-catenin and stimulates IkappaBalpha ubiquitination in vitro. Genes Dev. 13:270–283.[Abstract/Free Full Text]

  14. Behrens J., von Kries J.P., Kuhl M., Bruhn L., Wedlich D., Grosschedl R., Birchmeier W. (1996) Functional interaction of beta-catenin with the transcription factor LEF-1. Nature 382:638–642.[CrossRef][Medline]

  15. Molenaar M., van de Wetering M., Oosterwegel M., Peterson-Maduro J., Godsave S., Korinek V., Roose J., Destree O., Clevers H. (1996) XTcf-3 transcription factor mediates beta-catenin-induced axis formation in Xenopus embryos. Cell 86:391–399.[CrossRef][ISI][Medline]

  16. van de Wetering M., Cavallo R., Dooijes D., van Beest M., van Es J., Loureiro J., Ypma A., Hursh D., Jones T., Bejsovec A., et al. (1997) Armadillo coactivates transcription driven by the product of the Drosophila segment polarity gene dTCF. Cell 88:789–799.[CrossRef][ISI][Medline]

  17. Olson L.E., Tollkuhn J., Scafoglio C., Krones A., Zhang J., Ohgi K.A., Wu W., Taketo M.M., Kemler R., Grosschedl R., et al. (2006) Homeodomain-mediated beta-catenin-dependent switching events dictate cell-lineage determination. Cell 125:593–605.[CrossRef][ISI][Medline]

  18. Staal F.J., Noort Mv.M., Strous G.J., Clevers H.C. (2002) Wnt signals are transmitted through N-terminally dephosphorylated beta-catenin. EMBO Rep. 3:63–68.[CrossRef][ISI][Medline]

  19. Jho E.H., Zhang T., Domon C., Joo C.K., Freund J.N., Costantini F. (2002) Wnt/beta-catenin/Tcf signaling induces the transcription of Axin2, a negative regulator of the signaling pathway. Mol. Cell. Biol. 22:1172–1183.[Abstract/Free Full Text]

  20. Lustig B., Jerchow B., Sachs M., Weiler S., Pietsch T., Karsten U., van de Wetering M., Clevers H., Schlag P.M., Birchmeier W., et al. (2002) Negative feedback loop of Wnt signaling through upregulation of conductin/axin2 in colorectal and liver tumors. Mol. Cell. Biol. 22:1184–1193.[Abstract/Free Full Text]

  21. Behrens J., Jerchow B.A., Wurtele M., Grimm J., Asbrand C., Wirtz R., Kuhl M., Wedlich D., Birchmeier W. (1998) Functional interaction of an axin homolog, conductin, with beta-catenin, APC, and GSK3beta. Science 280:596–599.[Abstract/Free Full Text]

  22. Smits R., Kielman M.F., Breukel C., Zurcher C., Neufeld K., Jagmohan-Changur S., Hofland N., van Dijk J., White R., Edelmann W., et al. (1999) Apc1638T: a mouse model delineating critical domains of the adenomatous polyposis coli protein involved in tumorigenesis and development. Genes Dev. 13:1309–1321.[Abstract/Free Full Text]

  23. Mahmoud N.N., Boolbol S.K., Bilinski R.T., Martucci C., Chadburn A., Bertagnolli M.M. (1997) Apc gene mutation is associated with a dominant-negative effect upon intestinal cell migration. Cancer Res. 57:5045–5050.[Abstract/Free Full Text]

  24. Fodde R., Kuipers J., Rosenberg C., Smits R., Kielman M., Gaspar C., van Es J.H., Breukel C., Wiegant J., Giles R.H., et al. (2001) Mutations in the APC tumour suppressor gene cause chromosomal instability. Nat. Cell Biol. 3:433–438.[CrossRef][ISI][Medline]

  25. Fodde R., Smits R., Clevers H. (2001) APC, signal transduction and genetic instability in colorectal cancer. Nat. Rev. Cancer 1:55–67.[CrossRef][Medline]

  26. Green D.W., Roh H., Pippin J.A., Drebin J.A. (2001) Beta-catenin antisense treatment decreases beta-catenin expression and tumor growth rate in colon carcinoma xenografts. J. Surg. Res. 101:16–20.[Medline]

  27. Tighe A., Johnson V.L., Taylor S.S. (2004) Truncating APC mutations have dominant effects on proliferation, spindle checkpoint control, survival and chromosome stability. J. Cell Sci. 117:6339–6353.[Abstract/Free Full Text]

