Human Molecular Genetics Advance Access originally published online on August 24, 2007
Human Molecular Genetics 2007 16(22):2740-2750; doi:10.1093/hmg/ddm229
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
A functional polymorphism of the G
q (GNAQ) gene is associated with accelerated mortality in African-American heart failure


1 Department of Medicine, Cardiopulmonary Genomics Program, University of Maryland, Baltimore, MD, USA, 2 Department of Epidemiology, School of Public Health, University of Michigan, Ann Arbor, MI, USA and 3 Center for Molecular Cardiovascular Research, University of Cincinnati, Cincinnati, OH, USA
* To whom correspondence should be addressed: Hanna Professor and Director, Molecular Cardiovascular Research, 231 Albert Sabin Way, ML 0839, Cincinnati, OH 45267-0839., USA. Tel: +1 5135583065; Fax: +1 5135583438; Email: dorngw{at}ucmail.uc.edu
Received April 25, 2007; Revised July 31, 2007; Accepted July 31, 2007
| ABSTRACT |
|---|
|
|
|---|
G
q, encoded by the human GNAQ gene, is an effector subunit of the Gq heterotrimeric G-protein and the convergence point for signaling of multiple Gq-coupled neurohormonal receptors. To identify naturally occurring mutations that could modify GNAQ transcription, we examined genomic DNA isolated from 355 normal subjects for genetic variants in transcription factor binding motifs. Of seven variants identified, the most common was a GC to TT dinucleotide substitution at –694/–695 (allele frequency of 0.467 in Caucasians and 0.329 in African Americans) within a GC-rich domain containing consensus binding sites for Sp-1, c-rel and EGR-1. In promoter–reporter analyses, the TT substitution increased promoter activity in cultured neonatal rat cardiac myocytes and human HEK fibroblasts by
30% at baseline and after stimulation with phorbol ester. Two other relatively common polymorphisms, –173G/A and –168G/A, did not affect promoter activity. Since altered expression/activity of G
q is implicated in heart disease, we re-sequenced the GNAQ promoter in 1052 prospectively followed heart failure patients. The TT variant was not increased in heart failure, but was associated with decreased survival time among African Americans, with an adjusted RR of death/cardiac transplant of 1.95 (95% CI = 1.21–3.13) for heterozygotes and 2.4 (95% CI = 1.36–4.26) for homozygotes. Gel mobility shift assays showed that this GC/TT substitution eliminated Sp-1 binding without affecting c-rel or EGR-1 binding to this promoter fragment. Thus, the GNAQ –694/–695 promoter polymorphism alters transcription factor binding, increases promoter activity and adversely affects outcome in human heart failure. | INTRODUCTION |
|---|
|
|
|---|
Heart failure is a multifactorial clinical syndrome in which cardiac output is insufficient to meet physiological demand (1). The association of heart failure and its clinical antecedents with polymorphisms of
- and ß-adrenergic receptor genes or angiotensinogen, angiotensin converting enzyme and angiotensin II type I receptor genes suggests that gene variants affecting critical neurohormonal signaling pathways can impact heart disease (2,3).
Epinephrine/norepinephrine-
1 adrenergic receptor and angiotensin II-AT1 receptor signaling transduced via the Gq heterotrimeric G-protein contributes to cardiac hypertrophy and heart failure (4). In experimental models, increased expression of the alpha subunit of Gq (G
q) is sufficient to cause pathological cardiac hypertrophy without neurohormonal stimulation (5) and predisposes to functional cardiac decompensation and development of heart failure (6–9). In contrast, attenuation of cardiac Gq signaling through ablation of the G
q gene (GNAQ) or dominant G
q inhibition prevents reactive hypertrophy and is protective against heart failure (10–12). Whether variations in GNAQ expression or G
q function can affect human heart disease is unknown.
A previous genetic survey of GNAQ coding exons failed to identify common non-synonymous coding polymorphisms (13). Allelic variations within the GNAQ promoter, i.e. within the regions that regulate Gq mRNA expression, have not been investigated in this context. Here, we re-sequenced
800 bp of the proximal 5' region of human GNAQ, identifying three common and six rare allelic variations, resulting in seven major haplotypes (i.e. haplotypes shared by more than 10 subjects) in the African-American population and six major haplotypes in the Caucasian population. Bio-informatics analysis showed that two of the common polymorphisms, –695/–694 GC/TT and –173 G/A, occurred within putative transcription factor binding sites. Of the three common polymorphisms, only –695/–694 GC/TT altered promoter function or transcription factor binding, and was a powerful independent predictor of adverse outcome in African-American patients with systolic heart failure.
