Human Molecular Genetics Advance Access originally published online on January 12, 2007
Human Molecular Genetics 2007 16(5):499-514; doi:10.1093/hmg/ddl482
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Stat5 constitutive activation rescues defects in spinal muscular atrophy
1 Institute of Biochemistry and Molecular Biology, 2 Faculty Life Sciences and Institute of Genome Sciences, National Yang-Ming University, Taipei 112, Taiwan, 3 Institute of Molecular Biology, Academia Sinica, Taipei 115, Taiwan and 4 Department of Life Science, National Taiwan Normal University, Taipei 106, Taiwan
* To whom correspondence should be addressed. Tel: +886 227880460; Fax: +886 22782 6085; Email: hungli{at}ccvax.sinica.edu.tw
Received October 3, 2006; Revised November 27, 2006; Accepted December 23, 2006
| ABSTRACT |
|---|
|
|
|---|
Proximal spinal muscular atrophy (SMA) is a motor neuron degeneration disorder for which there is currently no effective treatment. Here, we report three compounds (sodium vanadate, trichostatin A and aclarubicin) that effectively enhance SMN2 expression by inducing Stat5 activation in SMA-like mouse embryonic fibroblasts and human SMN2-transfected NSC34 cells. We found that Stat5 activation enhanced SMN2 promoter activity with increase in both full-length and deletion exon 7 SMN transcripts in SMN2-NSC34 cells. Knockdown of Stat5 expression disrupted the effects of sodium vanadate on SMN2 activation but did not influence SMN2 splicing, suggesting that Stat5 signaling is involved in SMN2 transcriptional regulation. In addition, constitutive activation of Stat5 mutant (Stat5A1*6) profoundly increased the number of nuclear gems in SMA-patient lymphocytes and reduced SMA-like motor neuron axon outgrowth defects. These results demonstrate that Stat5 signaling could be a possible pharmacological target for treating SMA.
| INTRODUCTION |
|---|
|
|
|---|
Proximal spinal muscular atrophy (SMA) is an autosomal recessive disease characterized by degeneration of the anterior horn cells of the spinal cord. It is divided into three types based on clinical severity and age of onset (1). Two survival motor neuron (SMN) genes are typically present on chromosome 5q13: SMN1 (SMNT) and SMN2 (SMNC). Loss-of-function mutations of both copies of the telomeric gene, SMN1, are correlated with the development of SMA (25). The nearly identical centromeric gene SMN2, which is typically not mutated in SMA, appears to modify disease severity according to the amount of full-length protein it produces, since SMN protein levels from this gene are correlated with disease severity. However, the expressed amount of intact SMN protein from SMN2 does not provide adequate protection from SMA (4,68). The differences between SMN1 and SMN2 lie in their RNA expression patterns (911). Most SMN2 transcripts lack exon 3, 5 or most frequently 7, with only a small amount of full-length mRNA generated. In contrast, the SMN1 gene expresses mostly full-length mRNA, with only a small fraction of its transcripts spliced to remove exon 3, 5, or 7 (2,12). Recent studies have also shown that an AG-rich exonic splice enhancer in the center of SMN exon 7 is required for constitutive inclusion of exon 7 (13,14) and contributes to the production of a small amount of full-length SMN2 transcripts. Clearly, SMN protein is a critical SMA determinant, and the amount of SMN protein expressed correlates with the severity of pathologies in human SMA patients and SMA mouse models (6,7,15,16).
A major issue in SMA pathology is why the SMN protein level is high in all organs but much lower in the spinal cord relative to other tissue under SMA conditions. This decrease in SMN production in the spinal cord may be accounted for by differences in transcriptional and/or tissue-specific regulation of SMN promoters (17). Several cis-elements have been investigated including the region that is responsive to (ß- and
-interferon (IFN) and the IRF-1 transcription factor. In addition, enhanced SMN expression in IFN-treated SMA patient fibroblasts supports the expectation that up-regulation of SMN expression represents a potential therapeutic target (1820). N-methyl-D-aspartate glutamate receptor stimulation (21) was also found to up-regulate SMN expression in rat cerebellar granule cells; however, the underlying mechanism responsible for this response remains unclear.
