Skip Navigation


Human Molecular Genetics Advance Access originally published online on September 19, 2007
Human Molecular Genetics 2007 16(23):2892-2899; doi:10.1093/hmg/ddm248
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/23/2892    most recent
ddm248v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Martin, M. S.
Right arrow Articles by Escayg, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martin, M. S.
Right arrow Articles by Escayg, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

The voltage-gated sodium channel Scn8a is a genetic modifier of severe myoclonic epilepsy of infancy

Melinda S. Martin1, Bin Tang1, Ligia A. Papale2, Frank H. Yu3, William A. Catterall3 and Andrew Escayg1,*

1 Department of Human Genetics, Emory University, Atlanta, GA 30322, USA, 2 Department of Psychobiology, Universidade Federal de São Paulo, São Paulo, Brazil and 3 Department of Pharmacology, University of Washington, Seattle, WA 98195, USA

* To whom correspondence should be addressed at: Department of Human Genetics, Emory University, 615 Michael Street, Whitehead Building, Suite 301, Atlanta, GA 30322. Tel: +1 4047128328; Fax: +1 4047273949; Email: aescayg{at}genetics.emory.edu

Received July 5, 2007; Accepted August 23, 2007


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 FUNDING
 REFERENCES
 
The mammalian genome contains four voltage-gated sodium channel genes that are primarily expressed in the central nervous system: SCN1A, SCN2A, SCN3A and SCN8A. Mutations in SCN1A and SCN2A are responsible for several dominant idiopathic epilepsy disorders, including generalized epilepsy with febrile seizures plus (GEFS+) and severe myoclonic epilepsy of infancy (SMEI). Mutations in SCN8A are associated with cognitive deficits and neuropsychiatric illness in humans and movement disorders in mice; however, a role for SCN8A (Nav1.6) in epilepsy has not been investigated. To determine the relationship between Nav1.6 dysfunction and seizure susceptibility, we examined the thresholds of two Scn8a mouse mutants, Scn8amed and Scn8amed-jo, to flurothyl- and kainic acid (KA)-induced seizures. Both mutants were more seizure resistant than wild-type littermates, suggesting that altered Nav1.6 function reduces neuronal excitability. To determine whether impaired Nav1.6 function could ameliorate seizure severity in a mouse model of SMEI, we generated Scn1a+/–; Scn8amed-jo/+ double heterozygous mice. Unlike Scn1a+/– mice that are more susceptible to flurothyl-induced seizures, Scn1a+/–; Scn8amed-jo/+ mice displayed thresholds that were comparable to wild-type littermates. The Scn8amed-jo allele was also able to rescue the premature lethality of Scn1a+/– mice and extend the lifespan of Scn1a–/– mutants. These results demonstrate that genetic interactions can alter seizure severity and support the hypothesis that genetic modifiers contribute to the clinical variability observed in SMEI and GEFS+.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 FUNDING
 REFERENCES
 
Voltage-gated sodium channels are transmembrane protein complexes that play a critical role in electrical signaling between cells. Following an initial membrane depolarization, voltage-gated sodium channels open, permitting the rapid influx of sodium ions and the initiation and propagation of an action potential. Voltage-gated sodium channels are comprised of one {alpha} subunit and one or more auxiliary ß subunits (ß1–ß4). The 260 kDa {alpha} subunit contains several functional domains including an ion selective pore, an intracellular inactivation gate, and a positively charged voltage sensor (1).

The human genome contains 9 voltage-gated sodium channel {alpha} subunit genes, each with distinct spatial and temporal expression patterns (2). Four {alpha} subunits, Nav1.1, Nav1.2, Nav1.3 and Nav1.6, respectively encoded by SCN1A, SCN2A, SCN3A and SCN8A, are primarily expressed in the central nervous system (35). Mutations in SCN1A and SCN2A cause several subtypes of dominant idiopathic generalized epilepsy. Mutations in both SCN1A and SCN2A lead to generalized epilepsy with febrile seizures plus (GEFS+; MIM 604233 [OMIM] ) (6,7). SCN2A dysfunction also causes benign familial neonatal-infantile seizures (BFNIS; MIM 607745 [OMIM] ) (8), while SCN1A mutations are the main cause of severe myoclonic epilepsy of infancy (SMEI; MIM 607208 [OMIM] ) (9). SMEI is a debilitating form of childhood epilepsy characterized by complex febrile seizures, the development of afebrile seizures, and mental retardation. SMEI often results from loss of function SCN1A mutations, and represents a haploinsufficiency phenotype (10). Affected members of GEFS+ families with the same SCN1A mutation often present with a variety of epilepsy subtypes and severities, ranging from childhood febrile seizures to adult generalized or partial epilepsy to SMEI (11,12). Variable clinical severities are also observed among sporadic SMEI patients.

Yu et al. (13) constructed a mouse model of SMEI by targeted disruption of the mouse Scn1a gene. Heterozygous Scn1a+/– mutants, expressing 50% of normal Nav1.1 channel levels, exhibit spontaneous seizures and a high mortality rate from 4 weeks after birth. Homozygous mutants, which completely lack Nav1.1 channels, are ataxic and die 15 days after birth. Electrophysiological analysis of hippocampal pyramidal neurons from Scn1a–/– mice revealed normal levels of sodium currents, indicating that Scn1a–/– does not make a major contribution to sodium currents in these neurons. In contrast, sodium currents were significantly reduced in hippocampal interneurons that are critical for GABA-mediated neuronal inhibition. The ataxia observed in homozygous Scn1a–/– mutants is thought to be caused by reduced peak, persistent and resurgent sodium current in cerebellar Purkinje neurons (14). A second mouse model of SMEI was recently generated by the targeted introduction of a premature stop codon (R1407X), identified in three SMEI patients, into the mouse Scn1a gene (15). These heterozygous mutants also displayed decreased Nav1.1 expression, spontaneous seizures, and abnormal firing of neocortical interneurons. Both studies therefore suggest that reduced neuronal inhibition contributes to the SMEI phenotype.

