Skip Navigation


Human Molecular Genetics Advance Access originally published online on January 2, 2007
Human Molecular Genetics 2007 16(2):210-222; doi:10.1093/hmg/ddl470
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/2/210    most recent
ddl470v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Sabherwal, N.
Right arrow Articles by Rappold, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sabherwal, N.
Right arrow Articles by Rappold, G.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Long-range conserved non-coding SHOX sequences regulate expression in developing chicken limb and are associated with short stature phenotypes in human patients

Nitin Sabherwal1, Fiona Bangs2, Ralph Röth1, Birgit Weiss1, Karin Jantz1, Eva Tiecke2, Georg K. Hinkel3, Christiane Spaich4, Berthold P. Hauffa5, Hetty van der Kamp6, Johannes Kapeller1, Cheryll Tickle2 and Gudrun Rappold1,*

1 Department of Molecular Human Genetics, University of Heidelberg, Im Neuenheimer Feld 366, 69120 Heidelberg, Germany, 2 Division of Cell and Developmental Biology, School of Life Sciences, MSI/WTB Complex, University of Dundee, Dow Street, Dundee DD1 5EH, Scotland, 3 Gemeinschaftspraxis, Friedrichstrasse 38–40, 01067 Dresden, Germany, 4 Institute of Clinical Genetics, Klinikum Stuttgart, Bismarckstrasse 3, 70176 Stuttgart, Germany, 5 Zentrum für Kinderheilkunde, Universitätsklinikum Essen, Hufelandstrasse 55, 45122 Essen, Germany and 6 Department of Paediatrics, Leiden University Medical Center, PO Box 9600, 2300 RC Leiden, The Netherlands

* To whom correspondence should be addressed. Tel: +49 6221565059; Fax: +49 6221568884; Email: gudrun_rappold{at}med.uni-heidelberg.de

Received November 13, 2006; Accepted December 13, 2006


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 ELECTRONIC DATABASE INFORMATION
 REFERENCES
 
Defects in long-range regulatory elements have recently emerged as previously underestimated factors in the genesis of human congenital disorders. Léri-Weill dyschondrosteosis is a dominant skeletal malformation syndrome caused by mutations in the short stature homeobox gene SHOX. We have analysed four families with Léri-Weill dyschondrosteosis with deletions in the pseudoautosomal region but still with an intact SHOX coding region. Using fluorescence in situ hybridization and single nucleotide polymorphism studies, we identified an interval of ~200 kb that was deleted in all tested affected family members but retained in the unaffected members and in 100 control individuals. Comparative genomic analysis of this interval revealed eight highly conserved non-genic elements between 48 and 215 kb downstream of the SHOX gene. As mice do not have a Shox gene, we analysed the enhancer potential in chicken embryos using a green fluorescent protein reporter construct driven by the ß-globin promoter, by in ovo electroporation of the limb bud. We observed cis-regulatory activity in three of the eight non-genic elements in the developing limbs arguing for an extensive control region of this gene. These findings are consistent with the idea that the deleted region in the affected families contains several distinct elements that regulate Shox expression in the developing limb. Furthermore, the deletion of these elements in humans generates a phenotype apparently undistinguishable to those patients identified with mutations in the SHOX coding region and, for the first time, demonstrates the potential of an in vivo assay in chicken to monitor putative enhancer activity in relation to human disease.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 ELECTRONIC DATABASE INFORMATION
 REFERENCES
 
Longitudinal body growth is attained by regulated proliferation and differentiation of the chondrocytes in the growth plate (1). This process is under tight environmental and genetic control and any misregulation can lead to disproportionate or proportionate short stature or various skeletal dysplasias (2). The human SHOX gene (MIM 312865 [OMIM] ) is one of the major genes contributing to longitudinal growth (3,4). SHOX mutations resulting in haploinsufficiency have been reported in patients with isolated short stature (4) and Leri-Weill syndrome (LWS) (MIM 127300 [OMIM] ) (5,6), whereas the homozygous loss of SHOX results in the severe Langer dysplasia (MIM 249700 [OMIM] ) (5). The main clinical features of these two syndromes include mesomelic, disproportionate short stature and a characteristic curving of the radius, known as Madelung deformity, leading to a limited mobility of the wrist. Due to its position within the pseudoautosomal region of the sex chromosomes, SHOX was also hypothesized to play a role in some of the clinical features of Turner syndrome. Human embryo studies subsequently showed that SHOX is strongly expressed in various skeletal structures defective in Turner syndrome, confirming a potential role in bone development and body growth (7). The incidence of SHOX mutations/deletions is estimated to account for ~50–70% of LWS (8–14). In addition, about 3–15% (dependent on the population) of isolated (‘idiopathic’) short stature is caused by SHOX mutations (15–17).

The SHOX gene has highly homologous orthologs in various vertebrate species including chimpanzee, opossum, dog, chicken, frog and Tetraodon fish, but like other genes from the Xp22 region, it is absent in mouse and rat (18). During recent years, availability of the complete genome sequence from various vertebrates has allowed whole genome alignments between species. Comparative sequence analysis has identified pockets of DNA sequences conserved over evolutionary time providing a powerful guide in sorting functional from non-functional DNA (19). This allows not only the identification of genes, but also recognition of gene regulatory elements (20).