  28. Dihlmann S., Gebert J., Siermann A., Herfarth C., von Knebel Doeberitz M. (1999) Dominant negative effect of the APC1309 mutation: a possible explanation for genotype–phenotype correlations in familial adenomatous polyposis. Cancer Res. 59:1857–1860.[Abstract/Free Full Text]

  29. Schneikert J. and Behrens J. (2006) Truncated APC is required for cell proliferation and DNA replication. Int. J. Cancer 119:74–79.[CrossRef][ISI][Medline]

  30. Munemitsu S., Albert I., Souza B., Rubinfeld B., Polakis P. (1995) Regulation of intracellular beta-catenin levels by the adenomatous polyposis coli (APC) tumor-suppressor protein. Proc. Natl Acad. Sci. USA 92:3046–3050.[Abstract/Free Full Text]

  31. Eklof Spink K., Fridman S.G., Weis W.I. (2001) Molecular mechanisms of beta-catenin recognition by adenomatous polyposis coli revealed by the structure of an APC–beta-catenin complex. EMBO J. 20:6203–6212.[CrossRef][ISI][Medline]

  32. Ha N.C., Tonozuka T., Stamos J.L., Choi H.J., Weis W.I. (2004) Mechanism of phosphorylation-dependent binding of APC to beta-catenin and its role in beta-catenin degradation. Mol. Cell 15:511–521.[CrossRef][ISI][Medline]

  33. Xing Y., Clements W.K., Le Trong I., Hinds T.R., Stenkamp R., Kimelman D., Xu W. (2004) Crystal structure of a beta-catenin/APC complex reveals a critical role for APC phosphorylation in APC function. Mol. Cell 15:523–533.[CrossRef][ISI][Medline]

  34. Mayr B. and Montminy M. (2001) Transcriptional regulation by the phosphorylation-dependent factor CREB. Nat. Rev. Mol. Cell Biol. 2:599–609.[CrossRef][ISI][Medline]

  35. Smith K.J., Levy D.B., Maupin P., Pollard T.D., Vogelstein B., Kinzler K.W. (1994) Wild-type but not mutant APC associates with the microtubule cytoskeleton. Cancer Res. 54:3672–3675.[Abstract/Free Full Text]

  36. Nathke I.S., Adams C.L., Polakis P., Sellin J.H., Nelson W.J. (1996) The adenomatous polyposis coli tumor suppressor protein localizes to plasma membrane sites involved in active cell migration. J. Cell Biol. 134:165–179.[Abstract/Free Full Text]

  37. Rosin-Arbesfeld R., Cliffe A., Brabletz T., Bienz M. (2003) Nuclear export of the APC tumour suppressor controls beta-catenin function in transcription. EMBO J. 22:1101–1113.[CrossRef][ISI][Medline]

  38. Davies M.L., Roberts G.T., Spiller D.G., Wakeman J.A. (2004) Density-dependent location and interactions of truncated APC and beta-catenin. Oncogene 23:1412–1419.[CrossRef][ISI][Medline]

  39. Byrnes J.J. (1984) Structural and functional properties of DNA polymerase delta from rabbit bone marrow. Mol. Cell. Biochem. 62:13–24.[ISI][Medline]

  40. Perry C., Sastry R., Nasrallah I.M., Stover P.J. (2005) Mimosine attenuates serine hydroxymethyltransferase transcription by chelating zinc. Implications for inhibition of DNA replication. J. Biol. Chem. 280:396–400.[Abstract/Free Full Text]

  41. Albuquerque C., Breukel C., van der Luijt R., Fidalgo P., Lage P., Slors F.J., Leitao C.N., Fodde R., Smits R. (2002) The ‘just-right’ signaling model: APC somatic mutations are selected based on a specific level of activation of the beta-catenin signaling cascade. Hum. Mol. Genet. 11:1549–1560.[Abstract/Free Full Text]

  42. Hino S., Tanji C., Nakayama K.I., Kikuchi A. (2005) Phosphorylation of beta-catenin by cyclic AMP-dependent protein kinase stabilizes beta-catenin through inhibition of its ubiquitination. Mol. Cell. Biol. 25:9063–9072.[Abstract/Free Full Text]

