Human Molecular Genetics Advance Access originally published online on August 18, 2007
Human Molecular Genetics 2007 16(21):2600-2615; doi:10.1093/hmg/ddm217
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Huntingtin has a membrane association signal that can modulate huntingtin aggregation, nuclear entry and toxicity
Department of Biochemistry and Biomedical Sciences, McMaster University, HSC 4H24A, 1200 Main Street West, Hamilton, Ontario, Canada L8N3Z5
* To whom correspondence should be addressed. Tel: +1 9055259140 ext. 22450; Fax: , +1 9055229033; Email: truantr{at}mcmaster.ca
Received June 26, 2007; Revised July 25, 2007; Accepted July 31, 2007
| ABSTRACT |
|---|
|
|
|---|
Huntington's disease is caused by an expanded polyglutamine tract in huntingtin protein, leading to accumulation of huntingtin in the nuclei of striatal neurons. The 18 amino-acid amino-terminus of huntingtin is an amphipathic alpha helical membrane-binding domain that can reversibly target to vesicles and the endoplasmic reticulum (ER). The association of huntingtin to the ER is affected by ER stress. A single point mutation in huntingtin 1–18 predicted to disrupt this helical structure displayed striking phenotypes of complete inhibition of polyglutamine-mediated aggregation, increased huntingtin nuclear accumulation and greatly increased mutant huntingtin toxicity in a striatal-derived mouse cell line. Huntingtin vesicular interaction mediated by 1–18 is specific to late endosomes and autophagic vesicles. We propose that huntingtin has a normal biological function as an ER-associated protein that can translocate to the nucleus and back out in response to ER stress or other events. The increased nuclear entry of mutant huntingtin due to loss of ER-targeting results in increased toxicity.
| INTRODUCTION |
|---|
|
|
|---|
Huntington's disease (HD) is a dominant genetic neurologic disorder affecting 1/25 000 individuals (1). HD symptoms include a progressive loss of motor coordination and function (also known as chorea), eventually contributing to death. The site of pathology in HD is in the brain, particularly in the striatum and the cerebral cortex, with severe loss of up to 30% of the brain mass at death (2). The genetic defect in HD is a CAG DNA triplet repeat expansion in the first exon of the IT15 gene resulting in an expanded polyglutamine tract in the amino-terminus of the huntingtin protein. This polyglutamine expansion can result in the formation of large nuclear and cytoplasmic aggregates of huntingtin. The exact pathological trigger of HD is not known, but expanded polyglutamine confers a genetic gain-of-function in huntingtin that leads to disease (3), as well as a loss of function (4,5). The exact biological function of huntingtin is unknown, but huntingtin has been implicated in vesicular trafficking, i.e. the transport of lipid vesicles (endocytic, synaptic or lysosomal) along microtubules via an energy-dependent motor machinery (6–9). Huntingtin is present in all cells, and is essential for brain development in mice and maintenance of the endoplasmic reticulum (ER) at the cell level (10,11). Huntingtin has also been seen biochemically and by immunofluorescence at the ER, in the nucleus (12–14), and can dynamically travel between the cytoplasm and the nucleus. In proteomic studies, huntingtin has been found in brain membrane fractions (15). Huntingtin has been seen to be involved in transcription regulation of REST/NRSF-responsive genes, potentially by sequestering REST/NRSF in the cytoplasm (16,17). This suggests that huntingtin has the ability to localize to various sub-cellular compartments as part of its normal biological function. From our studies looking at conserved regions of the huntingtin protein, we discovered the presence of a nuclear export signal (NES) within the carboxyl-terminus of the protein (14). In the course of those studies, we noted the extreme sequence conservation of the first 18 amino acids of huntingtin prior to the polyglutamine tract (22+ amino acids when considering the polyglutamine tract). This sequence has been shown to be SUMO-modified, and appears to be important for mediating huntingtin small fragment toxicity in Drosophila models (18).
We hypothesized that this amino-terminal sequence may have a role in huntingtin sub-cellular localization. We fused this sequence to enhanced yellow fluorescent protein (eYFP) and assayed localization of the fusion protein in live striatal-derived STHdh cells (19), under minimal expression conditions. Huntingtin 1–18 appeared to target completely to the ER and vesicles. This targeting was seen to be ATP-dependent, at the ER membrane, and reversible. ER stress response to temperature shift or induction of the unfolded protein response (UPR) resulted in huntingtin release from the ER. By molecular modeling, we hypothesized that huntingtin 1–18 could assume the structure of an amphipathic alpha helix. Based on this hypothetical structure, we made series of point mutants predicted to be on either the hydrophobic or charged face of the helix, as well as a substitution mutant predicted to disrupt the alpha helix structure. These mutant phenotypes were consistent with an alpha helical structure for huntingtin 1–18. We additionally performed circular dichroism spectroscopy studies on a synthetic huntingtin 1–18 peptide with similar conclusions as our in vivo mutant phenotypes, that this sequence was an alpha helix. In the context of a large fragment of huntingtin protein or full-length huntingtin, mutants that disrupted huntingtin 1–18 ER-targeting activity resulted in the constitutive nuclear entry of huntingtin. A single-point mutant in huntingtin 1–18, M8P, predicted to disrupt only the helical structure of this domain, revealed striking phenotypes in cells expressing polyglutamine-expanded huntingtin protein. M8P Q138 huntingtin showed significantly increased nuclear localization and toxicity, despite the complete inhibition of protein aggregation, even in the context of very long polyglutamine repeats. Fluorescence recovery after photobleaching (FRAP) assays in live cells demonstrated that in larger huntingtin fragments, nuclear entry in the absence of 1–18 activity was being mediated by distal sequences between amino acids 81–588.
Some charged face mutants of huntingtin 1–18 displayed the phenotype of increased vesicular interaction. The vesicle population targeted by the huntingtin amino-terminus was found to be late endosomes and autophagic vesicles/vacuoles. These data provide insights into the normal biological function of huntingtin and allow us to hypothesize that huntingtin is an ER-associated protein that can release from the ER and transporting vesicles to enter the nucleus in response to ER stress. In addition, we find that the huntingtin membrane-association domain is a critical step for the nucleation of polyglutamine-mediated inclusion formation and the modulation of mutant huntingtin toxicity. We conclude from observations in our model system that polyglutamine-expanded huntingtin protein not seen in large, visible aggregates is the toxic species in HD and that the site of toxicity is within the nucleus.