Here we report on four families with LWS presenting deletions proximal to the SHOX gene. Comparative genomic analysis identified eight highly evolutionarily conserved non-coding DNA elements (CNEs) within the commonly deleted ~200 kb of DNA. We have tested and used an in ovo electroporation method in chicken embryos for the first time to analyse the enhancer capabilities of these CNEs (21). Using this method we have demonstrated that three CNEs show cis-regulatory activity in the developing limb bud. This argues that these conserved elements may play a role in regulating tissue-specific SHOX expression in the limb bud by acting as enhancers.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 ELECTRONIC DATABASE INFORMATION
 REFERENCES
 
Microdeletions downstream of the SHOX gene
To identify long-range regulatory elements of the SHOX gene, we have analysed the DNA of 122 patients with a clinical manifestation of LWS. By sequence analysis, we first screened for mutations affecting the coding region, the two promoters and the 5'- and 3'-UTRs of SHOX (22). Of 122 patients, 17 presented an intragenic mutation (nine missense, six nonsense, two frameshift mutations) and 47/122 a deletion of the entire gene consistent with previous studies (data not shown). We were interested in those patients who did not have a detectable SHOX mutation in the coding region and who also maintained the SHOX containing cosmid LLNOYCO3'M'34F05 as defined by fluorescence in situ hybridization (FISH) analysis, thus presumably presenting an intact SHOX genomic region (Fig. 1A). We then screened for the presence of the two adjacent cosmids LLNOYCO3'M'15D10 and ICRFc104G0411. According to these analyses, four of the 122 patients analysed (3.28%) presented an intact SHOX gene region (as suggested by two FISH signals with the cosmids LLNOYCO3'M'15D10 and LLNOYCO3'M'34F05), but cosmid ICRFc104G0411 revealed a weaker or no signal on one of the two sex chromosomes. This suggested that a deletion might exist 3' to the SHOX genomic locus in each of these four cases (Fig. 1B). This assumption was confirmed by FISH analysis with various cosmids that map to an interval between 550 and 750 kb from the telomere showing only one signal on one of the two sex chromosomes (Fig. 1A and B). To further verify these results, extensive single nucleotide polymorphism (SNP) analysis was carried out (Fig. 1C). The smallest deletion size was confined to ≤220 kb in family 4 and the largest deletion to 360 kb in family 1. All four families shared a common deletion interval of ~200 kb (Fig. 1A). This genomic interval was found to be deleted—as determined by FISH—in all affected family members tested (n = 16), thus co-segregating with disease. It was retained in all the tested unaffected family members (n = 19) (Fig. 2) and in 100 normal control individuals.


Figure 4701
View larger version (35K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 1. Deletion mapping by FISH and SNP analysis. (A) Schematic representation of the deletion intervals within the PAR1 region in four patients with LWS. The upper panel shows a scheme of the PAR1 region with SHOX (in red) residing between 505.1 and 540.1 kb from the telomere (NCBI build 125, March 2006). The SHOX exons and the cosmid contig used for deletion mapping are shown below the scale bar. All individuals have an intact SHOX region. Map positions of the cosmid clones are indicated by horizontal lines (see Materials and Methods). Black horizontal bars indicate the presence of the respective cosmid clones on both patients' sex chromosomes; white colour depicts the absence of a cosmid on one of the two sex chromosomes and grey colour the breakpoint region. All four index patients share a common minimal deletion of ~200 kb, indicated by vertical dotted lines. (B) FISH of cosmids 15D10, G0411, 29B11 and 57F07 to metaphase chromosomes of index patient of family 4. Note the absence of the signals of cosmids G0411 and 29B11 and presence of signals of cosmids 15D10 and 57F07. The hybridization of 57F07 included a control probe on Xq. (C) Summary of the SNP data of the four index patients and their parents when available. Numbers indicate PCR fragments containing SNPs, named according to their distance (kilobases) from the telomere (build 36.1). Numbers in brackets (below) indicate maximum number of polymorphisms detected within each fragment. Abbreviations are as follows: FD, fragment designation; IP, index patient; F, father; M, mother; Si, sister and So, son; E, heterozygosity of a tested SNP; O, homozygosity of the SNP. (–), SNP marker was not analysed.

 


Figure 4702
View larger version (11K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 2. Pedigrees of families 1–4. Affected individuals are represented by closed symbols and unaffected family members by open symbols. Index patients are indicated by arrows and other family members analysed for deletions by SNP analysis are shown by arrow heads. Members with unknown disease status are indicated with a question mark. Unaffected parents of family 2 were also analysed by FISH and shown to retain the SHOX gene region.

 
Comparative genomic analysis identifies highly conserved non-coding elements within the shared deletion interval
To investigate the functional significance of the deleted region, the DNA sequence from this interval was analysed for the presence of evolutionary conserved genomic elements using the UCSC and ECR genome browsers. The settings of the ECR browser were adjusted to identify sequences with a minimal length of 100 bp and a 70% identity according to the criteria suggested by Dubchak et al. (23). Several non-coding elements conserved in human, dog, opossum, chicken and frog were identified within the common minimal deletion of ~200 kb. The degree of conservation was found to inversely correlate with evolutionary distance (Fig. 3B). The eight most highly conserved elements were selected for further functional analysis. None of these eight conserved elements showed matches with ESTs in any of the genome browsers suggesting that they are non-coding.


Figure 4703
View larger version (38K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 3. Comparative genomic analysis. (A) Schematic representation of the genomic interval containing SHOX. (B) Panel shows comparative genomic analysis using the ECR genome browser of the SHOX genomic locus and the 250 kb interval proximal to it. In the ECR browser, grey colour indicates repetitive elements and white colour non-repetitive segments. Exons are indicated in blue and yellow, and CNEs in red and pink. The width of the red blocks indicates the size of the CNEs and their heights the percentage of conservation between dog, marmoset, chicken, Xenopus and three fish species, Fugu (Takifugu rubripes), Tetraodon and Zebrafish (Danio rerio). Eight highly conserved elements (CNE 2–9) are found within the common minimal ~200 kb deletion interval (highlighted). CNE4, CNE5 and CNE9 with a star symbol show enhancer activity in the developing limb.