| RESULTS |
|---|
|
|
|---|
Genetic variability in the GNAQ promoter
To identify naturally occurring genetic variations of the GNAQ promoter, the flanking region of the GNAQ gene extending to approximately –800 bp 5' of the transcription initiation site (Fig. 1A) was subjected to PCR amplification and re-sequencing in 322 Caucasian and 35 African-American subjects with no history of cardiac disease and with normal echocardiographic indices of cardiac function. In this non-affected cohort, six single nucleotide variations were identified at nucleic acid positions –168 (G/A), –173 (G/A), –311 (C/T), –321 (G/T), –537 (T/C), –719 (C/T) and a dinucleotide substitution was detected at –695/–694 (CG/TT) (Fig. 1A and Table 1). As the G-168A, G-173A and CG –694/–695 TT variants were the only ones with allele frequencies >0.05, they were the focus of further analysis and study.
|
|
Each of the three common GNAQ promoter variants was found at allele frequencies consistent with the predictions of Hardy–Weinberg equilibrium (HWE), although stratification by race revealed a significantly higher frequency of the –695/–694 TT allele in Caucasians than in African Americans (P < 0.001) (Fig. 1B and Table 1). Linkage disequilibrium (LD) analysis showed nearly complete linkage between the adjacent nucleotides within the –694/–695 dinucleotide polymorphism (D'>0.99, r2 = >0.96), but this site and the other two common polymorphisms at –168 and –173 are not in linkage disequilibrium (African-American r2 = 0.021, Caucasian r2 = 0.048). Minor alleles at all three positions, –695/–694, –173 and –168, never appeared on the same haplotype (Fig. 1B).
Informatics examination of the GNAQ gene 5' flanking region revealed the presence of numerous consensus transcription factor binding sites (Fig. 1A) and substantial homology among the human, dog and mouse promoter sequences (Fig. 2). The G/C sequence extending from –692 to –709, in which is located the CG –695/–694 TT dinucleotide polymorphism, encodes putative overlapping binding sites for the Sp1 (serum protein 1), c-rel (a NF
B transcription factor) and EGR-1 (early growth response-1) transcription factors, each of which has been implicated in cell growth (14–16). Substitution of TT for CG at position –695/–694 eliminates the Sp1 consensus sequence, but not the putative EGR-1 or c-rel binding sites. A putative myeloid zinc finger 1 (MZF1) binding site at –170 to –177 contained the G-173A variant and is immediately adjacent to the G-168A substitution. Substitution of the polymorphic sequence for the reference at position –173 eliminates the consensus MZF1 sequence, whereas replacing with the –169 variant left the putative binding domain intact. These findings suggested that at least two of the three more common GNAQ polymorphisms have potential to impact Gq promoter function by altering transcription factor binding.
|
The GNAQ –694/–695 GC/TT promoter polymorphism alters promoter activity
To determine the functional significance of GNAQ promoter polymorphisms, luciferase reporter gene constructs were created containing the wild-type, –695/–694 GC/TT, –173 G/A and –168 G/A polymorphisms (Fig. 3A). Reporter gene activity was measured in human embryonal kidney (HEK) cells at baseline and after stimulation with protein-kinase C-activating phorbol ester. The –695/–694 GC/TT substitution increased basal GNAQ promoter activity by
30% in HEK cells (n = 24–27 studies, P < 0.05 by ANOVA), whereas neither the –173 or –168 G/A substitutions significantly impacted luciferase activity (Fig. 3B). In the wild type and all three mutant promoters, phorbol ester treatment decreased GNAQ transcriptional activity by
30% in HEK cells (Fig. 3B), without affecting the trend for greater promoter activity of the –695/–694 GC/TT variant (P = 0.081).
|
Because of the possibility for tissue-specific expression profiles of GNAQ, the –695/–694 GC/TT promoter reporter studies were also performed in cultured neonatal rat cardiac myocytes. Again, the –695/–694 GC/TT substitution increased basal GNAQ promoter activity by
30% (n = 6, P = 0.02) without affecting suppression by PMA (Fig. 3C). Based on these functional studies and prior results showing alteration of cardiac performance by forced expression of G
q in mouse hearts (5), the –695/–694 GC/TT polymorphism was further examined as a potential modifier of cardiac function in human subjects.
The –694/–695 GC/TT GNAQ promoter polymorphism increases the risk of death/cardiac transplantation in heart failure
The sine qua non of increased cardiac Gq expression in animal models is non-failing cardiac hypertrophy that exhibits accelerated functional deterioration in response to various forms of stress (6–8,17,18). We hypothesized that enhanced GNAQ promoter activity in individuals with the GC/TT polymorphism might either increase the susceptibility to heart failure or accelerate its progression. To test whether it was a risk factor for heart failure development, a case-control study was performed comparing the prevalence of –695/–694 GC/TT in 355 normal subjects (320 Caucasian and 35 African American) who underwent echocardiographic examination with a well-characterized cohort of 1052 (741 Caucasian and 311 African American) heart failure patients who have been prospectively followed at the University of Cincinnati since late 1999. The –695/–694 TT allele frequency did not differ between normal and heart failure in either Caucasians (0.467 normals, 0.478 heart failure;
2 P-value = 0.4251) or African Americans (0.329 normals, 0.366 heart failure;
2 P-value = 0.7309), but was significantly more common in Caucasians (Table 1, P < 0.001). Genotype distribution within both racial groups was consistent with predictions of HWE. Comparison of echocardiographic parameters by genotype in normal subjects revealed no association between –695/–694 TT and any measured index of cardiac structure or function (Table 2). These data show that the GNAQ –695/–694 TT allele is more common in Caucasian individuals and is not associated with cardiac dysfunction or an increased risk of developing heart failure.