At present, no cure for SMA is available. However, in the search for effective therapies, SMA has an advantage over other diseases in that SMN2 is still present in patients and provides a natural target for therapeutic intervention. One approach to the treatment of SMA is to augment SMN protein levels, either by preventing exon 7 skipping in SMN2 transcripts or by increasing overall transcription from the SMN2 locus. Much work has already been done to identify factors, chemical compounds or other strategies that can be used to either suppress the exclusion of SMN2 exon 7 or enhance SMN2 expression (14,18,19,2229). Among these, one group of chemicals identified, which includes sodium butyrate (23), valproic acid (VPA, 2-propylpentanoic acid) (24,25) and sodium phenylbutyrate (2628) are histone deacetylase (HDAC) inhibitors, suggesting that drugs in this category may share certain signaling pathways. In addition to the HDAC inhibitors, aclarubicin (22) and sodium vanadate (29) have also been shown to restore correct SMN2 splicing pattern, and sodium vanadate is the first compound to have been found that can change the endogenous SMN2 splicing pattern. Sodium vanadate has been used clinically for the treatment of diabetes (30,31). It mimics the NGF-induced neuroprotective signaling pathway (32) and is believed to promote neuronal survival (33). In order to identify the common molecular pathway involved in the drugs inducing the expression of SMN2 locus, and to look for a better target for the treatment of SMA, we selected five known compounds [sodium butyrate, sodium vanadate, trichostatin A (TSA), aclarubicin, hydroxyurea] which we had previously tested and we knew to influence SMN2 expression in type I SMA patient-derived lymphocytes and tested them in SMA-like mouse embryonic fibroblasts (MEFs). We excluded sodium butyrate and hydroxyurea from subsequent tests due to their necessity for an excessive dosage or inefficiency in treating SMA-like MEFs and focused on TSA (an HDAC inhibitor) (34), aclarubicin (a topoisomerase II inhibitor) (35) and sodium vanadate (a tyrosine phosphatase inhibitor) (36) which were effective in treating SMA-like MEFs. We further analyzed the effect of TSA, aclarubicin and sodium vanadate treatment in an intact human SMN2 (35.5 kb)-transfected NSC34 cell. The experiment revealed results similar to the results obtained with SMA-like MEFs and demonstrated that the three compounds can also influence SMN2 expression in motor neurons. Because sodium vanadate is a well-known protein tyrosine phosphatase (PTP) inhibitor and was also the most effective compound in treating cells, we decided to screen a series of signaling molecules that are involved in tyrosine phosphorylation and the receptor tyrosine kinase (RTK) cascade and its downstream transcription factors. We found that TSA, aclarubicin and sodium vanadate all induce the activation of Stat5 (signal transducers and activators of transcription 5) in the motor neuron-like NSC34 cell. Stat5A was first identified as a mammary gland factor. Subsequent analysis showed that there were actually two closely related genes, Stat5A and Stat5B. Knockout of mouse double Stat5 gene led to defects in mammary gland development, T-cell proliferation, reduced levels of IGF-1 (insulin-like growth factor-1) and death within a few weeks of birth (3745). It is currently unknown whether Stat5 is involved in SMN regulation; however, an IFN response element (IRE) is included in SMN2 promoter, and a previous study (18) indicated that SMN level is increased by treating SMA patient-derived fibroblasts with ß- and
-IFN, suggesting the possibility that SMN2 could be a downstream target for cytokine stimulating factors, such as Stat family proteins.
Constitutive expression of activated Stat5 mutant (Stat5A1*6) (46) can increase SMN2 expression, suggesting that Stat5 might be a common target for drug-induced SMN2 expression. Furthermore, activation of Stat5A (Stat5A1*6) profoundly increased the number of nuclear gems in SMA patient lymphocytes and enhanced axon outgrowth in primary cultured SMA-like motor neurons. Our results demonstrate that the Stat5 signaling pathway may contribute to a pharmacological treatment of SMA by transcription activation of SMN2, and therefore Stat5 signaling might be a therapeutic target for SMA therapy.