  43. Taurin S., Sandbo N., Qin Y., Browning D., Dulin N.O. (2006) Phosphorylation of beta-catenin by cyclic AMP-dependent protein kinase. J. Biol. Chem. 281:9971–9976.[Abstract/Free Full Text]

  44. Sierra J., Yoshida T., Joazeiro C.A., Jones K.A. (2006) The APC tumor suppressor counteracts beta-catenin activation and H3K4 methylation at Wnt target genes. Genes Dev. 20:586–600.[Abstract/Free Full Text]

  45. Graham T.A., Weaver C., Mao F., Kimelman D., Xu W. (2000) Crystal structure of a beta-catenin/Tcf complex. Cell 103:885–896.[CrossRef][ISI][Medline]

  46. Poy F., Lepourcelet M., Shivdasani R.A., Eck M.J. (2001) Structure of a human Tcf4–beta-catenin complex. Nat. Struct. Biol. 8:1053–1057.[CrossRef][ISI][Medline]

  47. Neufeld K.L., Nix D.A., Bogerd H., Kang Y., Beckerle M.C., Cullen B.R., White R.L. (2000) Adenomatous polyposis coli protein contains two nuclear export signals and shuttles between the nucleus and cytoplasm. Proc. Natl Acad. Sci. USA 97:12085–12090.[Abstract/Free Full Text]

  48. Henderson B.R. and Fagotto F. (2002) The ins and outs of APC and beta-catenin nuclear transport. EMBO Rep. 3:834–839.[CrossRef][ISI][Medline]

  49. Krieghoff E., Behrens J., Mayr B. (2006) Nucleo-cytoplasmic distribution of beta-catenin is regulated by retention. J. Cell Sci. 119:1453–1463.[Abstract/Free Full Text]

  50. Li Z. and Nathke I.S. (2005) Tumor-associated NH2-terminal fragments are the most stable part of the adenomatous polyposis coli protein and can be regulated by interactions with COOH-terminal domains. Cancer Res. 65:5195–5204.[Abstract/Free Full Text]

  51. Liu J., Xing Y., Hinds T.R., Zheng J., Xu W. (2006) The third 20 amino acid repeat is the tightest binding site of APC for beta-catenin. J. Mol. Biol. 360:133–144.[CrossRef][ISI][Medline]

  52. Rowan A.J., Lamlum H., Ilyas M., Wheeler J., Straub J., Papadopoulou A., Bicknell D., Bodmer W.F., Tomlinson I.P. (2000) APC mutations in sporadic colorectal tumors: a mutational ‘hotspot’ and interdependence of the ‘two hits’. Proc. Natl Acad. Sci. USA 97:3352–3357.[Abstract/Free Full Text]

  53. Morin P.J., Sparks A.B., Korinek V., Barker N., Clevers H., Vogelstein B., Kinzler K.W. (1997) Activation of beta-catenin–Tcf signaling in colon cancer by mutations in beta-catenin or APC. Science 275:1787–1790.[Abstract/Free Full Text]

  54. Sadot E., Conacci-Sorrell M., Zhurinsky J., Shnizer D., Lando Z., Zharhary D., Kam Z., Ben-Ze'ev A., Geiger B. (2002) Regulation of S33/S37 phosphorylated beta-catenin in normal and transformed cells. J. Cell Sci. 115:2771–2780.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Hum Mol GenetHome page
E. M. Kohler, A. Derungs, G. Daum, J. Behrens, and J. Schneikert
Functional definition of the mutation cluster region of adenomatous polyposis coli in colorectal tumours
Hum. Mol. Genet., July 1, 2008; 17(13): 1978 - 1987.
[Abstract] [Full Text] [PDF]

Home page
 GENES CELLSHome page
A. P. Kouzmenko, K.-i. Takeyama, Y. Kawasaki, T. Akiyama, and S. Kato
Ligand-dependent interaction between estrogen receptor {alpha} and adenomatous polyposis coli
Genes Cells, July 1, 2008; 13(7): 723 - 730.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Brocardo, Y. Lei, A. Tighe, S. S. Taylor, M. T. S. Mok, and B. R. Henderson
Mitochondrial Targeting of Adenomatous Polyposis Coli Protein Is Stimulated by Truncating Cancer Mutations: REGULATION OF Bcl-2 AND IMPLICATIONS FOR CELL SURVIVAL
J. Biol. Chem., February 29, 2008; 283(9): 5950 - 5959.
[Abstract] [Full Text] [PDF]