|
The GNAQ gene product, the alpha subunit of heterotrimeric Gq, transduces signals for seven transmembrane spanning receptors of several neurohormones that are elevated in, and contribute to, the pathophysiology of, heart failure (4). We considered that increased Gq expression afforded by the –695/–694 TT polymorphism could have effects on the outcome of patients with excessive neurohormonal activity that is characteristic of heart failure syndromes, and therefore compared outcome in heart failure patients as a function of GNAQ haplotype. The clinical characteristics of heart failure subjects, delineated by race, are in Table 3, and show significant differences in age of clinical presentation, body mass index, diastolic blood pressure, stroke volume and left ventricular ejection performance. To avoid spurious associations resulting from the observed differences in allele frequencies and clinical covariates between African Americans and Caucasians, these populations were analyzed separately.
|
Within the group of heart failure cases, Kaplan–Meier methods and Cox Proportional Hazards modeling were undertaken for heart failure progression, defined by the combined endpoint of death or cardiac transplantation. To estimate whether GNAQ polymorphisms had any detectable effect on heart failure outcome, the initial analyses compared time from clinical diagnosis to death or heart transplantation in subjects with a wild-type haplotype at positions –695/–694 (homozygous CG) and at position –173 (homozygous G), i.e. the two promoter positions where informatics indicated the possibility that nucleotide substitutions occurred within putative transcription factor binding sites. In Caucasians, there was no difference in outcome between wild-type promoter and all polymorphic promoters, whereas African American heart failure with wild-type promoters had significantly prolonged (P = 0.0319) transplant-free survival (Fig. 4A).
|
For exploratory purposes, Kaplan–Meier analysis was performed for each –695/–694 and –173 haplotype represented by at least 5 individuals (Table 1). Figure 4B shows that of the six analyses, only one was significant: homozygous –694/–695 GC/TT versus wild-type (Log Rank P-value of 0.0086). Having the GC/TT polymorphism in combination with the –173 G/A polymorphism did not appear to alter survival time among African Americans compared to those who had no A alleles. Therefore, we examined the effect of –695/–694 genotype regardless of genotype at –173. Kaplan–Meier curves show a significant decrease in transplant-free survival time for African-Americans homozygous for the TT allele and an intermediate phenotype for African Americans heterozygous for the TT allele (Log Rank P = 0.0188). African American TT carriers have decreased transplant-free survival time compared to those homozygous for CG at the same position (Log Rank P = 0.022) (Fig. 4C). These results did not change when mortality alone was used as the endpoint (Log Rank P = 0.0318, data not shown). Using the wild-type promoter as a reference, Cox proportional hazards modeling showed that African-American TT homozygotes had a relative risk (RR) for death or transplant of 2.17 [95% confidence interval (CI) = 1.25–3.79] and African-American TT heterozygotes had a RR of 1.46 (95% CI = 0.94–2.28). In contrast, and consistent with the Kaplan–Meier findings in Figure 4A, neither Caucasian TT heterozygotes nor TT homozygotes showed any difference in survival (Log Rank P = 0.695) or increase in relative risk (RR = 0.93; 95% CI = 0.71–1.23 and RR = 0.89; 95% CI = 0.63–1.26, respectively).
In order to test whether GC/TT polymorphism status provided additional information about the rate of survival beyond traditional risk factors, we performed Cox proportional hazards modeling taking into account age at heart failure onset, sex, weight and beta blocker usage, i.e. factors known to affect survival (19). In African Americans, adding the –695/–694 genotype significantly increased the predictive utility of the model (likelihood ratio P = 0.0005), giving an RR estimate of 2.40 for TT homozygotes compared to individuals with only CG –695/–694 alleles (95% CI = 1.36–4.26) and an RR estimate of 1.95 for TT heterozygotes (95% CI = 1.21–3.13) (Table 4). In Caucasians –695/–694 status did not significantly improve the model (likelihood ratio P = 0.6597). Including a term to account for angiotensin converting enzyme inhibitor treatment did not significantly improve the fit of the model for either Caucasians (likelihood ratio P = 0.8625) or African Americans (likelihood ratio P = 0.2605).
|
To assess whether the information from Cox proportional hazards modeling provides a useful prediction of a new patients risk of death or cardiac transplant, a leave-one-out cross-validation approach was implemented. Each individual was sequentially left out and a Cox proportional hazards model for time from study enrollment to death or cardiac transplant by –695/–694 genotype was fitted using the remaining individuals. The relative risk for the person left out was then calculated using this model. These relative risks were used as the predictor in a Cox proportional hazards model of time to death or cardiac transplant. In African Americans, these relative risks were a significant predictor of time to death or cardiac transplant (RR = 1.85, 95% CI = 1.01–3.41, P = 0.048), but in Caucasians they were not (RR = 0.176, 95% CI = 0.02–1.68, P = 0.13).