| RESULTS |
|---|
|
|
|---|
Conserved 18 amino acid domain in huntingtin actively targets the ER
During the course of our previous studies attempting to find a huntingtin nuclear localization signal (14), we noted the high conservation of the first 18 amino acids of huntingtin in all vertebrate species. BLAST sequence alignment of huntingtin 1–588 revealed a striking conservation of sequence in the first 18 amino acids of the protein (22 residues when considering glutamines) with 100% similarity and 95% identity (Fig. 1A). By molecular modeling, it appeared that huntingtin 1–18 may form an amphipathic alpha helical structure, with the hydrophobic face potentially involved in membrane interactions (Fig. 1B–F). This led us to hypothesize that this conserved domain may be involved in huntingtin sub-cellular localization. Immunofluorescence with mAB2166 monoclonal antibody (20) in striatal-derived STHdh cells demonstrated that most of huntingtin protein was localized to the cytoplasm and perinucleus in a reticular structure (Fig. 2A, panel b). This signal had a high degree of overlap with the immunofluorescence signal from the ER lumen chaperone protein, calreticulin (21) (Fig. 2A, panels a and d). Given this ER-localization of huntingtin, we then fused this 1–18 sequence to the amino-terminus of eYFP, keeping the huntingtin start methionine intact, and assayed localization of the fusion proteins in live striatal-derived STHdh cells by both confocal and wide-field deconvolution microscopy under minimal expression conditions. Huntingtin 1–18-eYFP appeared to completely target to the cytoplasm, into the ER and small puncta (Fig. 2B, panel a). The same localization was seen for huntingtin 1–171, 1–588 fragments and full-length huntingtin as carboxyl-terminal eYFP fusions (Fig. 2B, panels b–d). This localization appeared similar to what has been reported for huntingtin by immunofluorescence in STHdh cells (19,22) and human neurons (13).
|
|
To test for huntingtin ER localization in vitro, we lysed and subjected STHdh cells to fractionation following nuclear isolation by low-speed and high-speed centrifugation (Fig. 2C). At 4°C, huntingtin appeared in all sub-cellular fractions (data not shown), unlike our live cell imaging results. However, at 25°C fractionation, closer to the 33–37°C visualization of our live cells, huntingtin co-fractionated with calreticulin at the high-speed pellet (Fig. 2C). Unlike the ER lumen located calreticulin, huntingtin's 1–18 sequence suggested us that it may behave more like the hepatitis non-structural protein 5A (NS5A) ER membrane association signal, which is an amphipathic alpha helix (23). We hypothesized that correct huntingtin ER localization may require an optimal ER, as several membrane resident proteins can mis-localize when stress is induced by the purification procedure. To test this temperature effect back in vivo, we then did immunofluorescence against huntingtin in STHdh cells at either 4 or 25°C fixation (Fig. 3A). When the cells were cooled prior to fixation, huntingtin signal was skewed towards the nucleus (Fig. 3A, panels b and c). Huntingtin 1–18-eYFP was then tested for temperature-dependent localization to the ER by cooling and warming live cells in a heated tissue culture dish (Fig. 3B) (Supplementary Material, Video S1). Huntingtin 1–18-eYFP was seen to reversibly target the ER depending on temperature, and could be cycled on and off repeatedly (data not shown). Huntingtin 1–18 -eYFP was small enough to diffuse into and out of the nucleus when it was not targeted to the ER. This effect was quantified with an internal soluble control of mRFP protein in Figure 3B, panel e. The same effect was seen with full-length endogenous huntingtin (Fig. 3A), which is too large to enter the nucleus by simple diffusion, indicating some active nuclear localization of huntingtin.
|
Taking advantage of our live cell system, we then tested whether huntingtin localization to the ER required energy. Addition of an ATP-inhibition cocktail resulted in the release of huntingtin 1–18 from ER and diffusion into the nucleus of all cells observed (representative cells in Fig. 4A). Loss of ER-targeting was also noted in response to cell treatments with UPR inducers tunicamycin or dithiothreitol (Fig. 4B), although at much longer time points. Thus, huntingtin 1–18 targeting to the ER is reversible, requires energy and can be inhibited by inducers of ER stress.
|
Huntingtin 1–18 is an amphipathic alpha helix
To test for the helical and/or amphipathic nature of this sequence in live cells, as hypothesized from the models in Figure 1, we performed a quantitative ER-targeting assay which involved the co-expression of mRFP with huntingtin 1–18 mutant moieties fused to eYFP, and the addition of Hoechst dye to stain nuclear DNA (Fig. 5A–I). Transfected cells were identified by red fluorescence without observation of the green fluorescent channel, thus blinding the investigator to the data at the time of acquisition, a method described by others (24). Cells were imaged capturing three fluorescent signal channels: the red channel to define mRFP and diffusion across the cell without any localization, the blue channel to define the area of the nucleus and the green channel to define the localization of eYFP fusions. From this, percent cytoplasmic localization was determined for each construct over 100 cells. As seen in Figure 5, alanine point mutants on the predicted hydrophobic face of the helix (Fig. 1D), completely abrogated huntingtin 1–18 ability to target the ER (Fig. 5J). However, a hydrophobic residue predicted to be on the opposite face (Fig. 1E), methionine 8, did not show any phenotype when mutated to an alanine (Fig. 5J). These point-mutant data indicate that the sequence was behaving with an amphipathic nature. To test for the presence of structure, we substituted methionine 8 with a proline residue to induce a structure-breaking proline turn. As with the hydrophobic face mutants, M8P huntingtin 1–18 was not able to target the ER (Fig. 5F–I). Mutations in the charged residues on the charged face of the helix at positions E5A and E12A resulted in increased vesicle targeting (Fig. 5K, M and O); however, mutations in basic residues on the charged face had no effect on ER or vesicle targeting (Fig. 5L, N and P). As with full-length huntingtin, huntingtin 1–18-eYFP was seen to co-fractionate with calreticulin, however, not in the nuclear fraction (Fig. 5Q). This suggested that while huntingtin 1–18 could target ER alone, specificity of this ER targeting was enhanced by additional sequences in huntingtin.
|
Finally, to directly analyze and confirm the structure of huntingtin 1–18, we performed circular dichroism spectroscopy studies of the 1–18 sequence produced as a synthetic peptide (Genescript). CD spectra revealed that huntingtin 1–18 synthetic peptide was an alpha helix, with 45% helical content (Fig. 6A). This spectrum did not change upon dilution, indicating that this was not likely a dimerization domain. When incubated with synthetic unilamellar vesicles (SUVs), the helical content was seen to change in the presence of the vesicles, indicating a conformational change of huntingtin 1–18 in direct response to the presence of membranes (Fig. 6B). Huntingtin 1–18 bound to either 1-palmitoyl 2-oleoyl phosphatidylcholine (POPC) vesicles or vesicles containing 1-palmitoyl 2-oleoyl phosphatidylserine (POPS) (POPC:POPS, 7:3), compositions of the ER and ER-derived vesicles. To test for the phenotype of the M8P mutation on huntingtin 1–18 structure, we performed CD spectroscopy on a 1–18 M8P synthetic peptide (Genescript). CD spectrum showed no helical content in the peptide (Fig. 6C), nor did the M8P peptide spectra change in the presence of SUVs (Fig. 6D). These results by mutational studies in vivo and spectroscopy in vitro correlate to show that huntingtin 1–18 is an amphipathic alpha helix, and that this structure is required to recognize membranes.
|
Huntingtin 1–18 mutations in full-length huntingtin context effect huntingtin ER localization, nuclear entry and polyglutamine-mediated toxicity
To test for the physiological relevance of our described huntingtin 1–18 point mutants in the context of a larger fragment of huntingtin protein, we either deleted amino acids 2–13 or 5–13 in the context of huntingtin 1–588[Q15] (Fig. 7A–D). This fragment of huntingtin contains most of the known modifications and interaction domains of huntingtin interacting proteins, as well as the first three HEAT-repeats within huntingtin (25). As an mRFP fusion protein, huntingtin 1–588 is
90 KDa in size and therefore cannot enter the nucleus by simple diffusion, contrary to our previous assays with just huntingtin 1–18 fused to eYFP. As with our previous assays, transfections were observed at minimal time points (12–14 h) in live STHdh cells. Deletion of huntingtin 2–13, 5–13 or the M8P mutation resulted in reduced ER targeting, and constitutive huntingtin nuclear entry, with M8P phenotype equal to deletion of residues 2–13 (Fig. 7D). Therefore, it appeared that in the absence of ER targeting, huntingtin was actively entering the nucleus by sequences distal to the amino-terminal first 81 amino acids (exon 1).