| RESULTS |
|---|
|
|
|---|
Three known compounds influence SMN2 expression in fibroblast and neuronal cells
In order to test whether different selective compounds can influence SMN2 expression in different cell lines, we used SMA-like MEFs (Smn/, SMN2) (SMN2 copy number = 3 as determined by semi-quantification PCR) to mimic type I SMA patients for the first round screening and SMN2 (35.5 kb) transfected motor neuron-like NSC34 cells (SMN2-NSC34) for the second round screening. Following a series of time-course RTPCR analyses, sodium vanadate, TSA and aclarubicin were all found to influence SMN2 expression in SMA-like MEFs (Table 1, Fig. 1AC). The three compounds were further tested in SMN2-NSC34 cells and the results were similar to those found in treating SMA-like MEFs (Table 1, Fig. 1DF). The full-length SMN2 expression level was enhanced after treatment with sodium vanadate for 24 h (Fig. 1A and D; data not shown) and the other two compounds for 48 h (Fig. 1B, C, E and F). Although the three compounds were all effective, sodium vanadate seemed to be most efficient because the time taken for the full-length SMN2 transcript to increase was the fastest and the relative increase of full-length SMN2 transcripts was greater than with TSA or aclarubicin. These results suggest that these three compounds may activate similar mechanisms involved in SMN2 expression in both fibroblasts and neuronal cells.
|
|
Stat5 was activated by treatment with sodium vanadate, TSA and aclarubicin in SMN2-NSC34 cells
Sodium vanadate is known as a PTP inhibitor; we were therefore interested in whether the regulation of PTPs is involved in stimulation of SMN2. In addition, inhibition of PTP signaling may conversely increase tyrosine kinase activity and it is well known that src homology 2 (SH2) domain-containing proteins mediate the signaling pathways of RTKs (47). Previous studies have also identified some cis-elements in SMN2 promoter, including IRE, and
-IFN treatment in SMA-patient-derived fibroblasts increased SMN expression (18,19). Stat family proteins that are phosphorylated at tyrosine residues activate SH2-mediated dimerization followed by rapid nuclear translocation. Stat proteins form homo- or heterodimers that recognize IRE or GAS elements (
-IFN-activated sequence) in the promoter region (48). Together, these findings suggest that SH2 domain-mediated signal transduction and its downstream molecules, such as Stat family proteins, may also be influenced after treatment with tyrosine phosphatase inhibitors. To test whether any potential drug-inducible target is involved in regulation of SMN2, we screened factors involved in tyrosine phosphorylation, downstream signal transduction molecules and other related proteins in SMN2-NSC34 cells (Supplementary Material, Table S1). Time course analysis of the treatment of the three different compounds in SMN2-NSC34 cells showed that after treatment with sodium vanadate for 24 h, or TSA or aclarubicin for 4 h, the phosphorylation level of Stat5 was increased and remained activated at 8 h (Fig. 2AC). Jak2, an upstream protein kinase of Stat5, was also activated at 24 h after sodium vanadate treatment (Fig. 2A) suggesting that sodium vanadate treatment activates the Jak2/Stat5 signaling pathway in neuronal cells. Other Stat family proteins were also influenced, but the level of any effects was lower than the activation of Stat5 (Supplementary Material, Figure S1). TSA and aclarubicin also induced Jak2 phosphorylation at 4 h, but this did not last 8 h (Fig. 2B and C).
|
The Stat5 signal transduction pathway influences SMN2 expression
To further test whether phospho-Stat5 expression influenced SMN2 expression, we constructed a constitutively activated Stat5A mutant (Stat5A1*6) and transfected it into SMN2-NSC34 cells. Surprisingly, the results showed that both full-length and deletion exon 7 SMN2 transcripts increased (Fig. 3A). Analysis of SMN2 expression by semi-quantitive RTPCR showed SMN2 transcripts significantly increased 1.8-fold (4 µg Stat5A1*6) and 2.2-fold (2 µg of Stat5A1*6) when SMN2-NSC34 cells were transfected with Stat5A1*6 (Fig. 3B). It is worth noting that SMN2 splicing pattern was not changed, suggesting that Stat5 does not influence the SMN2 alternative splicing. To further confirm whether Stat5 can regulate SMN2 activity, a 5.4 kb SMN2 promoter-derived luciferase expression vector was generated and co-transfected with Stat5A1*6 into the NSC34 cells. The results showed that the luciferase activity increased 3-fold (11.04 ± 0.697 to 45.59 ± 10.24) when Stat5A1*6 was expressed (Fig. 3C). Furthermore, we analyzed SMN expression level in a dosage-dependent increase of Stat5A1*6 over-expressed SMN2-NSC34 cell through western blot analyses. The result showed that SMN protein level significantly increased 2.6 and 4.6-fold (Fig. 3D). These results are consistent with the previous result showing that the full-length SMN2 transcript increased.