The first mutation in the human SCN8A gene, encoding Nav1.6 channels, was recently reported in a proband with juvenile-onset ataxia and mental retardation. Additional family members with the same dominant mutation displayed mild cognitive deficits and a variety of behavioral abnormalities (16). In the mouse, recessive mutations in Scn8a result in neuromuscular disorders. Mice homozygous for a point mutation in Scn8a (Scn8amed-jo) display cerebellar ataxia and a tremor involving the head and body (1719). Homozygosity for null mutations of Scn8a (Scn8amed or Scn8amed-tg) results in progressive paralysis, muscular atrophy of the hind limbs, and premature death between 3 and 4 weeks of age (2023). In addition, mice that lack Scn8a only in cerebellar Purkinje neurons exhibit impaired learning when examined using the Morris water maze (24).

A number of studies have examined the neuromuscular phenotypes of the Scn8a mutant mice; however, the effect of Nav1.6 dysfunction on seizure thresholds has not been investigated. To determine if Nav1.6 dysfunction leads to altered seizure thresholds, we examined the thresholds of heterozygous Scn8amed/+ and Scn8amed-jo/+ mice to seizures induced by the chemiconvulsants flurothyl and KA. In addition, we explored possible genetic interactions between Scn1a and Scn8a by analyzing the seizure thresholds and lifespan of Scn1a+/–; Scn8amed-jo/+ double heterozygous mutants.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 FUNDING
 REFERENCES
 
Nav1.6 dysfunction increases seizure thresholds
To examine the effect of Nav1.6 dysfunction on seizure thresholds, Scn8amed/+, Scn8amed-jo/+, and wild-type littermates were exposed to flurothyl, a chemiconvulsant thought to inhibit GABA-mediated neurotransmission (Fig. 1) (25). The latency to the myoclonic jerk (MJ), the first observable behavioral response, and the latency to the generalized tonic-clonic seizure (GTCS) were measured. Latencies to the MJ and the GTCS were increased by 25% (P = 2.0 x 10–4) and 58% (P = 8.1 x 10–7), respectively, in Scn8amed/+ mutants when compared to wild-type littermates (Fig. 1A). Similarly, Scn8amed-jo/+ mice showed a 31% increase (P = 4.4 x 10–7) in the latency to the MJ and a 55% increase (P = 1.4 x 10–6) in the latency to the GTCS (Fig. 1B), indicating that the Scn8a mutants are more resistant to flurothyl-induced seizures.


Figure 1
View larger version (10K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. Elevated thresholds to flurothyl-induced seizures in the Scn8a mutants. The average latency in minutes to the MJ and the GTCS is shown for (A) Scn8amed/+ and (B) Scn8amed-jo/+ mutants. Gray bars, wild-type; black bars, mutant; n = 12–14 per group. Error bars represent SEM. Asterisk indicates P<0.05 when compared to wild-type littermates.

 
Seizure thresholds in response to KA, a kainate glutamate receptor agonist, were also assessed in Scn8amed/+ and Scn8amed-jo/+ mice (Fig. 2). Seizure severity was measured using a modified Racine scale in which a score of 0 indicates no response and a score of 6 indicates death (26). At a dose of 20 mg/kg KA, Scn8amed/+ mice progressed to an average seizure severity of 3.0, and no GTCS was observed. In contrast, wild-type littermates progressed to an average seizure severity of 5.0 (P=0.009), with 80% exhibiting a GTCS (P = 7.1 x 10–4) (Fig. 2A). Scn8amed/+ mice also displayed a trend toward increased seizure resistance at a dose of 30 mg/kg KA; however, the measured parameters were not statistically different when compared to wild-type littermates (data not shown). At a dose of 20 mg/kg KA, Scn8amed-jo/+ mutants progressed to an average seizure severity of 4.5, with 50% exhibiting a GTCS. Wild-type littermates reached an average seizure severity of 5.4 (P = 0.37), with 80% exhibiting a GTCS (P = 0.20) (Fig. 2B). The average seizure severity score of the Scn8amed-jo/+ mutants reflected a similar trend (P = 0.19) consistent with increased seizure resistance at a dose of 15 mg/kg KA (data not shown).


Figure 2
View larger version (21K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. Elevated thresholds to KA-induced seizures in the Scn8a mutants. The average seizure severity and the percentage of mice progressing to GTCS are shown for (A) Scn8amed/+ and (B) Scn8amed-jo/+ mutants after administration of 20 mg/kg KA. Gray bars, wild-type; black bars, mutant; n = 10–12 per group. Error bars represent SEM. Asterisk indicates P<0.05 when compared to wild-type littermates.

 
Nav1.6 dysfunction restores normal seizure thresholds in a mouse model of SMEI
A mouse model of SMEI was recently generated by targeted deletion of the mouse Scn1a gene (13). Scn1a+/– mutants exhibit spontaneous tonic-clonic seizures and reduced lifespan. In order to investigate whether the increased seizure resistance associated with Nav1.6 dysfunction could ameliorate the SMEI phenotype, we compared the thresholds to flurothyl-induced seizures in Scn1a+/– mice to Scn1a+/–; Scn8amed-jo/+ double heterozygous mutants.