The GNAQ –694/–695 GC/TT polymorphism alters transcription factor binding
Given that in silico transcription factor analysis, in vitro promoter–reporter functional studies, and genotype association studies in heart failure all suggested an effect of the –695/–694 TT polymorphism, we used electrophoretic mobility shift assays (EMSA) to determine whether the nucleotide substitutions altered DNA-transcription factor interactions. Egr-1, Sp1 and c-rel each bound to a synthetic double stranded oligonucleotide encoding the region between –677 and –713, which spans the putative EGR-1/Sp1/c-rel binding site in the GC rich region from –692 to –709 (Fig. 5). EMSAs performed with an identical promoter fragment encoding polymorphic TT at –694/–695 showed binding of EGR-1 and c-rel, but not Sp1 (Fig. 5). Together, these data show that Sp1, EGR-1 and c-rel bind to a functionally significant and polymorphic GC-rich upstream fragment of the wild-type GNAQ promoter. The –695/–694 TT polymorphism eliminates Sp1 binding without affecting c-rel or EGR-1 binding, which increases basal promoter activity and confers adverse outcomes in human heart failure.
|
| DISCUSSION |
|---|
|
|
|---|
There are numerous generally accepted adverse clinical prognostic features for human heart failure, including male sex, African American race, age, disease severity, ischemic etiology, hypotension, and low body weight (19–21). In addition, an increasing number of genetic mutations in sarcomeric and calcium handling genes have been identified as causes of familial cardiomyopathies (22,23), and gene polymorphisms affecting neurohormonal signaling pathways have shown associations with development and outcomes in more common non-familial heart failure syndromes (2,3). Here, we describe a non-coding polymorphism in the GNAQ promoter that enhances promoter activity by altering transcription factor Sp1 binding and is associated with accelerated end points of death/cardiac transplant in African Americans with heart failure.
The –695/–694 TT GNAQ polymorphism increased basal promoter-luciferase reporter activity by
30% in human fibroblasts and rat cardiac myocytes. Although this level of difference in promoter activity may seem small, it is in the range of activity of other promoter polymorphisms that do not cause disease, but can modify it (24–26).
Our results indicate that the –695/–694 TT GNAQ polymorphism has similar relative effects on gene expression activity in the absence and presence of protein kinase (PK) C-activating PMA. This may have pathophysiological importance, as the observed negative regulation of Gq expression by its downstream effector kinase, PKC, may reflect a negative feedback of hypertrophic signaling in the heart. Since the –695/–694 TT GNAQ polymorphism does not affect PMA-mediated downregulation, PMA/PKC effects must be mediated by other cis elements. However, because promoter activity remained elevated in comparison to wild-type, our results suggest that basal Gq expression would still be increased in carriers of the polymorphism, relative to non-carriers of the same physiological status. Although our studies are limited in that they do not demonstrate increased myocardial Gq protein expression in –695/–694 TT carriers, if GNAQ promoter activity increases G alpha q protein expression in human myocardium, then there is ample experimental evidence from in vivo and in vitro systems to support increased cardiomyocyte agonist-stimulated signaling transduced through Gq (5–9,17,18), which can explain the association with a more aggressive heart failure course.
The association of accelerated clinical deterioration in heart failure with a genetic event that, at least in experimental systems, increases GNAQ transcription is consistent with the Neurohormonal Hypothesis of heart failure (27), upon which standard heart failure therapy is currently based. Briefly, this hypothesis states that primary heart failure causes secondary activation of the sympathetic and renin-angiotensin systems that have direct detrimental effects on the heart, independent of their vasoconstrictor activities. A corollary of this notion is that pharmacological blockade of these effects will be therapeutic in heart failure, which has been demonstrated in large scale clinical trials for many, but not all neurohormonal antagonists (28).
Since G
q is the common signal transducer for many neurohormone receptors, its cardiac effects have been examined in detail in genetic mouse models. Modest overexpression of G
q in mice causes a phenotype of cardiac hypertrophy with contractile dysfunction that, with additional physiological or genetic stress, progresses to overt heart failure (5–9,17,18). In contrast, G
q inhibition or cardiac-specific gene ablation protects against cardiac hypertrophy and heart failure under conditions of severe hemodynamic overload (10,12,29). Thus, cardiac survival in mice is inversely related to G
q expression. The current results suggest that the same is true in the human condition.