 
Three out of eight conserved elements show enhancer activity in the chicken embryo
The selected eight CNEs (CNE 2–CNE 9) were cloned into a reporter construct upstream of the ß-globin promoter driving the expression of green fluorescent protein (GFP) (Fig. 4A) and enhancer activity was monitored in chicken embryos. The ß-globin promoter was selected as it has no basal activity in the absence of an enhancer and the GFP reporter allows detection of low level activity (21). Two constructs, one lacking an enhancer sequence and the other containing the SV40 enhancer, were used as negative and positive controls, respectively. To investigate a potential regulatory activity of the conserved elements CNE 2–CNE 9, we assessed their function as putative enhancers in chicken embryos. We electroporated the limb bud (at stages HH11–22) in ovo (21) so that the results can be directly compared to the wild-type Shox expression pattern (Fig. 4B). An RFP reporter construct was co-electroporated to control for electroporation efficiency. The embryos were analysed for GFP expression 48 h following electroporation when Shox has been shown to be expressed in this region at these stages of development (Fig. 4B). Figure 4C and D shows the results of the electroporation experiments of the CNEs. RFP indicates the cells that were successfully electroporated. The first two panels in Figure 4C show the results of the positive control and negative control electroporations into the limb bud a, a', b and b', respectively. When the SV40 enhancer was introduced (positive control), wide-spread GFP expression in electroporated cells in the limb bud was detected [note similar distribution of GFP and RFP; n = 6/8 in the limb bud (75%)]. In contrast, when no enhancer was introduced (negative control), no GFP was detected in the electroporated cells in the limb after 48 h (compare distribution of GFP and RFP; n = 6/6 in the limb bud). When constructs containing the eight CNEs were introduced into the developing limb bud, GFP expression was detected with CNE 4, 5 and 9 only and not with CNE 2, 3, 6, 7 and 8 (Fig. 4C and D). GFP was expressed in electroporated cells in the proximal part of the limb, where Shox is expressed at this stage (compare with Fig. 4B). The table in Figure 4D summarizes these data including the number of embryos electroporated and those that expressed GFP. Note that, in the limbs which were viewed as whole mounts, positive results were obtained in between 57 and 62% of the cases which compares well with the positive control (75%). As a further control, we have also generated five constructs of similar length and GC content as the CNEs, but from non-conserved, non-coding regions of the X chromosome. All the five sequences are not contained within the deleted interval of the described patients. We electroporated 27 limb buds and can show that none (0/27) of the non-conserved NCE's can drive GFP expression in the limb, indicating that they do not have any enhancer activity in the limb (Fig. 4E and F).


Figure 4704
View larger version (64K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 4. Enhancer analysis in chicken embryos. (A) Schematic representation of the vector constructs used to analyse the enhancer activity of the CNEs and NCEs in chicken embryos. The ß-globin minimal promoter was used to drive the expression of GFP. The CNEs and NCEs were individually cloned upstream of the minimal promoter. (B) Wild-type Shox expression is detected in the mesenchyme of the proximal two-thirds of the developing limb bud at stage HH 26 of chicken embryos. (C) Enhancer activity assayed in the chicken limb buds. Pictures showing limb buds in whole mount. Electroporated regions are indicated by RFP (a' to j'). The SV40 enhancer was used as a positive control, indicated by the presence of GFP expression (a). An empty vector was used as a negative control (b) and shows no GFP expression. CNEs 4, 5 and 9 show enhancer activity in the limb bud (e, f and j). (D) Summary of the individual CNEs fragment size and map positions (NCBI build 36.1) on the X chromosome. The degree of respective conservation between the chicken CNE and the human CNE are indicated as a percentage. The results are detailed as (+) enhancer activity detected, or no enhancer activity (–) and the total number of electroporated embryos tested are also given. (E) Enhancer activity of the non-conserved elements used as further controls was assayed in the chicken limb buds. Pictures showing limb buds in whole mount. (F) Summary of the individual NCE fragment size and map position on the X chromosome (NCBI build 36.1). There is no conservation between human and chicken in the selected NCEs. The results are detailed as no enhancer activity (–) detected and the total number of electroporated embryos tested are given.

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 ELECTRONIC DATABASE INFORMATION
 REFERENCES
 
Haploinsufficiency of the human short stature homeobox gene SHOX leads to various short stature phenotypes. In this study, the analyses of LWS patients for SHOX deletions have revealed four families with an intact SHOX genomic region but with microdeletions downstream of the SHOX gene. The frequency of downstream deletions is lower when compared with previous studies possibly due to the different screening strategy applied (17,24). Thus, we cannot exclude that we may have missed more proximal deletions within the pseudoautosomal region in additional patients. Extensive FISH and SNP analysis have indicated that the analysed deletions share a common interval of ~200 kb sequence. In silico analysis of the shared deleted region showed that the interval is part of an extensive gene desert (25) of about ~750 kb between the genes SHOX and CSF2RA within the pseudoautosomal region (18). Eight CNEs with a high degree of conservation between the human and chicken genome (>70% identities over >200 bp of sequence) but also highly conserved in dog, marmoset and Xenopus were isolated within the 200 kb interval and functionally characterized. Six of these CNEs showed identities of around 80% over >400 bp of sequence between human and chicken (Fig. 4D). These CNEs are also remarkably stable in 150 different human individuals analysed, as for example only one SNP over 1026 bp in CNE5 and three SNPs over 824 bp in CNE9 were identified (data not shown). Such stability and conservation implies strong negative selection or alternatively, a greatly reduced mutation rate or efficient repair (26).

CNEs were identified as an unexpected component of all genomes and have often been shown to be more constrained than coding DNA and non-coding RNAs (27,28). Most CNEs are unique sequences, of unknown function and together comprise ~1–2% of the human genome with a distribution independent of gene location. Transgenic animal models represent the most advanced way to characterize whether CNEs may act as enhancers driving the expression of a minimal promoter-EGFP reporter cassette. A similar strategy has recently been used to map CNEs in the zebrafish genome (29). The ability to drive expression of a reporter gene in an appropriate region of the embryo signifies that the CNE functions as an enhancer. Since SHOX has no murine ortholog, these assays could not be performed in mouse or rat. Recently, chicken has emerged as a powerful model organism for gene function analysis using the newly developed technique of in ovo electroporation. Chicken embryos have also been shown to be useful for the functional analysis of murine-specific enhancers (21).

We have previously demonstrated that Shox expression in the chicken first appears in the limb buds at HH19/20 (30). Therefore, we carried out in ovo enhancer assays in chicken embryos. Eight CNEs were separately cloned upstream of the ß-globin promoter driving the expression of GFP and individually electroporated into the chicken limb bud. Testing these elements revealed that CNEs 2, 3, 6, 7 and 8 did not show any enhancer activity in the limb while CNEs 4, 5 and 9 drive reporter expression in the limb bud (Fig. 4C and D). Furthermore, enhancer activity is detected in regions where the endogenous gene is expressed.