The latency to the MJ in Scn1a+/– mutants was not statistically different from wild-type littermates (Fig. 3A). In contrast, the latency to the GTCS was reduced by 27% (Scn1a+/–, 4.46 ± 1.19 min; wild-type, 6.13 ± 0.69 min; P = 0.0049) (Fig. 3B). Scn1a+/– mice also displayed a more severe response with 62% of Scn1a+/– mutants progressing to tonic hind-limb extension following the GTCS, compared to only 9% of the wild-type littermates (P = 0.043) (Table 1). The latency to the MJ and the GTCS were increased by 39% (P = 0.0034) and 45% (P = 0.0017) in Scn1a+/–; Scn8amed-jo/+ mutants when compared to Scn1a+/– littermates (Fig. 3A and B). Thresholds to the GTCS in the double heterozygous mutants were comparable to that of wild-type littermates (Scn1a+/–; Scn8amed-jo/+, 6.46 ± 0.65 min; wild-type, 6.12 ± 0.41 min; P = 0.31) (Fig. 3B). The percentage of mice progressing to tonic hind-limb extension following the GTCS was reduced from 63% in Scn1a+/– mice to 0% in Scn1a+/–; Scn8amed-jo/+ mice (P = 0.026), which was similar to the incidence in wild-type littermates (Table 1). The increased threshold to flurothyl-induced GTCS and the reduced severity of the seizure response demonstrates that the Scn8amed-jo/+ mutation can rescue the seizure susceptibility of Scn1a+/– mice.


Figure 3
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3. Restoration of normal thresholds to flurothyl-induced seizures in Scn1a+/–; Scn8amed-jo/+ mutants. The average latency in minutes to the (A) MJ and (B) GTCS is shown. Gray bars, wild-type; black bars, Scn8amed-jo/+; white bars, Scn1a+/–; stripped bars, Scn1a+/–; Scn8amed-jo/+; n = 8–11 per group. Error bars represent SEM. Asterisk indicates P<0.05 when compared to wild-type littermates. Hash mark indicates P<0.05 when compared to Scn1a+/– littermates.

 


View this table:
[in this window]
[in a new window]

 
Table 1. Number of mice exhibiting tonic hind-limb extension following flurothyl-induced GTCS

 
The Scn8amed-jo mutation rescues the premature lethality of heterozygous Scn1a+/– mice
To determine if the Scn8amed-jo mutation could also improve the survival of Scn1a+/– mice, we compared the lifespan of Scn1a+/– mice to Scn1a+/–; Scn8amed-jo/+ littermates (Fig. 4A). Twelve Scn1a+/– and 10 Scn1a+/–; Scn8amed-jo/+ mutants were examined for 150 days from birth. During this time period we observed frequent spontaneous generalized seizures in the Scn1a+/– mice. A mortality rate of 40 and 100% at postnatal days 50 (P50) and 125 (P125) were noted for the Scn1a+/– mice. In contrast, no visible seizures or death was observed in Scn1a+/–; Scn8amed-jo/+ mice during the 150 day observation period (Fig. 4A).


Figure 4
View larger version (9K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4. Improved survival of Scn1a mutants with the Scn8amed-jo allele. (A) Scn1a+/–Scn8amed-jo/+ mutants. Black squares, Scn1a+/–; gray diamonds, Scn1a+/–Scn8amed-jo/+; n = 9–13 per group. (B) Scn1a–/–Scn8amed-jo/+ mutants. Black squares, Scn1a–/–; gray diamonds, Scn1a–/–Scn8amed-jo/+; n = 9–13 per group.

 
To confirm that the increased lifespan of the double heterozygous mutants was due to reduced seizure activity, we examined the electrocorticogram (ECoG) pattern of wild-type, Scn1a+/–, and Scn1a+/–; Scn8amed-jo/+ littermates (Fig. 5). ECoGs were recorded from 8 to 10 week-old freely moving mice. Scn1a+/– mice display ictal polyspike activity accompanied by stereotypic seizure behaviors with a typical duration of 15–30 s (Fig. 5B) (13). Scn1a+/–; Scn8amed-jo/+ mutants displayed frequent generalized spike and wave discharges that were associated with behavioral arrest. The average occurrences of the discharges in the Scn1a+/–; Scn8amed-jo/+ mutants were 35 and 50 per hour during the light and dark cycles, respectively. The frequencies of the discharges ranged from 2.3 to 12 Hz, with the majority of discharges occurring between 5–6 Hz. Unlike the ictal polyspike activity observed in the Scn1a+/– mice, the spike and wave discharges in the double heterozygous mutants were typically much shorter in duration (2–3 s) and did not involve a behavioral component (Fig. 5C). These brief spike and wave discharges were not observed in Scn1a+/– mice (13).


Figure 5
View larger version (54K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5. Decreased seizure severity in Scn1a+/–; Scn8amed-jo/+ mutants. Representative ECoG recordings from wild-type (n = 3), Scn1a+/– (n = 1), and Scn1a+/–; Scn8amed-jo/+ (n = 3) mice. (A) Normal ECoG pattern in an awake wild-type littermate. (B) ECoG pattern from an Scn1a+/– mutant during an ictal episode. Arrows indicate a 25 s polyspike discharge in both hemispheres accompanied by muscle activity, as indicated by the EMG channel. (C) ECoG pattern from Scn1a+/–; Scn8amed-jo/+ double heterozygous mutants. Arrows indicate brief 2–3 s spike and wave discharges in both hemispheres not associated muscle movement, as indicated by the EMG channel. Right ECoG, channel recording from the right hemisphere; Left ECoG, channel recording from the left hemisphere; EMG, channel recording from neck muscle.