|
In the context of toxic polyglutamine-expanded huntingtin 1–171 fragments, polyglutamine-expanded huntingtin (Q138) will typically induce the formation of multiple large aggregates of protein within 18 h of expression, and cell death is then seen to occur (Fig. 7E). This same fragment is also pathogenic in a HD mouse model (26). With the M8P mutation in 1–171 huntingtin context, we observed two striking phenotypes: the complete absence of polyglutamine-mediated aggregation at Q138 or even at Q250 lengths (data not shown), and increased huntingtin nuclear localization (Fig. 7E versus F). However, despite the absence of any visible aggregates, the toxicity of huntingtin 1–171 M8P increased dramatically, but this toxicity was still polyglutamine-dependent (Fig. 7I). Similar phenotypes were seen with M8P mutation in the context of full-length huntingtin, with increased nuclear localization (Fig. 7G versus H). The full-length huntingtin M8P also established that huntingtin 1–18 is the only signal in huntingtin required to associate with the ER in huntingtin. Therefore, it appeared that the amino-terminal membrane association activity in huntingtin was both important to trigger the onset of polyglutamine-dependent protein aggregation and modulate polyglutamine-mediated huntingtin toxicity.
To directly test for active huntingtin nuclear import by sequences distal to huntingtin 1–18, we fused huntingtin 81–588 at the amino and carboxyl-termini with eYFP and mRFP, resulting in a total size of
110 KDa. This was to prevent any artifactual nuclear localization due to diffusion. Using FRAP to assay nuclear import (27) (Fig. 8), we could observe low levels of simple diffusion of eYFP-mRFP (52 KDa) across the nuclear pore complexes (Fig. 8G–L). Despite the larger size, we found that eYFP-huntingtin 81–588-mRFP imported into the nucleus at a faster rate (Fig. 8A–F, graph in M). Thus, the reversible huntingtin ER localization by 1–18 could result in huntingtin nuclear entry when huntingtin is released from the ER, through an active nuclear import ability within residues 81–588 in huntingtin.
|
Huntingtin 1–18 targets specifically to late endosomes and autophagic vesicles
Having established that huntingtin can target the ER and that disruption of this targeting could lead to nuclear entry of huntingtin and increased mutant huntingtin toxicity, we then sought to determine the specific vesicular population targeted by huntingtin 1–18. By live cell video analysis, we could see that the puncta being targeted by huntingtin 1–18 moved in a manner consistent with vesicles, with a concentration of signal near the microtubule organizing center (Supplementary Material, Video S2). Using live cell imaging with a variety of early and late endosomal markers fused to eGFP, we co-expressed huntingtin 1–588 [Q15]-mRFP in STHdh cells. Huntingtin localized to vesicular populations and ER, but did not co-localize with the early endosomal marker RhoB (28,29) (Fig. 9A–C). In contrast, when huntingtin 1–588 was visualized with Rab7-eGFP, a late endosomal/lysosomal marker (30–34), co-localization was detected (Fig. 9D–F). This late-endosomal localization was enhanced by the E5A/E12A mutation (Fig. 9G–I). Wild-type huntingtin 1–588 also co-localized well with the macroautophagic vesicle/vacuole marker, the microtubule-associated protein 1 light chain 3 (LC3/atg8) (Fig. 9J–L). Thus, huntingtin localization to vesicles via 1–18 is specific to late endosomes and autophagic vesicles, with vacuolar membrane localization evident (Fig. 9G–I, white arrows).
|
| DISCUSSION |
|---|
|
|
|---|
Knowing the normal biological function of huntingtin is critical in understanding the role of polyglutamine-expansion in huntingtin during HD. Several groups have seen huntingtin localized to the ER, vesicles and the nucleus by a variety of methods, including immunofluorescence in fixed neurons and in tissue culture model cells (19,22); biochemical cell fractionation (12,15); and live cell imaging in tissue culture cells (14), neurons (35) and transgenic Drosophila models (7,8). Here, we describe the first 18 amino acids of huntingtin as a membrane-targeting domain that can mediate the association of huntingtin with the ER and late endosomes. In the absence of this membrane targeting, huntingtin is actively transported into the nucleus by a region of the protein within residues 81–588, a region that has been shown not to contain any classic importin
/karopherin beta-type nuclear localization signal (14), but does contain three HEAT-repeats (25,36), similar to those found in nuclear import factors (37). This functional domain in huntingtin now directly ties huntingtin function to the ER. ER stress is becoming increasingly important in understanding the pathology of several protein-misfolding neurodegenerative diseases, including Parkinson's and Alzheimer's diseases (38). Huntingtin over-expression has been seen to stimulate endosomal-lysosomal activity, endosomal tubulation and autophagy (39). Reduction of huntingtin levels in cells by siRNA-mediated methods results in perturbation of the ER (40), and genetic knockouts of huntingtin in embryonic stem cells demonstrated that huntingtin was essential for normal ER structure (10). The huntingtin 1–18 sequence has the structure of an amphipathic alpha helix. These structures are also seen in other ER and vesicle-associated proteins: the vesicle-associated membrane proteins, or VAMPs 16 amino acid signal (41); the ER-associated hepatitis C 5a protein 30 amino acid signal (23); and the yeast ER-associated nuclear receptor activator, AF2 (42). However, unlike the VAMP-targeting signal, but like the C5a and AF2 signals, huntingtin does not appear to need a downstream hydrophobic insertion tail sequence, but can associate to the ER by virtue of the 1–18 helical sequence alone. We noted that huntingtin 1–18 ER-targeting ability appears to be saturable, by observing increasing live cell expression over time in excess of 48 h. At very high levels of over-expression, excess huntingtin 1–18 appears soluble, but does not cause any toxicity (data not shown). Also, using in vitro pure vesicle targeting assays with purified huntingtin 1–18-eYFP, we did not observe any direct targeting, nor could we see huntingtin 1–18 targeting other membranous structures like the plasma membrane, even when highly over-expressed (data not shown). This suggests that huntingtin 1–18's ability to target membranes may be limited by another factor, and is likely not due to direct membrane insertion. This is consistent with our observations of reversible huntingtin association upon temperature stress. This suggests that reversible association of huntingtin with ER and vesicles may be an important activity of huntingtin.
The alpha helical structure is critical to huntingtin's ability to target the ER, as the M8P point-mutant or the hydrophobic residue point-mutants phenotype of disrupted membrane targeting is similar to deletion of the entire membrane association domain. The mutations on the charged face of the helix indicate the importance of acidic residues, but not basic residues. The mutation of all basic lysines to arginines without effect indicates that lysine modifications such as acetylation and SUMOylation (18) are not required for huntingtin membrane association, but these data do not exclude the possibility that post-translational modification of 1–18 may be important for huntingtin release from the ER. This function is likely important for huntingtin's biological role, as the 1–18 sequence is completely conserved in all vertebrate species of huntingtin.