We previously re-sequenced the coding exons of several human G protein alpha subunit genes, including GNAQ, and found that non-synonymous coding polymorphisms are quite rare (13). Since genetic polymorphisms in the 5' non-coding region have the potential to change protein function by altering expression characteristics, we analyzed the proximal GNAQ promoter region for nucleotide variations and identified 12 variants, of which only three were sufficiently common for meaningful genetic analysis. Of these three, only the GC/TT dinucleotide substitution at position –695/–694 appeared to increase GNAQ promoter function, which correlated with loss of transcription factor Sp1 binding. These results suggest that, as has been observed with the SM22
promoter, Sp1 at this position in the GNAQ promoter acts as a transcriptional repressor (30). We also found that Sp1 and EGR-1 bound to the same element, and that the –695/–694 TT variant could still bind EGR-1, but not Sp1. Interactions between Sp1 and Egr-1 have been described for other genes, where there is either competitive binding to the same DNA domain (31), or where EGR-1 directly complexes with Sp1 protein to affect transcriptional activation (32).
Our data show an effect of the GNAQ promoter polymorphism on heart failure in African Americans, but not on cardiac hypertrophy in normal subjects. However, we cannot rule out a modest pro-hypertrophic effect as the number of African-American non-affected subjects in our study is small, echocardiography is limited in its ability to quantify ventricular mass, which is a calculated (not measured) value, and inter-individual variability among study subjects is an unavoidable experimental confounder (33). In contrast, the consequences of the GNAQ –695/–694 GC/TT polymorphism on heart failure outcome in African Americans were striking, and consistent with the known biology of regulated G
q expression (see above). The consistency of the statistical and molecular results is further emphasized by the leave-one-out cross-validation. This provides evidence that not only is the TT –695/–694 allele associated with reduced survival time in this sample, but that this genetic information can be used to make an inference about the survival time of new heart failure patients drawn from the same population.
An intriguing finding is the lack of an observed GNAQ genetic association in Caucasians. While it is beyond the scope of the current study to determine the reasons for this, there are a number of potential causes. Epistatic interactions with loci not genotyped here (and which have higher frequency in Caucasians than African Americans) could potentially compensate for the increased G
q expression, as could epigenetic regulation, which could cause G
q expression to remain normal even in the absence of Sp1 binding. This issue and the question of whether GNAQ promoter polymorphisms can impact other conditions affected by Gq signaling, such as hypertension and renal disease, will require further study in other genetic cohorts.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Study subjects
The human study protocols were approved by the Institutional Review Board of the University of Cincinnati. Subjects provided written informed consent. Heart failure subjects were aged 18–80 years and had New York Heart Association heart failure class II–IV. The case-control association study included 1052 heart failure patients followed at University Hospital, Cincinnati between 1999 and 2004 and 355 non-affected controls recruited from the greater Cincinnati area between 2003 and 2005. Racial classification as Caucasian or African American was self-reported. The heart failure study endpoint was death or cardiac transplantation.
Genotyping
The positions of PCR primers used for amplifying overlapping fragments (–100 through –475 and –410 through –798) of the GNAQ promoter are indicated in Figure 1A. Primer sequences, also used for sequencing are: (upstream fragment).
5'-GGGTCTGGCCCCGACTTCG-3' (sense) and 5'-CCCCCTGCCCCGATTGCCA-3' (anti-sense) and (downstream fragment) 5'-TGTGTGGCGAGGGGGAGGGCTC-3' (sense) and 5'-CCTCCTTCCCCGGGAACAGGC-3' (anti-sense). Polymorphism discovery and GNAQ genotyping used bi-directional automated sequencing on an Applied Biosystems ABI 3130-xl Genetic Analyzer in 96 well format. Adequate sequence results were obtained in 98% of samples, and these were aligned with a reference sequence using SeqScape v2.5 to identify variations, which were individually verified by one of the investigators (RRP).
Cloning of the human GNAQ gene promoter and generation of promoter–reporter constructs
We employed a PCR-based strategy using high fidelity DNA polymerase to amplify
700 bp of the GNAQ promoter from human genomic DNA (encompassing the region from –799 to –100) utilizing the primers 5'-GATCGGATCCGGGTCTGGCCCCGACTTCG-3'(sense) and 5'-CATGAAGCTTCCTCCTTCCCCGGGAACAGGC-3'. To facilitate cloning into the luciferase reporter plasmid pGL3-Basic (Promega, Madison, WI), the oligonucleotides were engineered with BamHI and HindIII sites (bold), respectively. BamHI/HindIII-flanked PCR amplicons were obtained from human genomic DNA of known haplotype, and were purified, digested and cloned into pGL3-Basic. Reporter constructs were verified by double-stranded sequencing.