This is the first time that enhancer activity has been tested in the chick limb. Even though it is more difficult to electroporate chick limb mesenchyme than the neural tube epithelium (GFP expression is detected in 75% of the positive controls in the limb compared with 100% for the neural tube; data not shown), this assay nevertheless appears to be very robust with GFP expression being detected in around 60% of the limb buds electroporated with CNE 4, 5 and 9 and no GFP expression being detected in any of the limb buds electroporated with control sequences of a similar GC content and length (n = 27). These results therefore suggest that the chicken limb bud is useful as a rapid and efficient way for the screening activity of enhancers related to human disease.

Known SHOX function can be best correlated with limb development and short stature in patients with SHOX haploinsufficiency and thus the facts that CNEs 4, 5 and 9 drive GFP expression in the limb is particularly pertinent. It is also interesting to note that CNE 5 is duplicated in the genome (31). Its corresponding homolog with an 85% identity over 57 bp maps downstream of SHOX2, a highly homologous gene paralog with identical functional protein domains (32), suggesting some degree of coordinated expression between SHOX and SHOX2 in the limbs (7). Indeed, our recent analysis of Shox and Shox2 expression in chick embryos revealed that expression overlaps (30). It is also interesting to note that deleting the CNE5 homolog downstream of SHOX2 (which unlike SHOX has a mouse ortholog) in a transgenic mouse model results in the loss of the limb expression domain (Cobb and Duboule, personal communication). Together, these results show that differential SHOX expression in the limb is regulated by multiple cis-regulatory elements downstream of the gene. CNE 2, 3, 6, 7 and 8 did not drive detectable expression of GFP and therefore do not appear to have any enhancer activity in the embryonic limb. It is possible, however, that they function in different regions of the embryo or at later stages, e.g. post-natally. Indeed, electroporation of CNE 4, 5 and 9 into the neural tube where Shox is also expressed, were also found to drive GFP expression, as did CNE's 3 and 7 (data not shown). However, this assay is not as robust as that in the limb in that 8/27 (29%) of electroporations using NCEs gave weak positive results. Furthermore, the functional significance of Shox expression in the neural tube is currently unclear.

Very recently, LWS patients with an intact SHOX coding region and deletions downstream of the gene have been described. These studies revealed a commonly shared deletion interval of ~30 kb (24), ~40 kb (33) or ~10 kb (17) in their set of patients. While the minimal region of the first two studies overlap and formally include one of the CNEs (CNE 9) that we studied, enhancer activity assays in an in vivo animal model have not been carried out (24,33). The minimal 10 kb element identified by Huber et al. resides between CNE 8 and CNE 9, neither includes any of the CNEs that we studied nor does it contain any other conserved element suggesting that additional control regions regulating SHOX expression cannot be excluded. The combined results (24,33 and this study) suggest that CNE 9 may represent a particularly frequently deleted CNE in patients with LWS and downstream deletions (Fig. 5). In addition, data from this study shows for the first time that there is not only one but several cis-regulatory elements residing at 3' of the SHOX gene suggesting that deletion of either one of these elements may have an effect on the phenotype.


Figure 4705
View larger version (11K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 5. Comparative schematic representation of overlapping minimal deletions identified within the PAR1 region. The upper panel shows the SHOX genomic locus and its proximal ~250 kb interval. Different minimal deletions that are shared between the tested patients in each of the datasets are represented by double-headed arrows. The lowermost panel shows the overall conservation profile for the deleted regions taken from the UCSC Genome Browser.

 
Complexity in higher vertebrates is conferred by variation in timing, abundance and localization of gene expression. Multiple promoters, as well as enhancers and silencers are often required to obtain this regulation. Enhancers and silencers can work in an orientation- and distance-independent manner to achieve the temporal and spatial expression of the genes they regulate. Disruption of cis-acting enhancers, for example, that are sometimes hundreds of kilobases away from transcriptional start sites, have been reported in aniridia, preaxial polydactyly, Van Buchem disease and campomelic dysplasia (34–38). Genotype–phenotype correlations in some studies have suggested that defects in regulatory sequences might frequently present milder phenotypes than mutations in coding regions. Patients with mutations in SOX9, for example, generally show a more severe phenotype than the ones with defects in regulatory sequences located far from the SOX9 coding region (38). A similar phenomenon might be associated with SHOX-related phenotypes but due to the quantitative character of height and the great clinical variability of SHOX deficiency (8,9), these genotype–phenotype conclusions are difficult to draw.

Cis-regulatory elements comprise clustered target sites for transcription factors. Using bioinformatic approaches, various putative transcription factor binding sites, including those involved in limb development, can be identified. Functional assessment of the transcription factors putatively binding to the CNEs can now be verified by electro-mobility shift assays (EMSA) and/or yeast one hybrid screens. Compilation of all this information will highlight the molecular network involved in SHOX expression and thus its differential transcriptional regulation. The combined results of (24,33 and this study) suggest that although CNE 9 may represent a particularly frequently deleted CNE in the analysed subset of patients, CNE 4 and CNE 5 seem equally important for the proper transcriptional regulation of SHOX.