In the ER UPR, the human Ire1p proteins are ER-lumenal sensors of protein misfolding (43). Upon sensing misfolded protein, Ire1p protein is modified and cleaved, resulting in nuclear entry of an Ire1p fragment and allowing its function as a transcription activator for a series of genes, including those that encode chaperones and cysteine isomerases. ER stress induces the release of huntingtin from the ER, where it is then seen to actively enter the nucleus by distal sequences. Small fragment mouse transgenic models of HD have typically more severe phenotypes than full-length huntingtin models (26,44,45). The ability to simply diffuse into the nucleus may be partially responsible for the accelerated phenotype in these models. Others have shown that addition of exogenous nuclear export or import signals to mutant huntingtin can modulate its toxicity, with NES addition resulting in decreased toxicity (35). Like Ire1p, huntingtin has been shown to be involved in transcription regulation for a series of genes containing neuronal restrictive silencing elements, or NRSEs (16,17). But unlike Ire1p, huntingtin is not a lumenal protein, but at the cytoplasmic ER membrane. The concept of an ER membrane-bound protein translocating to the nucleus in response to stress is not novel. The antioxidant response element (ARE) binding transcription factor, Nrf1, associates with the ER membrane via an amino-terminal helical transmembrane domain. In response to cellular oxidative stress, Nrf1's ER-targeting domain is cleaved, and Nrf1 enters the nucleus to act as a transcription activator for a series of genes involved in anti-oxidant activity (46). The fact that we can observe reversible huntingtin targeting to ER via 1–18 in live cells indicates that the huntingtin membrane-association signal is likely not cleaved, and again suggests that it is not likely to be a direct membrane insertion signal.
Our data on huntingtin 1–18 activity mediating polyglutamine-dependent aggregation is consistent with data from yeast models that demonstrated that sequences flanking the polyglutamine tract can effect polyglutamine-mediated aggregation and toxicity (47). However, in those studies, different amino-terminal fusions as well as proline-rich regions could modulate huntingtin exon1 fragment aggregation and toxicity, indicating that regions of huntingtin protein on either side of the polyglutamine tract control huntingtin toxicity, and may even work in concert for normal huntingtin function. The proline-rich region in huntingtin carboxyl to the polyglutamine tract has been shown to mediate interaction with several vesicular proteins (48). This suggests that the huntingtin proline-rich region interacting proteins may communicate with proteins bound to 1–18 across the polyglutamine tract to mediate specificity. Thus, huntingtin may act as a molecular scaffold with the polyglutamine tract as an essential component. All species of vertebrate huntingtin contain at least four glutamines in this tract, and a glutamine-tract deletion mutant knockin HD mouse displays a neurologic phenotype (49). The complete disruption of polyglutamine-dependent visible aggregates of huntingtin by the M8P mutation led to greatly increased toxicity, consistent to what has been seen by others with huntingtin in neurons (50), and in another polyglutamine-expansion disease, SCA7 (51). The polyglutamine expansion in M8P context may be in another, more toxic structural conformation than what is seen in classic large, visible aggregates. This is a subject of further study, but indicates that there may be targets for therapeutic development in huntingtin protein in addition to the polyglutamine tract.
One of the classic pathological observations in HD is the accumulation of the mutant huntingtin protein in neuronal nuclei (52). Our data with huntingtin 1–18 function controlling huntingtin nuclear entry suggest that polyglutamine-expansion may subtly inhibit proper reversible ER-targeting or nuclear shuttling of huntingtin, thus resulting in increased nuclear levels over time. In M8P[Q138] huntingtin context, the protein was unable to form visible aggregates, yet was far more toxic than [Q138] huntingtin. M8P[Q138] huntingtin was also notably more nuclear than [Q138] huntingtin. These data demonstrated that the polyglutamine-expanded huntingtin protein not seen in visible aggregates was the toxic species, and that the site of toxicity was within the nucleus. The increased toxicity of M8P[Q138] huntingtin in the absence of any visible aggregates also suggests that in our cell culture model, physical blocking of vesicular trafficking is not a trigger of cell toxicity, contrary to what has been suggested by others in Drosophila HD models (7).
The activities of vesicular interaction, trafficking and nuclear entry as a transcription factor for huntingtin are strikingly similar to that recently proposed for the amino-terminal Huntingtin-Interacting Protein 1, or Hip1 (53). Our observations conclude that while huntingtin 1–18 is sufficient to target membranes, the specificity of that interaction to late endosomes is mediated by additional sequences in huntingtin. Others have seen that huntingtin can interact with early endosomes via an interaction with the huntingtin-associated protein 40, or Hap40, which interacts with huntingtin via the carboxyl-terminus (9). This indicates that full-length huntingtin has the ability to interact with both early and late endosomes through different regions of the protein as a mechanism to traffic from synapses down long axons to the cell body. This also stresses the importance of analysis of huntingtin function in a full-length context. However, the early endosome interaction may not be relevant to HD, as many mouse models show HD-like pathology in the absence of the carboxyl-terminus of huntingtin (26,54). With wild-type huntingtin, localization of the amino-terminus is specific to the ER, late endosomes and autophagic vesicles, which are precursors to autophagic vacuoles. In HD patient lymphoblasts, the presence of autophagic vacuoles is greatly enhanced in a polyglutamine length-dependent manner (55). Thus, huntingtin may have a normal role in the trafficking of vesicles and the formation of autophagic vacuoles. In addition, huntingtin can sense ER stress resulting in huntingtin nuclear entry, then export from the nucleus via the carboxyl-terminal NES as the off switch to this response. Nuclear export may also be the mediator of this response back in the cytoplasm via exported factors (Fig. 10). This suggests that the normal role of huntingtin, present in all cells, is in nuclear-ER communication in response to ER stress. This stress response may be more critical to the health of neuronal cell populations such as those in the striatum and the cortex. While we do not see any binary difference between wild type and mutant huntingtin for ER or vesicle targeting, this is consistent with the late age-onset, progressive and subtle nature of HD. Any effects of the polyglutamine expansion on huntingtin 1–18 activity will likely be understood better by the detailed analysis of huntingtin 1–18 direct interacting proteins, which are the subjects of future study.
|
The membrane association domain of huntingtin is therefore an important modulator of huntingtin function and mutant huntingtin nuclear entry and toxicity. This membrane-association domain may therefore be a good application of targeted drug design against HD. The role of post-translational modification and signaling affecting huntingtin 1–18 function, as well as the nuclear import signal in huntingtin 81–588 will additionally be the subjects of further study.