 
Nav1.6 dysfunction prolongs the lifespan of homozygous Scn1a–/– mutants
We also investigated the survival of Scn1a–/– mice carrying the Scn8amed-jo mutation. Unlike homozygous Scn1a–/– mice that do not survive beyond P15, six of the nine Scn1a–/–; Scn8amed-jo/+ mutants observed survived beyond P15 (P=0.003). Three mutants died at P15, two at P16, three at P17, and one at P18 (Fig. 4B). Although the presence of the Scn8amed-jo allele was unable to rescue the premature lethality of Scn1a–/– mice, it was able to modestly improve lifespan.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 FUNDING
 REFERENCES
 
Mutations in SCN1A cause several dominant idiopathic generalized epilepsy syndromes including GEFS+ and SMEI. A prominent feature of both GEFS+ and SMEI is the variable severity of the disease phenotype. Family members carrying the same GEFS+ mutation display phenotypes ranging from childhood febrile seizures to mild or severe adult afebrile epilepsy to SMEI (11,12). This variable clinical presentation within a family suggests that genetic and/or environmental factors may modify the severity of the GEFS+ and SMEI phenotypes.

Although it is widely accepted that the clinical presentation of a disease can be influenced by genetic modifiers, only a small number of human modifier genes have been identified (2729). Studies conducted in mice with sodium channel mutations, including the Scn2aQ54, Scn8amedJ and Scn1a loss of function mutants, have demonstrated that their phenotypes can be influenced by genetic modifiers (15,3032). Genetic modifiers that influence the seizure phenotype of the Scn2aQ54 mutant have been localized to chromosomes 11 and 19 (30). The phenotype of Scn2aQ54 mice can also be altered by the Szt1 or Nmf134 mutant alleles of the potassium channel Kcnq2. Double heterozygous mutants carrying the Scn2aQ54 transgene and either Kcnq2 mutation display a more severe phenotype characterized by early onset generalized epilepsy and juvenile lethality at 3 weeks of age (33). A dramatic example of genetic modification is provided by homozygous Scn8amedJ mutants. When maintained on a C57BL/6J background, homozygous Scn8amedJ mutants exhibit premature lethality by 4 weeks of age. In contrast, on genetic backgrounds that carry a functional copy of the dominant genetic modifier Scnm1, Scn8amedJ mutants exhibit a normal lifespan (31,32). Here, we demonstrate that Scn8a can function as a modifier in a mouse model of SMEI by restoring normal seizure thresholds and improving survival. These results provide evidence for genetic modification as a mechanism by which SMEI and possibly GEFS+ phenotypes can be altered, and further supports the notion that genetic variants in one ion channel can modify the phenotype caused by a deleterious mutation in another ion channel.

Mutations in the mouse Scn8a gene result in a variety of recessive neuromuscular phenotypes, including tremor, cerebellar ataxia, dystonia and paralysis. The tremor and ataxia are believed to result from the altered biophysical properties of Purkinje cells (34,35). Purkinje cells of homozygous Scn8a mutants display reduced persistent current, reduced resurgent current and diminished spontaneous simple spikes (34,36,37). In addition, prefrontal cortex pyramidal cells and retinal ganglion cells of the homozygous Scn8amed mutants also show reduced excitability (38,39).

Scn8amed-jo/+ and Scn8amed/+ mutants exhibited comparable increases in thresholds to flurothyl-induced seizures, while Scn8amed/+ mice appeared to exhibit higher thresholds to KA-induced seizures. Electrophysiological analysis of Purkinje cells from homozygous Scn8amed and Scn8amed-jo mice revealed more pronounced defects in persistent, transient and resurgent sodium currents in the Scn8amed mutants (37). The higher threshold to KA-induced seizures observed in Scn8amed/+ mice may therefore reflect a larger effect of this mutation on neuronal excitability. However, we cannot rule out that the possibility that differences in genetic backgrounds may have contributed to this observation, since the Scn8amed and Scn8amed-jo/+ mice are maintained on the C3HeB/FeJ and C57BL/6J genetic backgrounds, respectively. In addition, loss of function Scn8a mutations, such as Scn8amed, result in cell-specific compensatory changes in which Nav1.1 or Nav1.2 channels accumulate at the nodes of Ranvier and initial segments of the cerebellum, optic nerve, cortex, and hippocampus (39). As a result, redistribution or up-regulation of sodium channel subunits in the Scn8amed/+ mutant may have also contributed to the higher threshold to KA-induced seizures.

Lower seizure thresholds and spontaneous seizures are observed in mice with reduced Scn1a expression. In contrast, Scn8amed/+mutants with reduced Scn8a expression display elevated seizure thresholds. We hypothesize that the opposing effects of Nav1.1 and Nav1.6 dysfunction on seizure thresholds are due to differences in the cell types that are influenced by these sodium channel subtypes. Support for this hypothesis is derived from the observation that GABAergic interneurons of the hippocampus and cortex, but not excitatory pyramidal cells, have reduced sodium currents in Scn1a+/– and Scn1a–/– mutants (13,15). In addition, Nav1.1 channels preferentially localize to the soma and axons of parvalbumin-positive interneurons in the hippocampus and neocortex (15). These findings suggest that the reduced excitability of interneurons in the cortex and hippocampus contribute to seizure generation in SMEI. In contrast, excitatory neuronal cell types, such as Purkinje cells, pyramidal cells of the cortex and retinal ganglion cells, are affected in Scn8a mutants. Therefore, reduced excitability of pyramidal cells in the hippocampus and cortex in Scn8a mutants may underlie the elevated seizure resistance of these mice.