This is the first comprehensive analysis of putative SHOX enhancer activity in an in vivo system. We have shown that deletions in four families with LWS result in the loss of three cis-regulatory elements from an extended SHOX control region, which can drive reporter gene expression during chicken limb development. These results help to explain why patients with both intact SHOX genes can still show the characteristic malformations associated with SHOX deficiency.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
ELECTRONIC DATABASE INFORMATION
 REFERENCES
 
Clinical evaluation of the patients
Data on age and standard deviations from normal heights were available for the following individuals: Family 1 [III-2 (–2.5 SDS), f, 68 years; III-9 (–3.3 SDS), f, 57 years; IV-2 (–3.1 SDS), f, 48 years; IV-3 (–1.2 SDS), m, 45 years; IV-4 (–3.6 SDS), f, 37 years; IV-16 (–0.1 SDS), m, 40 years; IV-19 (+0.37 SDS), m, 34 years; IV-22 (–3.0 SDS), m, 37 years; V-2 (–0.9 SDS), f, 28 years; V-3 (–2.4 SDS), m, 27 years; V-4 (–3.1 SDS), f, 22 years; V-7 (+0.7 SDS), f, 14 years; V-22 (–2.2 SDS), m, 16.1 years; V-23 (–0.5 SDS), m, 13 years and V-24 (–2.5 SDS), m, 9 years]; index patient of family 2 [(–3.0 SDS) and sitting height/leg length (+3.4 SDS), m, 17 years] and parents [(–0.4 SDS), m (–1.4 SDS), f]; index patient of family 3 (158 cm, f, 16 years) and parents (174 cm, m; 164 cm, f) and members of family 4 [I-2 (–2.0 SDS), f, 64 years; II-1 (–1.6 SDS), m, 46 years; II-3 (–2.0 SDS), m, 43 years; II-4 (–0.5 SDS), f, 39 years; II-5 (–0.6 SDS), m, 41 years; II-6 (–1.4 SDS), f, 38 years; III-2 (–2.8 SDS), f, 12 years; III-3 (–1.3 SDS), f, 10 years; III-4 (–0.7 SDS), f, 7 years; III-5 (–2.4 SDS), f, 11 years; III-6 (–1.0 SDS), m, 9 years and III-7 (–0.2 SDS), m, 5 years]. Eleven members of family 1 (III-2, III-5, III-9, IV-2, IV-3, IV-6, IV-12, IV-23, V-3, V-5 and V-25), the index patient of family 2, two members of family 3 (I-2, II-1) and four members of family 4 (II-3, II-5, III-2 and III-5) presented clinical and radiological features of LWS, such as mesomelic shortening of the fore arms and lower legs, curving of the radius, Madelung deformity, triangularization of the distal radial epiphysis or lucency of distal ulnar border of radius. All individuals were seen by endocrinologists. Disorders such as growth hormone (GH) deficiency, GH receptor defect, malignant neoplastic disease, chronic infectious disease, active rheumatoid arthritis, diabetes mellitus and renal insufficiency were previously ruled out. Short stature was diagnosed when height for sex and chronological age was below the third percentile or below –2 SDS of national height standards.

Patients' material
Peripheral blood samples were collected from 17 members of family 1, three members of family 2, three members of family 3 and 12 members of family 4, after informed consent was obtained. Together 14 males (six affected and eight non-affected) and 21 females (10 affected and 11 non-affected) were analysed. All families were of European origin (two German, one Austrian and one Dutch). FISH was carried out on metaphase spreads of the following individuals: Family 1—III-2, III-7, III-9, IV-2, IV-3, IV-6, IV-17, IV-20, IV-23, V-2, V-3, V-5, V-8, V-9, V-23, V-24, V-25; family 2—I-1, I-2, II-1; family 3—I-1, I-2, II-1; family 4—I-2, II-1, II-3, II-4, II-5, II-6, III-2, III-3, III-4, III-5, III-6, III-7.

FISH analysis
Biotinylated cosmid DNA was hybridized to metaphase chromosomes of lymphocytes of patients as described (39). FISH was performed using the following cosmids: 15D10 (LLN0YCO3'M'15D10), 34F05 (LLN0YCO3'M'34F05), G0411 (ICRFc104G0411), 9E03 (LLN0YCO3'M'9E03), 29B11 (LLN0YCO3'M'29B11), 36A06 (LLN0YCO3'M' 36A06), 51D11 (LLN0YCO3'M'51D11), 61E05 (LLN0YCO3'M'61E05), 57F07 (LLN0YCO3'M'57F07), 21B02 (LLN0YCO3'M'21B02), 46C09 (LLN0YCO3'M'4C09), WI2-2160E21, HucosLi 2/3/2, P0117 (ICRFc104P0117) and E0625 (LLNLC110E0625). One or both cosmid ends were sequenced to derive an exact map position of the respective clones and also analysed regarding their SNPs content (Fig. 1C). Hybridization signals were detected via avidin-conjugated FITC. Chromosomes were counterstained with DAPI. Images of FITC- and DAPI-stained chromosomes were taken separately using a cooled charge coupled device camera system (Photometrics, Tucson AZ, USA).

SNP analysis
SNPs mapping was undertaken to refine the breakpoint regions as defined by FISH. The following SNPs were derived from the SNP database and UCSC genome browser (www.ncbi.nlm.nih.gov/SNP/, www.ucsc.edu/genome): SNPs 539, 541, 547, 552, 555, 563, 573, 588, 605, 625, 638, 645, 652, 662, 667, 676, 687, 690, 692, 701, 711, 723, 735, 737, 748, 766, 771, 772, 775, 784, 796, 801, 817, 893, 905, 910, 915, 928, 939, 940, 946, 949 (Table 1). Depending on the distal and proximal deletion breakpoints, different SNPs were chosen and analysed for sequence heterozygosity in the respective patients. After PCR amplification, PCR products were sequenced on a MEGABACE sequencer (Amersham Bioscience, Piscataway, NJ, USA) using the DYEnamic ET dye terminator Cycle Sequencing Kit according to the manufacturer's instructions. Details of primers and PCR conditions concerning the SNP analysis have been provided in Table 1.


View this table:
[in this window]
[in a new window]

  		Table 1. SNP Primers in the PAR1 region between 536 and 949 kb from the telomere

 
SHOX mutation analysis by direct sequencing
Mutation analysis for the SHOX coding region, 5' and 3'-UTRs and promoters P1 and P2 was carried out as previously described (4 and unpublished data). Primer pairs were previously described (4,8). In total, eight different PCR amplifications were carried out per individual patient DNA. This covers the entire protein-coding region of SHOX as well as the 5'- and 3'-UTRs.