|
To further investigate whether SMN may be a downstream target for Stat5 recognition, we analyzed the promoter sequence of both murine and human SMN gene. Sequence analysis showed two conserved Stat5 binding sites (TTCNNNGAA/ TTCNNNTAA) in murine Smn promoter (NCBI accession no. AF027668 [GenBank] ). However, no Stat5 conserved binding site could be found in human SMN2 promoter (NCBI accession no. AF027688 [GenBank] ). In addition, an element (CTCNNNTAA) that was similar to the Stat5 binding site appeared three times in SMN2 promoter, the locations are 413 to 409 bp, 2338 to 2330 bp and 3881 to 3873 bp downstream of the SMN2 start codon (+1). We therefore tested whether Stat5 has binding capacity to the predicted binding site in the SMN2 promoter by an EMSA alternative assay. We induced Stat5 activity by treating SMN2-NSC34 with sodium vanadate for 5 h. Nuclear extracts (3 and 6 µl) from NSC34 cells with and without sodium vanadate treatment were first incubated with the double strand 3'-biotinylated putative Stat5 recognition sequence (CCCAGTCTCTACTAAATACAA) and then the DNAprotein complex identified with the phospho-Stat5 antibody. In the absence of sodium vanadate treatment, the signal-to-background ratio was 2.13:1. When the cells were treated with sodium vanadate, the ratio increased to 3.34:1 (Fig. 4A). To measure the protein concentration dependence of the binding assay, we performed the experiment with increasing amounts of sodium vanadate induced SMN2-NSC34 cell nuclear extract. The result showed linearity between 0.1 and 8.1 µl of nuclear extract (0.8 and 64.8 µg) (Fig. 4B). In addition, competition analysis was performed to further determine the sequence specificity of Stat5 to the putative Stat5 binding site in the SMN2 promoter. Both non-biotinylated specific competitor (same sequence as the normal oligonucleotide) and Stat5 consensus competitor (AGATTTCTAGGAATTC AATCC) effectively competed for Stat5 binding to the putative Stat5 binding site. The signal-to-background ratios of 3.11:1 (Fig. 4C) and 2.5:1 (Fig. 4D) were achieved in the absence of competitor. When a 2.540-fold molar excess of biotinylated specific competitor was added, the signal-to-background ratio was 1.32:1 (Fig. 4C). Addition of 540 ng Stat5 consensus competitor considerably decreased the signal-to-background ratio to 1.11:1 (Fig. 4D). Moreover, neither non-specific competitor, transcription factor SP1 consensus binding oligonucleotide (GCTCGCCCCGCCC CGATCGAAT), nor a mutated, non-biotinylated Stat5 putative SMN2 binding sequence (CCCAGTCTTTACTTAATACAA) disrupted the binding affinity. The signal-to-background ratios were 3.68:1 to 3.36:1 (SP1) and 3.58:1 to 3.31:1 (Fig. 4E and F). These results suggest that Stat5 may regulate SMN2 expression by recognizing the putative Stat5 binding site.