Luciferase assays
Transfected HEK cells or neonatal rat cardiac myocytes were harvested, lysed in cell culture lysis reagent (Promega) and clarified by centrifugation at 1000x g, and the supernatant was immediately assayed for luciferase activity in a Berthold luminometer (Sirius) using the Luciferase assay system from Promega. Relative luciferase activity was normalized to protein content (Bradford assay). Data are reported as raw counts for HEK assays, in which transfection efficiency was consistently greater than 80%, or as induction relative to empty pGL3-Basic vector for neonatal rat cardiac myocytes, where transfection efficiency varied between 15 and 25% (34).
Electrophoretic mobility shift assays
Gel mobility shift assays were performed essentially as described (34). Briefly, 20 000 cpm of 32P-double-stranded DNA (5 pmol/µl) was incubated for 20 min with 300 ng of human recombinant Sp1, EGR or c-rel protein in the presence or absence of a 50-fold molar excess of unlabeled competing oligonucleotide or specific antibody. DNA-protein complexes were resolved by electrophoresis through 5% polyacrylamide gels and visualized by autoradiography. Probe (sense) sequences were as follows (the position of the GC/TT polymorphism is bold; the GC-rich element is in italics):
GCWT, 5'-CAGAGCCCGCGGGGGCCGGCCCAGCCCGGGAGCCGC-3'.
TTmut, 5'- CAGAGCCCGCGGGGGCCGTTCCAGCCCGGGAGCCGC -3'.
Statistical analyses
Students t-tests and
2 tests were used to assess significant differences in variables between ethnic groups and between genotype classes within ethnic groups. Genotype and allele frequencies were calculated using SNP Assistant (Genorama, Inc.). HWE was assessed in each ethnic group separately. Differences in time from heart failure diagnosis to endpoint were assessed using Kaplan–Meier curves and Log Rank tests. Relative risks were obtained using Cox Proportional Hazards modeling (35,36). Haplotypes were calculated using PHASE 2.0 (37). Based on the allele frequencies that were found for individual SNPs and the PHASE output, we recognized that there would be a number of low frequency haplotypes, with seven major haplotypes (i.e. haplotypes shared by more than ten subjects) in the African-American population and six major haplotypes in the Caucasian population. These haplotypes were defined primarily by the dinucleotide polymorphism at positions –695/–694 and by the single nucleotide polymorphism at –173, with wild-type alleles at the rare polymorphic sites making up the rest of these major haplotypes. Thus, for the primary analysis in the heart failure survival study, 3 two-locus haplotypes were considered. For exploratory purposes, secondary analyses were carried out with several of the other haplotypes, although barring a significant effect we recognize that we are underpowered. Except as stated, all analyses were carried out using the R Statistical Language (38).
For cell culture studies, all transfections were performed in duplicate. Experimental groups were compared using Students t-test or one-way analysis of variance. A Bonferroni or Mann–Whitney test was used for post hoc comparisons as appropriate, with P < 0.05 indicating significance.
| FUNDING |
|---|
|
|
|---|
This work was supported by NHLBI P50 HL77101, Genetic and Molecular Signaling in Heart Failure. Funding to pay the Open Access publication charge was provided by ... .
Conflict of Interest statement. The authors declare that they have no competing financial interests.
| FOOTNOTES |
|---|
The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors. | REFERENCES |
|---|
|
|
|---|
-
Hunt S.A., Abraham W.T., Chin M.H., Feldman A.M., Francis G.S., Ganiats T.G., Jessup M., Konstam M.A., Mancini D.M., Michl K., et al. ACC/AHA 2005 Guideline Update for the Diagnosis and Management of Chronic Heart Failure in the Adult: a report of the American College of Cardiology/American Heart Association Task Force on Practice Guidelines (Writing Committee to Update the 2001 Guidelines for the Evaluation and Management of Heart Failure): developed in collaboration with the American College of Chest Physicians and the International Society for Heart and Lung Transplantation: endorsed by the Heart Rhythm Society. Circulation (2005) 112:e154–e235.
[Free Full Text] - Bleumink G.S., Schut A.F., Sturkenboom M.C., Deckers J.W., van Duijn C.M., Stricker B.H. Genetic polymorphisms and heart failure. Genet. Med. (2004) 6:465–474.[ISI][Medline]
- Liggett S.B. Polymorphisms of beta-adrenergic receptors in heart failure. Am. J. Med. (2004) 117:525–527.[CrossRef][ISI][Medline]
- Dorn G.W., Brown J.H. Gq signaling in cardiac adaptation and maladaptation. Trends Cardiovasc. Med. (1999) 9:26–34.[CrossRef][ISI][Medline]
-
DAngelo D.D., Sakata Y., Lorenz J.N., Boivin G.P., Walsh R.A., Liggett S.B., Dorn G.W. Transgenic Galphaq overexpression induces cardiac contractile failure in mice. Proc. Natl Acad. Sci. USA (1997) 94:8121–8126.