Comparative genomic analysis
The genomic sequence was retrieved from the UCSC genome browser (www.ucsc.edu/genome). The vertebrate sequences orthologous to the human SHOX locus were obtained from the ECR Browser (http://ecrBrowser.dcode.org). Identification of conserved sequences in vertebrates was obtained using a combination of BLASTN and ECR browser tools. An e-value of 1 x 10–7 (corresponding to a sequence size of 100 bp with a 70% homology between species) was used as a threshold to filter out low homology hits between queried and subject sequence. All the alignments obtained represent a comparison of the human SHOX sequence to that of a second species.

Plasmid constructs
Plasmid vector BG-EGFP containing the human globin promoter driving the expression of GFP was kindly provided by Dr J. Johnson (21). The conserved non-coding sequence elements CNE 2–CNE 9 were PCR-amplified using respective primers and human genomic DNA as template: CNE2 For (AAAACCGCGGCGACTAATGATATTCCGCAA), CNE2 Rev (AAAATCTAGATTACCACATTCTCCAAGGAC), CNE3 For (AAAACCGCGGCTCTTCTCCTGACCTCCTAA), CNE3 Rev (AAAATCTAGACTCTCTAATA GATCTAATTA), CNE4 For (AAAACCGCGGTTTGCAGTGTTATGCACTCG), CNE4 Rev (AAAATCTAGACTGGTGTTCGGTCTCAGCTC), CNE5 For (AAAACCGCGGGCCTCCCTCGGGAGCGATTG), CNE5 Rev (AAAATCTAGACATCCTCATCCTGCCTTCGA), CNE6 For (AAAACCGCGGGTGCAGGGAAGCTCCTTCTG), CNE6 Rev (AAAA TCTAGATACCCTAAGCCCTTCCTTCC), CNE7 For (AA AACCGCGGGAGGCTGCAGCTCACCCCGC), CNE7 Rev (AAAATCTAGAAAACTGCACAGACCAGGTCT), CNE8 For (AAAACCGCGGTCCCCTCTGAGCCTGGC AGG), CNE8 Rev (AAAATCTAGACTCCATATCCCTGCAGA GAC), CNE9 For (AAAACCGCGGTATACTTTACTTCTT TGCTG), CNE9 Rev (AAAATCTAGATTGTGTCTGCAGTGTCCCCT). The PCR products were A-overhanged and cloned in the pSTBlue-1/Acceptor vector (Novagen). For subcloning the conserved elements upstream of the human globin promoter, the pSTBlue-1 clones containing the CNEs, were double-digested with SacII and XbaI (MBI Fermentas) and ligated in a similarly digested plasmid vector. For the non-conserved NCEs, the same procedure was carried out. The exact position of the selected sequences on the X chromosome are given in Figure 4F.

PCR reactions were carried out with Expand High Fidelity Taq (Roche). Clones were sequenced on a MEGABACE sequencer (Amersham Bioscience) using the DYEnamic ET dye terminator Cycle Sequencing Kit according to the manufacturer's instructions.

Chicken in ovo electroporations and enhancer reporter expression analysis
Fertilized White Leghorn eggs were obtained from H. Stewart (Lincolnshire, UK) and were incubated at 39°C. One microgram per microliter of the GFP reporter construct containing the conserved NCE (or non-conserved NCE) element was co-electroporated with 1 µg/µl of an RFP expression vector [RFP in pCAGGs driven by the U6 promoter from chick chromosome 28 (40)] and 0.02% fast green. This mix was injected into the limb bud mesenchyme at stages HH 20–22 and electroporated with one pulse of 45 V for 50 ms using 3 mm platinum electrodes placed anterior and posterior to the limb bud. Limb buds were analysed as whole mounts for GFP and RFP expression 48 h following electroporation using a UV fluorescence microscope and a GFP or TXR filter, respectively. Embryos had reached approximately stage HH 26 when the limb buds were analysed.


   ELECTRONIC DATABASE INFORMATION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 ELECTRONIC DATABASE INFORMATION
REFERENCES
 
Online Mendelian Inheritance in Man (MIM), http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=OMIM; The GDB Human Genome Database, http://www.gdb.org; National Center for Biotechnology Information (NCBI), http://www.ncbi.nlm.nih.gov/; UCSC Genome Bioinformatics, http://www.genome.ucsc.edu/; dbSNP, http://www.ncbi.nlm.nih.gov/SNP/.


   ACKNOWLEDGEMENTS
 
We thank Rüdiger Blaschke and Claudia Durand for comments on the manuscript. This work was supported by the Deutsche Forschungsgemeinschaft (N.S.), Medical Faculty of Heidelberg (G.R.), BBSRC (F.K.B.), MRC (C.T., E.T.), The Royal Society (C.T.) and Boehringer Ingelheim (E.T.).

Conflict of Interest statement. None declared.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 ELECTRONIC DATABASE INFORMATION
 REFERENCES
 

  1. Wagner E.F. and Karsenty G. (2001) Genetic control of skeletal development. Curr. Opin. Genet. Dev. 11:527–532.[CrossRef][Web of Science][Medline]

  2. Kant S.G., Wit J.M., Breuning M.H. (2003) Genetic analysis of short stature. Horm. Res. 60:157–165.[CrossRef][Web of Science][Medline]

  3. Ellison J.W., Wardak Z., Young M.F., Gehron Robey P., Laig-Webster M., Chiong W. (1997) PHOG, a candidate gene for involvement in the short stature of Turner syndrome. Hum. Mol. Genet. 6:1341–1347.[Abstract/Free Full Text]

  4. Rao E., Weiss B., Fukami M., Rump A., Niesler B., Mertz A., Muroya K., Binder G., Kirsch S., Winkelmann M., et al. (1997) Pseudoautosomal deletions encompassing a novel homeobox gene cause growth failure in idiopathic short stature and Turner syndrome. Nat. Genet. 16:54–63.[CrossRef][Web of Science][Medline]

  5. Belin V., Cusin V., Viot G., Girlich D., Toutain A., Moncla A., Vekemans M., Le Merrer M., Munnich A., Cormier-Daire V. (1998) SHOX mutations in dyschondrosteosis (Léri-Weill syndrome). Nat. Genet. 19:67–69.[Web of Science][Medline]

  6. Shears D.J., Vassal H.J., Goodman F.R., Palmer R.W., Reardon W., Superti-Furga A., Scambler P.J., Winter R.M. (1998) Mutation and deletion of the pseudoautosomal gene SHOX cause Léri-Weill dyschodrosteosis. Nat. Genet. 19:70–73.[CrossRef][Web of Science][Medline]

  7. Clement-Jones M., Schiller S., Rao E., Blaschke R.J., Zuniga A., Zeller R., Robson S.C., Binder G., Glass I., Strachan T., Lindsay S., Rappold G.A. (2000) The short stature homeobox gene SHOX is involved in skeletal abnormalities in Turner syndrome. Hum. Mol. Genet. 22:695–702.