| METHODS |
|---|
|
|
|---|
Plasmid constructs
Double-stranded synthetic DNA oligonucleotides (McMaster Mobix facility) encoding the first 18 amino acids (WT or mutants) of huntingtin with 5' EcoRI and 3' BamHI overhangs were cloned between EcoRI/BamHI sites of peYFPNI (BD Biosciences/Clontech) to create Htt 1–18-eYFPNI plasmids with a Kozac consensus translation start site at the huntingtin start methionine. Subsequent huntingtin 1–18 mutants and VAMP1helix-peYFPNI plasmids were created in a similar fashion using synthetic oligonucleotides. To create mRFP-VAMP1 construct, VAMP1 DNA was PCR amplified from VAMP1_pBlueScript (a kind gift of Dr D.W. Andrews, McMaster), digested and ligated with EcoRI/BamHI cut pmRFPC1. GFP-Htt1-588 constructs have been described elsewhere (14). Htt1-171-peYFPNI construct was created by cloning BspEI/XhoI fragment of huntingtin into BspEI/XhoI cut peYFPNI that was first modified to ensure a proper reading frame. This plasmid was then used further to clone Htt1-586-peYFPNI and Htt1-3144-peYFPNI by subcloning either XhoI/KpnI or XhoI/SacII fragment of huntingtin. Htt1-588
2-13-peYFPN1 construct was created by first PCR amplification of the gene from the plasmid Htt1-588-pmRFPN1 using oligonucleotides with the sequence GATCGCTAGCATGCTCAAGTCCTTCCAG and GATCGAATTCCGGTACCGTCTAACACAATTTC, respectively. The PCR product was cleaved with NheI and EcoRI and subcloned into NheI/EcoRI sites of peYFPN1. The M8P and E5AE12A mutations were introduced into huntingtin 1-171 and huntingtin 1-588 using the QuikChange II XL (Stratagene) site-directed mutagenesis kit resulting in Htt1-171M8P-peYFPN1 and Htt1-588E5AE12A-pmRFPN1 constructs. All PCR and DNA manipulation enzymes were purchased from New England Biolabs unless noted otherwise. All of the plasmid constructs were verified by nucleotide sequencing (Mobix, Sigma). Huntingtin 1-Hun1-1-18 and huntingtin expression was verified by western blot analysis with huntingtin anti-N18 antibody (Santa Cruz) and huntingtin monoclonal mAB2166 (Chemicon).
Tissue cell culture
Mouse striatal STHdhQ7/Q7 cells (a kind gift of M. E. MacDonald, MGH), a cell line derived from the mouse striatum of wild-type mice, were grown in Dulbecco's modified Eagle's medium (Invitrogen) with 10% fetal bovine serum (Invitrogen) at 33°C with 5% CO2. Striatal cells were clonally selected and grown under G418 drug selection at 33ºC to ensure temperature sensitive selection as described elsewhere (19). HEK293 cells were grown in alpha-minimum essential medium with 10% FBS and antibiotics at 37°C with 5% CO2.
Cell fractionation
Endogenous huntingtin. STHdhQ7/Q7 cells grown on 10 cm dishes were washed twice with ice-cold PBS and collected using a rubber cell scraper. Cells were re-suspended in homogenization buffer (250 mM sucrose, 3 mM imidazole, 1 mM EDTA, and protease inhibitor cocktail of 20 µg/ml PMSF, 1 µg/ml pepstatin A, 1 µg/ml leupeptin) pH 7.4. Cells were homogenized with 30 up and down strokes of a glass Dounce homogenizer on ice. Lysed cell were spun at 500 g for 5 min to pellet the nuclei and unbroken cells. The supernatant from this fraction was labeled post nuclear supernatant (PNS). The PNS was then further subjected to a differential centrifugation scheme to collect series of pellets and supernatants as previously described (46). Briefly, PNS was first subjected to a 20 min spin at 10 000 g to pellet mitochondria (P10). The supernatant from this step (S10) was further spun at 100 000 g for 60 min to obtain an ER enriched fraction (P100). The supernatant from this step (S100) was treated as remaining total cytosol. For fractionation at room temperature, all the manipulation steps and buffers were kept at room temperature, 25°C.
Transfected cells. HEK293 cells were transfected with N18-eYFP, N18M8P-eYFP or EYFP plasmid alone. After 48 h post-transfection, cells were washed twice with PBS and harvested using a rubber policeman. The cells were lysed and fractionated as above.
Immunoblot analysis
Equal amounts of protein from each fraction were resolved on either a 10% or 7% SDS–polyacrylamide gel and electroblotted to a PVDF membrane. Membranes were blocked with 5% non-fat dry milk in PBST for 1 h followed by 1 h incubation at room temperature with anti N18 (1:1000, Santa Cruz), mAB2166 (1:1000, Chemicon), lamin A (1:3000, AbCam), calreticulin (1:5000, Stressgen) or anti-EYFP (1:3000) antibodies. After incubation with appropriate HRP-conjugated secondary antibody, bands were visualized by enhanced chemiluminescence (Amersham Biosciences).
ATP depletion and temperature shift
Two micrograms of Htt 1-18-eYFPN1 plasmid was transfected into STHdhQ7/Q7 cells in 25 mM live-cell culture dishes. Cells were imaged at 24 h post transfection. Following imaging, 50 mM sodium azide (BioShop), 50 mM 2-deoxy-D-glucose (Sigma) and 1 mM adenosine-5'(b,g-imido)triphosphate tetralithium salt hydrate (AMP-PNP, Sigma) were added directly into the dish and incubated at 33°C for 4 h. Cells were then imaged again. For temperature shift, after 16 h expression, cells were placed on ice for 30 min and imaged immediately after.
ER stress induction
For ER stress induction, STHdhQ7/Q7 cells were transfected with Htt 1-18-peYFPNI in 25-mm dishes. After 12–16 h post-transfection, cells were imaged, and washed twice with PBS. The untreated cells were maintained in serum-free media alone, while the treated cells were incubated with 5 mM DTT, or 2 µg/ml tunicamycin for 1 h in serum-free media. Cells were imaged again immediately after each treatment.
Nuclear localization analysis and ER-targeting assay
In order to statistically analyze the effects of various huntingtin mutations on the huntingtin nuclear localization, a self-blinded method for data acquisition was used that has been described in detail elsewhere (24). Briefly, the area of the nucleus is defined by Hoescht DNA staining dye while the area of the entire cell is defined by mRFP. Using these parameters for area, percent cytoplasmic localization was determined as follows:
Percent cytoplasmic localization = 100–[(Total Nuclear Intensity–Background Nuclear Intensity)/(Total Nuclear+Cytoplasm Intensity–Background Cell Intensity)].
Circular dichroism spectroscopy
Peptides were obtained as 0.5 mg/ml solutions in phosphate buffer. They were diluted to 0.25 mg/ml in 10 mM NaH2PO4, 0.14 M NaCl, 1 mM EDTA, pH 7.4 (phosphate buffer). The buffer was previously filtered through 0.2 µ Millipore filters.
Films of POPC and POPC:POPS at a 7:3 molar ratio were prepared by dissolving an appropriate amount of lipid in chloroform:methanol (2:1), then taking defined aliquots into Pyrex tubes and evaporating the solvent under nitrogen gas with constant rotation of the tubes. The lipid, coating the tubes as a thin film (for maximum exposure to a hydrating agent), was further dried under vacuum for 3 h and kept in the freezer overnight under a layer of Argon gas. Hydration of the lipid films was accomplished by vigorous vortexing in phosphate buffer to make multilamellar vesicles (MLVs). To transform MLVs into SUVs, the MLVs were saturated with Argon gas and placed in a sonicator water bath for 15 min at room temperature or until the suspensions gained clarity. SUVs were required because they have less light scattering than MLVs and are therefore more suitable for far UV CD spectroscopy.
For mixtures of SUVs with peptide, components were mixed in a 1:1 proportion so as to have a final lipid to peptide molar ratio of 10:1.