The Scn8amed-jo allele was also capable of restoring normal thresholds to flurothyl-induced seizures in Scn1a+/–; Scn8amed-jo/+ double heterozygous mice. Since the mechanism of action of flurothyl is not fully understood, we also evaluated the double heterozygous mutants for more physiologically relevant indicators of improved neuronal excitability. Unlike Scn1a+/– mice that display frequent spontaneous seizures with stereotypic motor behaviors and a reduced lifespan, no mortality or seizures were observed in the double heterozygous mutants. Scn1a+/– mutants also display excessive jumping and erratic behavior in response to mild startle. Whether this hyper-responsive behavior reflects seizure activity is unclear; however, this behavioral abnormality was not observed in the double heterozygous mutants.

In the presence of the Scn8amed-jo allele, a modest improvement in the lifespan of Scn1a–/– mice was also observed. Interestingly, the increase in lifespan is similar to that achieved by manual feeding of Scn1a–/– mutants (13). The incomplete rescue of the premature lethality of Scn1a–/– mice suggests that there is a limit to the magnitude of the abnormal neuronal excitability that can be corrected by altered Nav1.6 function. It is also possible that the level of expression of Scn8a in neonatal pups may be insufficient to restore normal neuronal excitability in pups that lack Nav1.1 channels. Alternatively, Nav1.1 channels may play a unique role in one or more biological processes that are necessary for survival. Consistent with this possibility is the observation that SCN1A mutations in humans are dominant and individuals with two mutant SCN1A alleles have not been identified.

The findings of this study indicate that Scn8a can function as a genetic modifier of SMEI. Together with previous studies showing genetic interactions between Scn2a and Kcnq2 in mouse epilepsy (32), our results support the idea that genetic testing for mutations and single nucleotide polymorphisms in a panel of selected ion channel genes might provide useful clinical information to guide treatment of generalized epilepsy. Furthermore, our results suggest that blocking Nav1.6 channels may be one of the therapeutic benefits of currently used non-selective sodium channel-blocking anti-epileptic drugs, and raises the possibility that selective blocking of Nav1.6 channels may improve efficacy in patients with epilepsy. Although pharmacological agents that can selectively target sodium channel subtypes are currently unavailable, new methodologies, such as the development of siRNAs against SCN8A, may enable the selective targeting of Nav1.6 channels in the future. Additional studies using mice with different forms of epilepsy will also provide the opportunity to evaluate the ability of Scn8a to ameliorate seizure severity in more common types of epilepsy.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 FUNDING
 REFERENCES
 
Animals
C3HeB/FeJ-Scn8amed/J and C57BL/6J-Scn8amed-jo/J male mice were purchased from the Jackson Laboratory, Bar Harbor and maintained on C3HeB/FeJ and C57BL/6J backgrounds, respectively. Scn1a+/– mice were maintained on a FVB/NJ background. To generate Scn1a+/–; Scn8amed-jo/+ double heterozygous mutants, Scn8amed-jo/+ females were crossed to Scn1a+/– males. Expected Mendelian ratios were observed (23% Scn1a+/–; Scn8amed-jo/+, 27% Scn1a+/–, 27% Scn8amed-jo/+, 23% wild-type). To generate Scn1a–/–; Scn8amed-jo/+ mice, Scn1a+/–; Scn8amed-jo/+ females were crossed to Scn1a+/– males. Expected Mendelian ratios were observed (29% Scn1a+/–; Scn8amed-jo/+, 24% Scn1a+/–, 16% Scn1a–/–; Scn8amed-jo/+, 12% Scn1a–/–, 8% Scn8amed-jo/+, 12% wild-type). Littermates were used for all experiments to minimize variation due to differences in genetic backgrounds. Mice were reared in a pathogen-free mouse facility with a 12 h light/dark cycle. Food and water were available ad libitum. All experimental protocols involving mice were approved by the Emory University IACUC committee.

Genotyping of mice
Scn1a mutants were genotyped using primers pairs specific to the neomycin cassette; NF (AGGATCTCCTGTCATCTCACCTTGCTCCTG), NR (AAGAACTCGTCAAGAAGGCGATAGAAGGCG) and to Scn1a exon 26; 1aF (CGAATCCAGATGGAAGAGCGGTTCATGGCT), 1aR (ACAAGCTGCTATGGACATTGTCAGGTCAGT). A 290 bp PCR product was generated from the wild-type allele and a 490 bp PCR product was generated from the mutant allele using the primer pairs 1aF, 1aR and NF, NR, respectively. PCR amplification was carried out with one cycle at 94°C for 2 min and 32 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 45 s. Genotyping of C3HeB/FeJ-Scn8amed/J mice was performed with PCR primers and conditions suggested by the Jackson Laboratory (http://jaxmice.jax.org/pub-cgi/protocols/protocols.sh?objtype=protocol&protocol_id=454). Genotyping of C57BL/6J-Scn8amed-jo/J mice was performed using primer pair, 8aF (ATGCCACAGAAGTGTCATTCC) and 8aR (GGTATTTCCCAGCAAACAGGT). PCR amplification was performed with one cycle at 94°C for 2 min and 32 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 30 s. The 204 bp PCR product was digested with MslI to produce a 129 bp fragment from the wild-type allele and a 102 bp fragment from the mutant allele.

Flurothyl seizure induction
Mice between 5 and 12 weeks of age were placed in a clear plexiglass chamber, and flurothyl (2,2,2-trifluroethylether) (Sigma-Aldrich) was slowly introduced into the chamber via a syringe pump at a rate of 20 µl/min and allowed to volatilize. Seizure thresholds were determined by measuring the latency to the first MJ and to the GTCS. The MJ is the first observable behavioral response, and is characterized by a brief jerk of the shoulders and/or neck. The GTCS is characterized by convulsions of the entire body and a loss of posture. The mice were also scored for progression of the GTCS to tonic hind-limb extension. Data from males and females were analyzed separately. No sex differences in the data were observed; therefore, the data from both sexes were combined.