  8. Schiller S., Spranger S., Schechinger B., Fukami M., Merker S., Drop S.L., Trojer J., Knoblauch H., Kunze J., Seidel J., Rappold G.A. (2000) Phenotypic variation and genetic heterogeneity in Leri-Weill syndrome. Eur. J. Hum. Genet. 8:54–62.[CrossRef][Web of Science][Medline]

  9. Cormier-Daire V., Huber C., Munnich A. (2001) Allelic and non-allelic heterogeneity in dyschondrosteosis (Léri-Weill syndrome). Am. J. Med. Genet. 106:272–274.[CrossRef][Web of Science][Medline]

  10. Grigelioniene G., Schoumans J., Neumeyer L., Ivarsson A., Eklof O., Enkvist O., Tordai P., Fosdal I., Myhre A.G., Westphal O., et al. (2001) Analysis of short stature homeobox-containing gene (SHOX) and auxological phenotype in dyschondrosteosis and isolated Madelung deformity. Hum. Genet. 109:551–558.[CrossRef][Web of Science][Medline]

  11. Falcinelli C., Iughetti L., Percesepe A., Calabrese G., Chiarelli F., Cisternino M., De Sanctis L., Pucarelli I., Radetti G., Wasniewska M., et al. (2001) SHOX point mutations and deletions in Leri-Weill dyschondrosteosis. J. Med. Genet. 39:E33.

  12. Ross J.L., Scott C. Jr, Marttila P., Kowal K., Nass A., Papenhausen P., Abboudi J., Osterman L., Kushner H., Carter P., et al. (2001) Phenotypes associated with SHOX deficiency. J. Clin. Endocrinol. Metab. 86:5674–5680.[Abstract/Free Full Text]

  13. Flanagan S.F., Munns C.F., Hayes M., Williams B., Berry M., Vickers D., Rao E., Rappold G.A., Batch J.A., Hyland V.J., Glass I.A. (2002) Prevalence of mutations in the short stature homeobox containing gene (SHOX) in Madelung deformity of childhood. J. Med. Genet. 39:758–763.[Free Full Text]

  14. Huber C., Cusin V., Le Merrer M., Mathieu M., Sulmont V., Dagoneau N., Munnich A., Cormier-Daire V. (2001) SHOX point mutations in dyschondrosteosis. J. Med. Genet. 38:323–351.[Free Full Text]

  15. Rappold G.A., Fukami M., Niesler B., Schiller S., Zumkeller W., Bettendorf M., Heinrich U., Vlachopapadoupoulou E., Reinehr T., Onigata K., Ogata T. (2002) Deletions of the homeobox gene SHOX (short stature homeobox) are an important cause of growth failure in children with short stature. J. Clin. Endocrinol. Metab. 87:1402–1406.[Abstract/Free Full Text]

  16. Binder G., Ranke M.B., Martin D.D. (2003) Auxology is a valuable instrument for the clinical diagnosis of SHOX haploinsufficiency in school-age children with unexplained short stature. J. Clin. Endocrinol. Metab. 88:4891–4896.[Abstract/Free Full Text]

  17. Huber C., Rossilio M., Munnich A., Cormier-Daire V. French SHOX genesis module. (2006) High incidence of SHOX anomalies in patients with short stature. J. Med. Genet. 43:735–739.[Abstract/Free Full Text]

  18. Blaschke R.J. and Rappold G. (2006) The pseudoautosomal regions, SHOX and disease. Curr. Opin. Genet. Dev. 16:233–239.[CrossRef][Web of Science][Medline]

  19. Pannachio L.A. and Rubin E.M. (2001) Genomic strategies to identify mammalian regulatory sequences. Nat. Rev. Genet. 2:100–109.[CrossRef][Web of Science][Medline]

  20. Kleinjan D.A. and van Heyningen V. (2005) Long-range control of gene expression: emerging mechanisms and disruption in disease. Am. J. Hum. Genet. 76:8–32.[CrossRef][Web of Science][Medline]

  21. Timmer J., Johnson J., Niswander L. (2001) The use of in ovo electroporation for the rapid analysis of neural-specific murine enhancers. Genesis 29:123–132.[CrossRef][Web of Science][Medline]

  22. Blaschke R.J., Topfer C., Marchini A., Steinbeisser H., Janssen J.W., Rappold G.A. (2003) Transcriptional and translational regulation of the Léri-Weill and Turner syndrome homeobox gene SHOX. J. Biol. Chem. 278:47820–47826.[Abstract/Free Full Text]

  23. Dubchak I., Brudno M., Loots G.G., Pachter L., Mayor C., Rubin E.M., Frazer K.A. (2000) Active conservation of non-coding sequences revealed by three-way species comparisons. Genome Res. 10:1304–1306.[Abstract/Free Full Text]

  24. Benito-Sanz S., Thomas N.S., Huber C., Gorbenko del Blanco D., Aza-Carmona M., Crolla J.A., Maloney V., Rappold G., Argente J., Campos-Barros A., Cormier-Daire V., Heath K.E. (2005) A novel class of pseudoautosomal region 1 deletions downstream of SHOX is associated with Léri-Weill dyschondrosteosis. Am. J. Hum. Genet. 77:533–544.[CrossRef][Web of Science][Medline]