Scans were performed in an Aviv CD spectrometer model 215 (Aviv Instruments, NJ, USA).
Solutions were scanned in the far UV range between 260 and 190 nm in a 1 mM rectangular quartz cuvette contained in a piezoelectric holder for temperature control.
Temperature was maintained at 25°C. When runs were done in duplicates they were superimposable. The data collected in milidegrees were transformed to mean residue ellipiticity [
]
and presented in units of degree/cm2/dmole, with the formula (
/molarity) x (no. of residues) x pathlength.
Two different programs were used for secondary structure determination: CONTIN and SELCON. The results from both were in reasonable agreement and therefore they were averaged. A database of 56 proteins (43 soluble and 13 membrane proteins) was utilized for this analysis.
Cell viability/toxicity assay
To determine the relative toxic affects of huntingtin construct on STHdhQ7/Q7 cells, transfected cells expressing various huntingtin constructs for 16 h were stained with propidium iodide dye. Cells were imaged and the percent of cell death due to transfected huntingtin construct was established by dividing the number of red+ green cells/total green transfected cells. Control cells were transfected with either eYFPNI or mRFPC1 plasmid alone to determine toxicity affects of the transfection reagent and protein tags alone.
Subcellular markers
To visualize early endosomes, plasmid Endo-CFP (BD Biosciences/Clontech), a RhoB-eGFP marker was used. Late endosomes were visualized using, peGFP-CD63 (a generous gift of G.M. Griffiths and S. Grinstein) and eGFP-Rab7 (a generous gift of S. Pfeffer). ER-CFP (BD Biosciences/Clontech) and ER-Tracker (Invitrogen/Molecular Probes) were used to visualize ER. In order to minimize non-specific labeling, only 100 nM ER-Tracker was added for specific ER membrane localization. Autophagic vesicles and vacuoles were visualized using eYFP-LC3, a generous gift of A. Yamamoto.
Live cell imaging and deconvolution
All widefield fluorescence microscope images were captured on a Nikon TE200 epifluorescence inverted microscope equipped with a 60 x oil immersion plan apochromat NA1.4 objective and a Hamamatsu Orca ER digital camera (Hamamatsu Photonics, Japan). One hundred and seventy-five watt Xenon light source was used attenuated by a ND8 neutral density filter. EYFP, eGFP and mRFP were imaged with motorized filter wheels and XYZ stage (Sutter Instruments, CA, USA) and specific eYFP, eGFP and texas red filter sets respectively (Semrock Corporation, NY, USA). For live cell microscopy, STHdhQ7/Q7 cells were seeded onto heated culture dishes (Delta T, Bioptechs, Butler, PA, USA) and transfected with 2 µg of plasmid DNA using ExGen 500 (Fermentas) according to the manufacturer's instructions. Cells were maintained at 33°C and observed 18–24 h post transfection directly in the culture dish without fixation. Sequential images were digitally captured, and channels were overlaid and pseudocolored using Simple PCI v5.2 imaging software (Hamamatsu Photonics, Japan). Image restoration was done by either 3D Z-stacks captured at 50 nm slices and nearest neighbors algorithm, or by 2D deconvolution of the maximum stack projection using Autodeblur 9.3 software (Autoquant Imaging, NY, USA), or using Volocity deconvolution software (Improvision). Only raw, unprocessed, image data captured at 12-bit data depth was used for fluorescence pixel intensity quantification in Simple PCI. Statistical significance was determined using a student's t test. Videos were captured at 10 frames/sec 1.4 mega pixels resolution in single channel fluorescence, cropped to area of interest at 512 x 512 pixels, deconvolved using the Autoquant 2D iterative algorithm and finally saved as MPEG video after display adjustments (equalization) in Imaris 4.1 (Bitplane, Zurich, Switzerland).
Confocal images were captured on a Leica SP5 laser confocal microscope using 468, 488, 490 or 561 nm laser wavelengths with spectral imaging and emission gating. All confocal images were scanned sequentially with one laser only per channel and restricted by light spectral gating to prevent signal bleed. All images were done on live cells with glass-bottomed dishes, as described elsewhere (27). Inverted FRAP experiments were performed on the same microscope using the FRAP Wizard software from Leica, similar to those experiments described elsewhere (27,51).
For 3D and 4D time-course imaging, a Leica inverted DMI 6000B microscope with 63 x glycerol objective was used with 491 or 561 nm laser excitation and a Nipkow/Spinning disc device (QLC100, Visitek) and fast laser switcher (Spectral Applied Research) with a Hammamatsu 512X512 back-thinned EM-CCD camera with signal gain amplification (C9100). Z stacking in 100 nm increments was done via a piezo-electric stage (Ludl) controlled by Volocity 4.0 Software. Imaging was done on live cells in glass-bottomed dishes under 5% C02 and 37°C temperature control by a heated air box (Neue Biosciences). Voxel stacks were visualized and MPEG encoded using Imaris 4.1 software (Bitplane, Zurich, Switzerland).
| SUPPLEMENTARY MATERIAL |
|---|
|
|
|---|
Supplementary Material is available at HMG Online.
| FUNDING |
|---|
|
|
|---|
This work is supported by research grant # is MOP-82793 to RT from the Canadian Institutes of Health Research, the Huntington's Disease Society of Canada and the High Q Foundation of New York. RT is a CIHR New Scientist Scholar.
| ACKNOWLEDGEMENTS |
|---|
The authors would like to thank S. Grinstein at the University of Toronto for endosomal markers plasmids, and David W. Andrews at McMaster for advice on VAMP signals and ER targeting.
Conflict of Interest statement. None declared.
| REFERENCES |
|---|
|
|
|---|
- Schols L., Bauer P., Schmidt T., Schulte T., Riess O. Autosomal dominant cerebellar ataxias: clinical features, genetics, and pathogenesis. Lancet Neurol. (2004) 3:291–304.[CrossRef][Web of Science][Medline]
- Vonsattel J.P., Myers R.H., Stevens T.J., Ferrante R.J., Bird E.D., Richardson E.P. Jr. Neuropathological classification of Huntington's disease. J. Neuropathol. Exp. Neurol. (1985) 44:559–577.[Web of Science][Medline]
- Housman D. Gain of glutamines, gain of function? Nat. Genet. (1995) 10:3–4.[CrossRef][Web of Science][Medline]
- Leavitt B.R., Wellington C.L., Hayden M.R. Recent insights into the molecular pathogenesis of Huntington disease. Semin. Neurol. (1999) 19:385–395.[Web of Science][Medline]
- Leavitt B.R., Guttman J.A., Hodgson J.G., Kimel G.H., Singaraja R., Vogl A.W., Hayden M.R. Wild-type huntingtin reduces the cellular toxicity of mutant huntingtin in vivo. Am. J. Hum. Genet. (2001) 68:313–324.[CrossRef][Web of Science][Medline]
- Gauthier L.R., Charrin B.C., Borrell-Pages M., Dompierre J.P., Rangone H., Cordelieres F.P., De Mey J., MacDonald M.E., Lessmann V., Humbert S., Saudou F. Huntingtin controls neurotrophic support and survival of neurons by enhancing BDNF vesicular transport along microtubules. Cell (2004) 118:127–138.[CrossRef][Web of Science][Medline]
- Gunawardena S., Her L.S., Brusch R.G., Laymon R.A., Niesman I.R., Gordesky-Gold B., Sintasath L., Bonini N.M., Goldstein L.S. Disruption of axonal transport by loss of huntingtin or expression of pathogenic polyQ proteins in Drosophila. Neuron (2003) 40:25–40.[CrossRef][Web of Science][Medline]
-
Lee W.C., Yoshihara M., Littleton J.T. Cytoplasmic aggregates trap polyglutamine-containing proteins and block axonal transport in a Drosophila model of Huntington's disease. Proc. Natl Acad. Sci. USA (2004) 101:3224–3229.