KA seizure induction
Mice between 3 and 4 months of age were injected intraperitoneally (i.p.) with 15, 20 or 30 mg/kg KA (Ocean Produce International). KA was dissolved in 0.9% saline to a concentration of 2.5 mg/ml in order to obtain an appropriate injection volume. All mice were injected between 12 noon and 4 p.m. to minimize behavioral variation due to the circadian rhythm. After the injection of KA, mice were observed for 2 h and scored according to a modified Racine scale (26). This modified scale is based on the following criteria: stage 0 – no response; stage 1 – staring; stage 2 – head nodding; stage 3 – forelimb clonus; stage 4 – rearing and falling; stage 5 – GTCS; stage 6 – death. Data from males and females were analyzed separately. No sex differences in the data were observed; therefore, the data from both sexes were combined.

Statistical analysis
For parametric data sets, statistical analysis between genotypes was performed using the Student t-test. Dichotomous data sets (the number of mice exhibiting a GTCS and the mortality rates) were analyzed for statistical significance using the Fisher Exact test, while non-parametric data (the KA seizure stage) was analyzed using a Mann–Whitney Rank Sum test.

Electrocorticography
Wild-type, Scn1a+/–, and Scn1a+/–; Scn8amed-jo mice were implanted for ECoG recordings. Briefly, mice were anesthetized with isoflurane gas and placed onto a stereotaxic frame (Cartesian Research, OR, USA). Two pairs of bipolar stainless steel screws were placed ipsilaterally for ECoG monitoring. One pair on the right hemisphere (anteroposterior (AP) = +2.00 mm from bregma, mediolateral (ML) = +1.00 mm from midline; AP =–1.5 mm from bregma, ML = +1.0 mm from midline) and the other pair on the left hemisphere (AP = –0.5 mm from bregma, ML = –2.2 mm from midline; AP = –3.5 mm from bregma, ML = –2.2 mm from midline). In addition, two fine wires (Cooner AS632, CA, USA) were inserted into the dorsal neck muscles to facilitate recording of muscle activity. ECoG and electromyogram (EMG) electrodes were attached to a micro-connector (VMS, OH, USA), and dental ceramic compound was poured over the screws, wires and base of the skullcap.

After 3 days of recovery, each mouse was placed into a Plexiglas box (15 cm  x  15 cm  x  15 cm) and was attached to a series of bioelectric amplifiers (Embla A10, Iceland) via a small counterbalanced commutator (Dragonfly Research, WV, USA). Following 24 h of acclimatization, ECoG and EMG data were collected for 96 h. Amplified ECoG and EMG signals were digitally collected, processed and viewed in real-time with the Somnologica Science rodent sleep-recording software package (Iceland). Epileptiform activity was manually scored.


    FUNDING
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 FUNDING
 REFERENCES
 
National Institutes of Health (NS046484 and NS051834 to A.E.).


    ACKNOWLEDGEMENTS
 
We are grateful to Dr Sandra Helmers and Joshua Ehrenberg for assistance with the interpretation of the mouse ECoG data, and to Dr David Weinshenker and Kroshona Tabb for assistance with the flurothyl and kainic acid seizure induction paradigms. We would also like to thank Dr Allan Levey, Dr Glenda Keating, Dr Michael Decker and Gillian Hue for facilitating the experiments that were conducted in the Woodruff Memorial Research Building, Emory University.

Conflict of Interest statement. None declared.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 FUNDING
 REFERENCES
 

  1. Catterall W.A. From ionic currents to molecular mechanisms: the structure and function of voltage-gated sodium channels. Neuron (2000) 26:13–25.[CrossRef][Web of Science][Medline]

  2. Goldin A.L. Diversity of mammalian voltage-gated sodium channels. Ann. NY Acad. Sci. (1999) 868:38–50.[CrossRef][Web of Science][Medline]

  3. Westenbroek R.E., Merrick D.K., Catterall W.A. Differential subcellular localization of the RI and RII Na+ channel subtypes in central neurons. Neuron (1989) 3:695–704.[CrossRef][Web of Science][Medline]

  4. Beckh S., Noda M., Lubbert H., Numa S. Differential regulation of three sodium channel messenger RNAs in the rat central nervous system during development. EMBO J. (1989) 8:3611–3616.[Web of Science][Medline]

  5. Tzoumaka E., Tischler A.C., Sangameswaran L., Eglen R.M., Hunter J.C., Novakovic S.D. Differential distribution of the tetrodotoxin-sensitive rPN4/NaCh6/Scn8a sodium channel in the nervous system. J. Neurosci. Res. (2000) 60:37–44.[CrossRef][Web of Science][Medline]

  6. Sugawara T., Tsurubuchi Y., Agarwala K.L., Ito M., Fukuma G., Mazaki-Miyazaki E., Nagafuji H., Noda M., Imoto K., Wada K., et al. A missense mutation of the Na+ channel alpha II subunit gene Na(v)1.2 in a patient with febrile and afebrile seizures causes channel dysfunction. Proc. Natl. Acad. Sci. USA (2001) 98:6384–6389.[Abstract/Free Full Text]

  7. Escayg A., MacDonald B.T., Meisler M.H., Baulac S., Huberfeld G., An-Gourfinkel I., Brice A., LeGuern E., Moulard B., Chaigne D., et al. Mutations of SCN1A, encoding a neuronal sodium channel, in two families with GEFS+2. Nat. Genet. (2000) 24:343–345.[CrossRef][Web of Science][Medline]