  25. Nobrega M.A., Ovcharenko I., Afzal V., Rubin E.M. (2003) Scanning human gene desert for long-range enhancers. Science 302:413.[Free Full Text]

  26. Drake J.A., Bird C., Nemesh J., Thomas D.J., Newton-Cheh C., Reymond A., Excoffier L., Attar H., Antonarakis S.E., Dermitzakis E.T., Hirschhorn J.N. (2006) Conserved non-coding sequences are selectively constrained and not mutation cold spots. Nat. Genet. 38:223–227.[CrossRef][Web of Science][Medline]

  27. Dermitzakis E.T., Kirkness E., Schwarz S., Birney E., Reymond A., Antonarakis S.E. (2004) Comparison of human chromosome 21 conserved nongenic sequences (CEs) with mouse and dog genomes show that their selective constraint is independent of their genic environment. Genome Res. 14:852–859.[Abstract/Free Full Text]

  28. Dermitzakis E.T., Reymond A., Antonarakis S.E. (2005) Conserved non-genic sequences—an expected feature of mammalian genome. Nat. Rev. Genet. 6:151–157.[CrossRef][Web of Science][Medline]

  29. Woolfe A., Goodson M., Goode D.K., Snell P., McEwen G.K., Vavouri T., Smith S.F., North P., Callaway H., Kelly K., et al. (2005) Highly conserved non-coding sequences are associated with vertebrate development. PLoS Biol. 3:e7.[CrossRef][Medline]

  30. Tiecke E., Bangs F., Blaschke R., Farell E.R., Rappold G., Tickle C. (2006) Expression of the short stature homeobox gene Shox is restricted by proximal and distal signals in chick limb buds and affects the length of skeletal elements. Dev. Biol. 298:585–596.[CrossRef][Web of Science][Medline]

  31. McEwen G.K., Woolfe A., Goode D., Vavouri T., Callaway H., Elgar G. (2006) Ancient duplicated conserved noncoding elements in vertebrates: a genomic and functional analysis. Genome Res. doi: 10.1101/gr.4143406.

  32. Blaschke R.J., Monaghan A.P., Schiller S., Schechinger B., Rao E., Padilla-Nash H., Ried T. (1998) Rappold SHOT, a novel SHOX-related homeobox gene is implicated in craniofacial, brain, heart and limb development. PNAS 95:2406–2411.[Abstract/Free Full Text]

  33. Fukami M., Kato F., Tajima T., Yokoya S., Ogata T. (2006) Transactivation function of an ~800-bp evolutionarily conserved sequence at the SHOX 3' region: implications for the downstream enhancer. Am. J. Hum. Genet. 78:167–170.[CrossRef][Web of Science][Medline]

  34. Kleinjan D.A., Seawright A., Schedl A., Quinlan R.A., Danes S., van Heyningen V. (2001) Aniridia-associated translocations, DNase hypersensitivity, sequence comparison and transgenic analysis redefine the functional domain of PAX6. Hum. Mol. Genet. 10:2049–2059.[Abstract/Free Full Text]

  35. Lauderdale J.D., Wilensky J.S., Oliver E.R., Walton D.S., Glaser T. (2000) 3' deletions cause aniridia by preventing PAX6 gene expression. Proc. Natl Acad. Sci. USA 97:13755–13759.[Abstract/Free Full Text]

  36. Lettice L.A., Heaney S.J., Purdie L.A., Li L., de Beer P., Oostra B.A., Goode D., Elgar D., Hill R.E., d Graff E. (2003) A long-range Shh enhancer regulates expression in the developing limb and fin and is associated with preaxial polydactyly. Hum. Mol. Genet. 12:1725–1735.[Abstract/Free Full Text]

  37. Loots G.G., Kneissel M., Keller H., Baptist M., Chang J., Collette N.M., Ovcharenko D., Plajzer-Frick I., Rubin E.M. (2005) Genomic deletions of a long-range bone enhancer misregulates sclerostin in Van Buchem disease. Genome Res. 15:928–935.[Abstract/Free Full Text]

  38. Velagelati G.V., Bien-Willner G.A., Northup J.K., Lockhart L.H., Hawkins J.C., Jalal S.M., Withers M., Lupski J.R., Stankiewicz P. (2005) Position effects due to chromosome breakpoints that map approximately 99 kb upstream and approximately 1.3 Mb downstream of SOX9 in two patients with campomelic dysplasia. Am. J. Hum. Genet. 76:652–662.[CrossRef][Web of Science][Medline]

  39. Lichter P. and Cremer T. (1992) Human Cytogenetics: A Practical Approach(Oxford University Press, Oxford).

  40. Das R.M., Van Hateren N.J., Howell G.R., Farrell E.R., Bangs F.K., Porteous V.C., Manning E.M., McGrew M.J., Ohyama K., Sacco M.A., et al. (2006) A robust system for RNA interference in the chicken using a modified microRNA operon. Dev. Biol. 294:554–563.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Brief Funct Genomic ProteomicHome page
D.-J. Kleinjan and P. Coutinho
Cis-ruption mechanisms: disruption of cis-regulatory control as a cause of human genetic disease
Brief Funct Genomic Proteomic, July 13, 2009; (2009) elp022v1.
[Abstract] [Full Text] [PDF]

Home page
 Brief Funct Genomic ProteomicHome page
G. Elgar
Pan-vertebrate conserved non-coding sequences associated with developmental regulation
Brief Funct Genomic Proteomic, July 1, 2009; 8(4): 256 - 265.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
E Klopocki, C-E Ott, N Benatar, R Ullmann, S Mundlos, and K Lehmann
A microduplication of the long range SHH limb regulator (ZRS) is associated with triphalangeal thumb-polysyndactyly syndrome
J. Med. Genet., June 1, 2008; 45(6): 370 - 375.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/2/210    most recent
ddl470v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Sabherwal, N.
Right arrow Articles by Rappold, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sabherwal, N.
Right arrow Articles by Rappold, G.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?