[Abstract/Free Full Text] -
Pal A., Severin F., Lommer B., Shevchenko A., Zerial M. Huntingtin-HAP40 complex is a novel Rab5 effector that regulates early endosome motility and is up-regulated in Huntington's disease. J. Cell. Biol. (2006) 172:605–618.
[Abstract/Free Full Text] -
Hilditch-Maguire P., Trettel F., Passani L.A., Auerbach A., Persichetti F., MacDonald M.E. Huntingtin: an iron-regulated protein essential for normal nuclear and perinuclear organelles. Hum. Mol. Genet. (2000) 9:2789–2797.
[Abstract/Free Full Text] - Reiner A., Dragatsis I., Zeitlin S., Goldowitz D. Wild-type huntingtin plays a role in brain development and neuronal survival. Mol. Neurobiol. (2003) 28:259–276.[CrossRef][Web of Science][Medline]
-
De Rooij K.E., Dorsman J.C., Smoor M.A., Den Dunnen J.T., Van Ommen G.J. Subcellular localization of the Huntington's disease gene product in cell lines by immunofluorescence and biochemical subcellular fractionation. Hum. Mol. Genet. (1996) 5:1093–1099.
[Abstract/Free Full Text] - DiFiglia M., Sapp E., Chase K., Schwarz C., Meloni A., Young C., Martin E., Vonsattel J.P., Carraway R., Reeves S.A., et al. Huntingtin is a cytoplasmic protein associated with vesicles in human and rat brain neurons. Neuron (1995) 14:1075–1081.[CrossRef][Web of Science][Medline]
-
Xia J., Lee D.H., Taylor J., Vandelft M., Truant R. Huntingtin contains a highly conserved nuclear export signal. Hum. Mol. Genet. (2003) 12:1393–1403.
[Abstract/Free Full Text] - Suopanki J., Gotz C., Lutsch G., Schiller J., Harjes P., Herrmann A., Wanker E.E. Interaction of huntingtin fragments with brain membranes–clues to early dysfunction in Huntington's disease. J. Neurochem. (2006) 96:870–884.[CrossRef][Web of Science][Medline]
-
Zuccato C., Ciammola A., Rigamonti D., Leavitt B.R., Goffredo D., Conti L., MacDonald M.E., Friedlander R.M., Silani V., Hayden M.R., et al. Loss of huntingtin-mediated BDNF gene transcription in Huntington's disease. Science (2001) 293:493–498.
[Abstract/Free Full Text] - Zuccato C., Tartari M., Crotti A., Goffredo D., Valenza M., Conti L., Cataudella T., Leavitt B.R., Hayden M.R., Timmusk T., et al. Huntingtin interacts with REST/NRSF to modulate the transcription of NRSE-controlled neuronal genes. Nat. Genet. (2003) 35:76–83.[CrossRef][Web of Science][Medline]
-
Steffan J.S., Agrawal N., Pallos J., Rockabrand E., Trotman L.C., Slepko N., Illes K., Lukacsovich T., Zhu Y.Z., Cattaneo E., et al. SUMO modification of Huntingtin and Huntington's disease pathology. Science (2004) 304:100–104.
[Abstract/Free Full Text] -
Trettel F., Rigamonti D., Hilditch-Maguire P., Wheeler V.C., Sharp A.H., Persichetti F., Cattaneo E., MacDonald M.E. Dominant phenotypes produced by the HD mutation in STHdh(Q111) striatal cells. Hum. Mol. Genet. (2000) 9:2799–2809.
[Abstract/Free Full Text] - Wilkinson F., Nguyen T.M., Morris G.E. Monoclonal antibodies from three new regions of huntingtin, the Huntington's disease protein. Biochem. Soc. Trans. (1997) 25:51S.[Medline]
-
Williams D.B. Beyond lectins: the calnexin/calreticulin chaperone system of the endoplasmic reticulum. J. Cell Sci. (2006) 119:615–623.
[Abstract/Free Full Text] -
Wheeler V.C., White J.K., Gutekunst C.A., Vrbanac V., Weaver M., Li X.J., Li S.H., Yi H., Vonsattel J.P., Gusella J.F., et al. Long glutamine tracts cause nuclear localization of a novel form of huntingtin in medium spiny striatal neurons in HdhQ92 and HdhQ111 knock-in mice. Hum. Mol. Genet. (2000) 9:503–513.
[Abstract/Free Full Text] -
Brass V., Bieck E., Montserret R., Wolk B., Hellings J.A., Blum H.E., Penin F., Moradpour D. An amino-terminal amphipathic alpha-helix mediates membrane association of the hepatitis C virus nonstructural protein 5A. J. Biol. Chem. (2002) 277:8130–8139.
[Abstract/Free Full Text] - Voss T.C., Demarco I.A., Booker C.F., Day R.N. Computer-assisted image analysis protocol that quantitatively measures subnuclear protein organization in cell populations. Biotechniques (2004) 36:240–247.[Web of Science][Medline]
- Andrade M.A., Bork P. HEAT repeats in the Huntington's disease protein. Nat. Genet. (1995) 11:115–116.[CrossRef][Web of Science][Medline]
-
Schilling G., Becher M.W., Sharp A.H., Jinnah H.A., Duan K., Kotzuk J.A., Slunt H.H., Ratovitski T., Cooper J.K., Jenkins N.A., et al. Intranuclear inclusions and neuritic aggregates in transgenic mice expressing a mutant N-terminal fragment of huntingtin. Hum. Mol. Genet. (1999) 8:397–407.
[Abstract/Free Full Text] - Howell J.L., Truant R. Live-cell nucleocytoplasmic protein shuttle assay utilizing laser confocal microscopy and FRAP. Biotechniques (2002) 32:80–82.[Web of Science][Medline]
-
Michaelson D., Silletti J., Murphy G., D'Eustachio P., Rush M., Philips M.R. Differential localization of Rho GTPases in live cells: regulation by hypervariable regions and RhoGDI binding. J. Cell. Biol. (2001) 152:111–126.
[Abstract/Free Full Text] -
Amano T., Furuno T., Hirashima N., Ohyama N., Nakanishi M. Dynamics of intracellular granules with CD63-GFP in rat basophilic leukemia cells. J. Biochem. (Tokyo) (2001) 129:739–744.
[Abstract/Free Full Text] -
Barbero P., Bittova L., Pfeffer S.R. Visualization of Rab9-mediated vesicle transport from endosomes to the trans-Golgi in living cells. J. Cell Biol. (2002) 156:511–518.
[Abstract/Free Full Text] -
Bucci C., Thomsen P., Nicoziani P., McCarthy J., van Deurs B. Rab7: a key to lysosome biogenesis. Mol. Biol. Cell (2000) 11:467–480.