  8. Heron S.E., Crossland K.M., Andermann E., Phillips H.A., Hall A.J., Bleasel A., Shevell M., Mercho S., Seni M.H., Guiot M.C., et al. Sodium-channel defects in benign familial neonatal-infantile seizures. Lancet (2002) 360:851–852.[CrossRef][Web of Science][Medline]

  9. Claes L., Del-Favero J., Ceulemans B., Lagae L., Van Broeckhoven C., De Jonghe P. De novo mutations in the sodium-channel gene SCN1A cause severe myoclonic epilepsy of infancy. Am. J. Hum. Genet. (2001) 68:1327–1332.[CrossRef][Web of Science][Medline]

  10. Ohmori I., Kahlig K.M., Rhodes T.H., Wang D.W., George A.L. Jr. Nonfunctional SCN1A is common in severe myoclonic epilepsy of infancy. Epilepsia (2006) 47:1636–1642.[CrossRef][Web of Science][Medline]

  11. Singh R., Andermann E., Whitehouse W.P., Harvey A.S., Keene D.L., Seni M.H., Crossland K.M., Andermann F., Berkovic S.F., Scheffer I.E. Severe myoclonic epilepsy of infancy: extended spectrum of GEFS+? Epilepsia (2001) 42:837–844.[CrossRef][Web of Science][Medline]

  12. Meisler M.H., Kearney J.A. Sodium channel mutations in epilepsy and other neurological disorders. J. Clin. Invest. (2005) 115:2010–2017.[CrossRef][Web of Science][Medline]

  13. Yu F.H., Mantegazza M., Westenbroek R.E., Robbins C.A., Kalume F., Burton K.A., Spain W.J., McKnight G.S., Scheuer T., Catterall W.A. Reduced sodium current in GABAergic interneurons in a mouse model of severe myoclonic epilepsy in infancy. Nat. Neurosci. (2006) 9:1142–1149.[CrossRef][Web of Science][Medline]

  14. Kalume F., Yu F.H., Catterall W.A., Scheuer T. Na current in Purkinje neurons from Nav1.1(–/–) mice: implications for resurgent current and ataxia. Society for Neuroscience Conference, Washington D.C. (2005).

  15. Ogiwara I., Miyamoto H., Morita N., Atapour N., Mazaki E., Inoue I., Takeuchi T., Itohara S., Yanagawa Y., Obata K., et al. Na(v)1.1 localizes to axons of parvalbumin-positive inhibitory interneurons: a circuit basis for epileptic seizures in mice carrying an Scn1a gene mutation. J. Neurosci. (2007) 27:5903–5914.[Abstract/Free Full Text]

  16. Trudeau M.M., Dalton J.C., Day J.W., Ranum L.P., Meisler M.H. Heterozygosity for a protein truncation mutation of sodium channel SCN8A in a patient with cerebellar atrophy, ataxia, and mental retardation. J. Med. Genet. (2006) 43:527–530.[Abstract/Free Full Text]

  17. Sidman R.L., Cowen J.S., Eicher E.M. Inherited muscle and nerve diseases in mice: a tabulation with commentary. Ann. NY Acad. Sci. (1979) 317:497–505.[CrossRef][Medline]

  18. Dick D.J., Boakes R.J., Candy J.M., Harris J.B., Cullen M.J. Cerebellar structure and function in the murine mutant ‘jolting’. J. Neurol. Sci. (1986) 76:255–267.[CrossRef][Web of Science][Medline]

  19. Kohrman D.C., Smith M.R., Goldin A.L., Harris J., Meisler M.H. A missense mutation in the sodium channel Scn8a is responsible for cerebellar ataxia in the mouse mutant jolting. J. Neurosci. (1996) 16:5993–5999.[Abstract/Free Full Text]

  20. Duchen L.W. Hereditary motor end-plate disease in the mouse: light and electron microscopic studies. J. Neurol. Neurosurg. Psychiatry (1970) 33:238–250.[Free Full Text]

  21. Kohrman D.C., Harris J.B., Meisler M.H. Mutation detection in the med and medJ alleles of the sodium channel Scn8a. Unusual splicing due to a minor class AT-AC intron. J. Biol. Chem. (1996) 271:17576–17581.[Abstract/Free Full Text]

  22. Kohrman D.C., Plummer N.W., Schuster T., Jones J.M., Jang W., Burgess D.L., Galt J., Spear B.T., Meisler M.H. Insertional mutation of the motor endplate disease (med) locus on mouse chromosome 15. Genomics (1995) 26:171–177.[CrossRef][Web of Science][Medline]

  23. Burgess D.L., Kohrman D.C., Galt J., Plummer N.W., Jones J.M., Spear B., Meisler M.H. Mutation of a new sodium channel gene, Scn8a, in the mouse mutant ‘motor endplate disease’. Nat. Genet. (1995) 10:461–465.[CrossRef][Web of Science][Medline]

  24. Woodruff-Pak D.S., Green J.T., Levin S.I., Meisler M.H. Inactivation of sodium channel Scn8A (Na-sub(v)1.6) in Purkinje neurons impairs learning in Morris water maze and delay but not trace eyeblink classical conditioning. Behav. Neurosci. (2006) 120:229–240.[CrossRef][Web of Science][Medline]

  25. Hashimoto Y., Araki H., Suemaru K., Gomita Y. Effects of drugs acting on the GABA-benzodiazepine receptor complex on flurothyl-induced seizures in Mongolian gerbils. Eur. J. Pharmacol. (2006) 536:241–247.[CrossRef][Web of Science][Medline]