[Abstract/Free Full Text] -
Adams J.W., Sakata Y., Davis M.G., Sah V.P., Wang Y., Liggett S.B., Chien K.R., Brown J.H., Dorn G.W. Enhanced Galphaq signaling: a common pathway mediates cardiac hypertrophy and apoptotic heart failure. Proc. Natl Acad. Sci. USA (1998) 95:10140–10145.
[Abstract/Free Full Text] -
Sakata Y., Hoit B.D., Liggett S.B., Walsh R.A., Dorn G.W. Decompensation of pressure-overload hypertrophy in G alpha q-overexpressing mice. Circulation (1998) 97:1488–1495.
[Abstract/Free Full Text] -
Dorn G.W., Tepe N.M., Lorenz J.N., Koch W.J., Liggett S.B. Low- and high-level transgenic expression of beta2-adrenergic receptors differentially affect cardiac hypertrophy and function in Galphaq-overexpressing mice. Proc. Natl Acad. Sci. USA (1999) 96:6400–6405.
[Abstract/Free Full Text] -
Mende U., Kagen A., Cohen A., Aramburu J., Schoen F.J., Neer E.J. Transient cardiac expression of constitutively active Galphaq leads to hypertrophy and dilated cardiomyopathy by calcineurin-dependent and independent pathways. Proc. Natl Acad. Sci. USA (1998) 95:13893–13898.
[Abstract/Free Full Text] - Wettschureck N., Rutten H., Zywietz A., Gehring D., Wilkie T.M., Chen J., Chien K.R., Offermanns S. Absence of pressure overload induced myocardial hypertrophy after conditional inactivation of Galphaq/Galpha11 in cardiomyocytes. Nat. Med. (2001) 7:1236–1240.[CrossRef][ISI][Medline]
- Kina T., Ikuta K., Takayama E., Wada K., Majumdar A.S., Weissman I.L., Katsura Y. The monoclonal antibody TER-119 recognizes a molecule associated with glycophorin A and specifically marks the late stages of murine erythroid lineage. Br. J. Haematol. (2000) 109:280–287.[CrossRef][ISI][Medline]
-
Esposito G., Rapacciuolo A., Naga Prasad S.V., Takaoka H., Thomas S.A., Koch W.J., Rockman H.A. Genetic alterations that inhibit in vivo pressure-overload hypertrophy prevent cardiac dysfunction despite increased wall stress. Circulation (2002) 105:85–92.
[Abstract/Free Full Text] -
Lynch R.A., Wagoner L., Li S., Sparks L., Molkentin J., Dorn G.W. Novel and nondetected human signaling protein polymorphisms. Physiol. Genomics (2002) 10:159–168.
[Abstract/Free Full Text] - Black A.R., Black J.D., Azizkhan-Clifford J. Sp1 and kruppel-like factor family of transcription factors in cell growth regulation and cancer. J. Cell Physiol. (2001) 188:143–160.[CrossRef][ISI][Medline]
- Thiel G., Cibelli G. Regulation of life and death by the zinc finger transcription factor Egr-1. J. Cell Physiol. (2002) 193:287–292.[CrossRef][ISI][Medline]
- Rayet B., Gelinas C. Aberrant rel/nfkb genes and activity in human cancer. Oncogene (1999) 18:6938–6947.[CrossRef][ISI][Medline]
-
Syed F., Odley A., Hahn H.S., Brunskill E.W., Lynch R.A., Marreez Y., Sanbe A., Robbins J., Dorn G.W. Physiological growth synergizes with pathological genes in experimental cardiomyopathy. Circ. Res. (2004) 95:1200–1206.
[Abstract/Free Full Text] -
Hayakawa Y., Chandra M., Miao W., Shirani J., Brown J.H., Dorn G.W., Armstrong R.C., Kitsis R.N. Inhibition of cardiac myocyte apoptosis improves cardiac function and abolishes mortality in the peripartum cardiomyopathy of Galpha(q) transgenic mice. Circulation (2003) 108:3036–3041.
[Abstract/Free Full Text] -
Cowburn P.J., Cleland J.G., Coats A.J., Komajda M. Risk stratification in chronic heart failure. Eur. Heart J. (1998) 19:696–710.
[Free Full Text] - Pulignano G., Del Sindaco D., Tavazzi L., Lucci D., Gorini M., Leggio F., Porcu M., Scherillo M., Opasich C., Di Lenarda A., Senni M., Maggioni A.P. Clinical features and outcomes of elderly outpatients with heart failure followed up in hospital cardiology units: data from a large nationwide cardiology database (IN-CHF Registry). Am. Heart J. (2002) 143:45–55.[CrossRef][ISI][Medline]
-
Kalantar-Zadeh K., Block G., Horwich T., Fonarow G.C. Reverse epidemiology of conventional cardiovascular risk factors in patients with chronic heart failure. J. Am. Coll. Cardiol. (2004) 43:1439–1444.