[Abstract/Free Full Text] - Martinet W., De Meyer G.R., Andries L., Herman A.G., Kockx M.M. Detection of autophagy in tissue by standard immunohistochemistry: possibilities and limitations. Autophagy (2006) 2:55–57.[Web of Science][Medline]
- Munafo D.B., Colombo M.I. Induction of autophagy causes dramatic changes in the subcellular distribution of GFP-Rab24. Traffic (2002) 3:472–482.[CrossRef][Web of Science][Medline]
- Tanida I., Ueno T., Kominami E. LC3 conjugation system in mammalian autophagy. Int. J. Biochem. Cell Biol. (2004) 36:2503–2518.[CrossRef][Web of Science][Medline]
- Saudou F., Finkbeiner S., Devys D., Greenberg M.E. Huntingtin acts in the nucleus to induce apoptosis but death does not correlate with the formation of intranuclear inclusions. Cell (1998) 95:55–66.[CrossRef][Web of Science][Medline]
- Andrade M.A., Petosa C., O'Donoghue S.I., Muller C.W., Bork P. Comparison of ARM and HEAT protein repeats. J. Mol. Biol. (2001) 309:1–18.[CrossRef][Web of Science][Medline]
- Mans B.J., Anantharaman V., Aravind L., Koonin E.V. Comparative genomics, evolution and origins of the nuclear envelope and nuclear pore complex. Cell Cycle (2004) 3:1612–1637.[Web of Science][Medline]
- Zhao L., Ackerman S.L. Endoplasmic reticulum stress in health and disease. Curr. Opin. Cell Biol. (2006) 18:444–452.[CrossRef][Web of Science][Medline]
-
Kegel K.B., Kim M., Sapp E., McIntyre C., Castano J.G., Aronin N., DiFiglia M. Huntingtin expression stimulates endosomal-lysosomal activity, endosome tubulation, and autophagy. J. Neurosci. (2000) 20:7268–7278.
[Abstract/Free Full Text] - Omi K., Hachiya N.S., Tokunaga K., Kaneko K. siRNA-mediated inhibition of endogenous Huntington disease gene expression induces an aberrant configuration of the ER network in vitro. Biochem. Biophys. Res. Commun. (2005) 338:1229–1235.[CrossRef][Web of Science][Medline]
-
Kim P.K., Hollerbach C., Trimble W.S., Leber B., Andrews D.W. Identification of the endoplasmic reticulum targeting signal in vesicle-associated membrane proteins. J. Biol. Chem. (1999) 274:36876–36882.
[Abstract/Free Full Text] -
Thenot S., Henriquet C., Rochefort H., Cavailles V. Differential interaction of nuclear receptors with the putative human transcriptional coactivator hTIF1. J. Biol. Chem. (1997) 272:12062–12068.
[Abstract/Free Full Text] - Patil C., Walter P. Intracellular signaling from the endoplasmic reticulum to the nucleus: the unfolded protein response in yeast and mammals. Curr. Opin. Cell Biol. (2001) 13:349–355.[CrossRef][Web of Science][Medline]
- Hodgson J.G., Agopyan N., Gutekunst C.A., Leavitt B.R., LePiane F., Singaraja R., Smith D.J., Bissada N., McCutcheon K., Nasir J., et al. A YAC mouse model for Huntington's disease with full-length mutant huntingtin, cytoplasmic toxicity, and selective striatal neurodegeneration. Neuron (1999) 23:181–192.[CrossRef][Web of Science][Medline]
- Mangiarini L., Sathasivam K., Seller M., Cozens B., Harper A., Hetherington C., Lawton M., Trottier Y., Lehrach H., Davies S.W., Bates G.P. Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell (1996) 87:493–506.[CrossRef][Web of Science][Medline]
-
Wang W., Chan J.Y. Nrf1 is targeted to the endoplasmic reticulum membrane by an N-terminal transmembrane domain. Inhibition of nuclear translocation and transacting function. J. Biol. Chem. (2006) 281:19676–19687.
[Abstract/Free Full Text] -
Duennwald M.L., Jagadish S., Muchowski P.J., Lindquist S. Flanking sequences profoundly alter polyglutamine toxicity in yeast. Proc. Natl Acad. Sci. USA (2006) 103:11045–11050.
[Abstract/Free Full Text] -
Qin Z.H., Wang Y., Sapp E., Cuiffo B., Wanker E., Hayden M.R., Kegel K.B., Aronin N., DiFiglia M. Huntingtin bodies sequester vesicle-associated proteins by a polyproline-dependent interaction. J. Neurosci. (2004) 24:269–281.
[Abstract/Free Full Text] -
Clabough E.B., Zeitlin S.O. Deletion of the triplet repeat encoding polyglutamine within the mouse Huntington's disease gene results in subtle behavioral/motor phenotypes in vivo and elevated levels of ATP with cellular senescence in vitro. Hum. Mol. Genet. (2006) 15:607–623.
[Abstract/Free Full Text] - Arrasate M., Mitra S., Schweitzer E.S., Segal M.R., Finkbeiner S. Inclusion body formation reduces levels of mutant huntingtin and the risk of neuronal death. Nature (2004) 431:805–810.[CrossRef][Medline]
-
Taylor J., Grote S.K., Xia J., Vandelft M., Graczyk J., Ellerby L.M., La Spada A.R., Truant R. Ataxin-7 Can Export from the Nucleus via a Conserved Exportin-dependent Signal. J. Biol. Chem. (2006) 281:2730–2739.
[Abstract/Free Full Text] -
DiFiglia M., Sapp E., Chase K.O., Davies S.W., Bates G.P., Vonsattel J.P., Aronin N. Aggregation of huntingtin in neuronal intranuclear inclusions and dystrophic neurites in brain. Science (1997) 277:1990–1993.
[Abstract/Free Full Text] -
Mills I.G., Gaughan L., Robson C., Ross T., McCracken S., Kelly J., Neal D.E. Huntingtin interacting protein 1 modulates the transcriptional activity of nuclear hormone receptors. J. Cell Biol. (2005) 170:191–200.
[Abstract/Free Full Text] - Bates G.P., Gonitel R. Mouse models of triplet repeat diseases. Mol. Biotechnol. (2006) 32:147–158.[CrossRef][Web of Science][Medline]
-
Nagata E., Sawa A., Ross C.A., Snyder S.H. Autophagosome-like vacuole formation in Huntington's disease lymphoblasts. Neuroreport (2004) 15:1325–1328.[Web of Science][Medline]
This article has been cited by other articles:
![]() |
A. L. Southwell, A. Khoshnan, D. E. Dunn, C. W. Bugg, D. C. Lo, and P. H. Patterson Intrabodies Binding the Proline-Rich Domains of Mutant Huntingtin Increase Its Turnover and Reduce Neurotoxicity J. Neurosci., September 3, 2008; 28(36): 9013 - 9020. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Warby, C. N. Doty, R. K. Graham, J. B. Carroll, Y.-Z. Yang, R. R. Singaraja, C. M. Overall, and M. R. Hayden Activated caspase-6 and caspase-6-cleaved fragments of huntingtin specifically colocalize in the nucleus Hum. Mol. Genet., August 1, 2008; 17(15): 2390 - 2404. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||