  26. Racine R.J. Modification of seizure activity by electrical stimulation. II. Motor seizure. Electroencephalogr. Clin. Neurophysiol. (1972) 32:281–294.[CrossRef][Web of Science][Medline]

  27. Heydemann A., Doherty K.R., McNally E.M. Genetic modifiers of muscular dystrophy: implications for therapy. Biochim. Biophys. Acta (2007) 1772:216–228.[Medline]

  28. Smith J.D., Topol E.J. Identification of atherosclerosis-modifying genes: pathogenic insights and therapeutic potential. Expert Rev. Cardiovasc. Ther. (2006) 4:703–709.[CrossRef][Medline]

  29. Steinberg M.H., Adewoye A.H. Modifier genes and sickle cell anemia. Curr. Opin. Hematol. (2006) 13:131–136.[Medline]

  30. Bergren S.K., Chen S., Galecki A., Kearney J.A. Genetic modifiers affecting severity of epilepsy caused by mutation of sodium channel Scn2a. Mamm. Genome (2005) 16:683–690.[CrossRef][Web of Science][Medline]

  31. Sprunger L.K., Escayg A., Tallaksen-Greene S., Albin R.L., Meisler M.H. Dystonia associated with mutation of the neuronal sodium channel Scn8a and identification of the modifier locus Scnm1 on mouse chromosome 3. Hum. Mol. Genet. (1999) 8:471–479.[Abstract/Free Full Text]

  32. Buchner D.A., Trudeau M., Meisler M.H. SCNM1, a putative RNA splicing factor that modifies disease severity in mice. Science (2003) 301:967–969.[Abstract/Free Full Text]

  33. Kearney J.A., Yang Y., Beyer B., Bergren S.K., Claes L., Dejonghe P., Frankel W.N. Severe epilepsy resulting from genetic interaction between Scn2a and Kcnq2. Hum. Mol. Genet. (2006) 15:1043–1048.[Abstract/Free Full Text]

  34. Levin S.I., Khaliq Z.M., Aman T.K., Grieco T.M., Kearney J.A., Raman I.M., Meisler M.H. Impaired motor function in mice with cell-specific knockout of sodium channel Scn8a (NaV1.6) in cerebellar purkinje neurons and granule cells. J. Neurophysiol. (2006) 96:785–793.[Abstract/Free Full Text]

  35. Levin S.I., Meisler M.H. Floxed allele for conditional inactivation of the voltage-gated sodium channel Scn8a (NaV1.6). Genesis (2004) 39:234–239.[CrossRef][Web of Science][Medline]

  36. Harris J.B., Boakes R.J., Court J.A. Physiological and biochemical studies on the cerebellar cortex of the murine mutants ‘jolting’ and ‘motor end-plate disease’. J. Neurol. Sci. (1992) 110:186–194.[CrossRef][Web of Science][Medline]

  37. Raman I.M., Sprunger L.K., Meisler M.H., Bean B.P. Altered subthreshold sodium currents and disrupted firing patterns in Purkinje neurons of Scn8a mutant mice. Neuron (1997) 19:881–891.[CrossRef][Web of Science][Medline]

  38. Maurice N., Tkatch T., Meisler M., Sprunger L.K., Surmeier D.J. D1/D5 dopamine receptor activation differentially modulates rapidly inactivating and persistent sodium currents in prefrontal cortex pyramidal neurons. J. Neurosci. (2001) 21:2268–2277.[Abstract/Free Full Text]

  39. Van Wart A., Matthews G. Impaired firing and cell-specific compensation in neurons lacking nav1.6 sodium channels. J. Neurosci. (2006) 26:7172–7180.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Hum Mol GenetHome page
L. A. Papale, B. Beyer, J. M. Jones, L. M. Sharkey, S. Tufik, M. Epstein, V. A. Letts, M. H. Meisler, W. N. Frankel, and A. Escayg
Heterozygous mutations of the voltage-gated sodium channel SCN8A are associated with spike-wave discharges and absence epilepsy in mice
Hum. Mol. Genet., May 1, 2009; 18(9): 1633 - 1641.
[Abstract] [Full Text] [PDF]


Home page
J Child NeurolHome page
J. H. Livingston, J. H. Cross, A. Mclellan, R. Birch, and S. M. Zuberi
A Novel Inherited Mutation in the Voltage Sensor Region of SCN1A Is Associated With Panayiotopoulos Syndrome in Siblings and Generalized Epilepsy With Febrile Seizures Plus
J Child Neurol, April 1, 2009; 24(4): 503 - 508.
[Abstract] [PDF]


Home page
Arch NeurolHome page
S. A. Mullen and I. E. Scheffer
Translational Research in Epilepsy Genetics: Sodium Channels in Man to Interneuronopathy in Mouse
Arch Neurol, January 1, 2009; 66(1): 21 - 26.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
W. A. Catterall, S. Dib-Hajj, M. H. Meisler, and D. Pietrobon
Inherited Neuronal Ion Channelopathies: New Windows on Complex Neurological Diseases
J. Neurosci., November 12, 2008; 28(46): 11768 - 11777.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
M. Royeck, M.-T. Horstmann, S. Remy, M. Reitze, Y. Yaari, and H. Beck
Role of Axonal NaV1.6 Sodium Channels in Action Potential Initiation of CA1 Pyramidal Neurons
J Neurophysiol, October 1, 2008; 100(4): 2361 - 2380.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/23/2892    most recent
ddm248v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Martin, M. S.
Right arrow Articles by Escayg, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martin, M. S.
Right arrow Articles by Escayg, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?