[Abstract/Free Full Text] - Franz W.M., Muller O.J., Katus H.A. Cardiomyopathies: from genetics to the prospect of treatment. Lancet (2001) 358:1627–1637.[CrossRef][ISI][Medline]
- Morita H., Seidman J., Seidman C.E. Genetic causes of human heart failure. J. Clin. Invest. (2005) 115:518–526.[CrossRef][ISI][Medline]
-
Karban A.S., Okazaki T., Panhuysen C.I., Gallegos T., Potter J.J., Bailey-Wilson J.E., Silverberg M.S., Duerr R.H., Cho J.H., Gregersen P.K., et al. Functional annotation of a novel NFKB1 promoter polymorphism that increases risk for ulcerative colitis. Hum. Mol. Genet. (2004) 13:35–45.
[Abstract/Free Full Text] -
Takahashi N., Akahoshi M., Matsuda A., Ebe K., Inomata N., Obara K., Hirota T., Nakashima K., Shimizu M., Tamari M., et al. Association of the IL12RB1 promoter polymorphisms with increased risk of atopic dermatitis and other allergic phenotypes. Hum. Mol. Genet. (2005) 14:3149–3159.
[Abstract/Free Full Text] -
Yuan H.Y., Chen J.J., Lee M.T., Wung J.C., Chen Y.F., Charng M.J., Lu M.J., Hung C.R., Wei C.Y., Chen C.H., Wu J.Y., Chen Y.T. A novel functional VKORC1 promoter polymorphism is associated with inter-individual and inter-ethnic differences in warfarin sensitivity. Hum. Mol. Genet. (2005) 14:1745–1751.
[Abstract/Free Full Text] - Packer M. The neurohormonal hypothesis: a theory to explain the mechanism of disease progression in heart failure. J. Am. Coll. Cardiol. (1992) 20:248–254.[Abstract]
- Gheorghiade M., De Luca L., Bonow R.O. Neurohormonal inhibition in heart failure: insights from recent clinical trials. Am. J. Cardiol. (2005) 96:3L–9L.[ISI][Medline]
-
Akhter S.A., Luttrell L.M., Rockman H.A., Iaccarino G., Lefkowitz R.J., Koch W.J. Targeting the receptor-Gq interface to inhibit in vivo pressure overload myocardial hypertrophy. Science (1998) 280:574–577.
[Abstract/Free Full Text] -
Wamhoff B.R., Hoofnagle M.H., Burns A., Sinha S., McDonald O.G., Owens G.K. A G/C element mediates repression of the SM22alpha promoter within phenotypically modulated smooth muscle cells in experimental atherosclerosis. Circ. Res. (2004) 95:981–988.
[Abstract/Free Full Text] - Huang R.P., Fan Y., Ni Z., Mercola D., Adamson E.D. Reciprocal modulation between Sp1 and Egr-1. J. Cell Biochem. (1997) 66:489–499.[CrossRef][ISI][Medline]
-
Zhang X., Liu Y. Suppression of HGF receptor gene expression by oxidative stress is mediated through the interplay between Sp1 and Egr-1. Am. J. Physiol. Renal Physiol. (2003) 284:F1216–F1225.
[Abstract/Free Full Text] - Foppa M., Duncan B.B., Rohde L.E. Echocardiography-based left ventricular mass estimation. How should we define hypertrophy? Cardiovasc. Ultrasound (2005) 3:17.[CrossRef][Medline]
-
Galvez A.S., Brunskill E.W., Marreez Y., Benner B.J., Regula K.M., Kirschenbaum L.A., Dorn G.W. Distinct pathways regulate proapoptotic Nix and BNip3 in cardiac stress. J. Biol. Chem. (2006) 281:1442–1448.
[Abstract/Free Full Text] - Kaplan E.L., Meier P. Nonparametric estimation from incomplete observations. J. Am. Stat. Assoc. (2006) 53:457–481.[CrossRef]
- Parmar M., Machin D. Survival Analysis: A practical approach (1995) John Wiley & Sons.
- Stephens M., Donnelly P. A comparison of bayesian methods for haplotype reconstruction from population genotype data. Am. J. Hum. Genet. (2003) 73:1162–1169.[CrossRef][ISI][Medline]
-
R Develpoment Core Team. R:A language and environment for statistical computing. (2.3.0), R foundation for statistical computing. (2005).
This article has been cited by other articles:
![]() |
V. Tikhonoff and E. Casiglia Evolving concepts of left ventricular hypertrophy Eur. Heart J., April 1, 2008; 29(7): 846 - 848. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