|
Knockdown Stat5 did not block SMN2 exon 7 inclusion
To further evaluate the potential role of Stat5 in SMN2 regulation, we used Stat5A dsRNA to knockdown the endogenous Stat5 expression (Fig. 5A) prior to sodium vanadate treatment in SMN2-NSC34 cells. It is clear that SMN level decreased 1.72-fold after Stat5A dsRNA treatment for 48 h (Fig. 5A, lanes 3 and 4 and bottom, and C) suggesting Stat5 has a role in the regulation of SMN2. Full-length SMN2 transcripts remained elevated (Fig. 5A, lane 3) after sodium vanadate treatment; however, the level was less than the vanadate-treatment-only panel (Fig. 5A, lane 2). These results demonstrate that although knockdown of Stat5 expression may down-regulate SMN2 expression, this expression does not affect the SMN2 alternative splicing, suggesting that sodium vanadate treatment may induce dual pathways for transcriptional activation and alternative splicing.
|
Stat5A1*6 expression increases the number of nuclear gems in SMA patient lymphocytes
Stat5 increases SMN2 expression, suggesting Stat5 may be a potential factor in treating SMA. Most cell lines derived from SMA patients showed defects in the formation of nuclear gems. We therefore investigated whether Stat5 constitutive expression recovered the number of nuclear gems in SMN1-deficient SMA patient lymphocytes. Immunocytochemical analysis showed most control cells contained nuclear gems in their nuclei and in the cytoplasm (Fig. 6AC). However, SMN signals were almost undetectable in the cytoplasm and nuclei of SMA patient lymphocytes (Fig. 6DF). In some Stat5A1*6-transfected lymphocytes, however, the SMN signal was detected and the number of nuclear gems increased (Fig. 6I, indicated by arrows). The SMN protein level increase was confirmed by immunoblot analysis (Fig. 6K). In comparison with the normal control (72% cells contained nuclear gems), the SMA patients showed extremely low numbers of nuclear gems (only 1020%). In Stat5A1*6-transfected SMA-patient lymphocytes, the gem number increased 23-fold (1552% in patient 1, 935% in patient 3 and 1145% in patient 4); however, the effect was not significant in patient 2 (1831%) (Fig. 6L and M), this finding is roughly consistent with the fold increase of SMN protein for each patient (2.68-fold in patient 1, 2.17-fold in patient 3, 1.74-fold in patient 4, only 1.49-fold in patient 2). These results demonstrate that Stat5 activation recovers nuclear gems in Smn-deficient cells in vitro.
|
Stat5A1*6 expression diminishes axon outgrowth defects in primary cultured SMA-like motor neurons
Recent studies have demonstrated that motor neurons lacking Smn reveal an axon outgrowth deficiency but that dendrite extension is not affected (49). We therefore wanted to evaluate whether Stat5 constitutive expression can modify the defects in axon outgrowth of SMA-like mouse motor neurons in vitro. Primary cultured normal (Smn+/+) and heterozygous motor neurons (Smn+/; SMN2) showed a normal neurite outgrowth phenotype (Fig. 7AF). Most of the heterozygous motor neurons (86.9%) showed extended axons (845.2 ± 229 µm, Fig. 8D) and only a few cells (13.1%) showed shorter axon phenotypes (Fig. 8C). We observed that in normal and heterozygous motor neurons, a complicated neurite network is frequently formed between motor neuron clusters (Fig. 7A and D). The SMA-like motor neurons (Smn/; SMN2), however, revealed different phenotypes under the same culture conditions. About 38.9% of the SMA-like motor neurons showed shorter axons (148.2 ± 65.07 µm, Fig. 8D) and the other 61.1% showed axon-less phenotypes (indistinguishable from dendrites, axon<50 µm) (Figs 7H and 8C) and did not show neurite networks in cultured conditions (Fig. 7H). Some SMA-like motor neurons seemed to show normal dendrite outgrowth; however, they showed defective axon extension (Fig. 7H, indicated with an arrow). Only a few motor neurons showed extended axons; however, they were shorter than Smn heterozygous (Smn+/; SMN2) motor neurons (Figs 7H and 8C). In addition, some SMA-like motor neurons did not show any neurite outgrowth (Fig. 7H, indicated with an arrowhead). To confirm whether SMN is indeed necessary for motor neuron axon outgrowth, SMA-like motor neurons were transiently transfected with V5-tagged SMN expression vector and motor axon outgrowth was analyzed by immunocytochemical study. Axon outgrowth was clearly detected in SMN transfected SMA-like motor neurons (Fig. 8A, indicated with arrows) but not in those without SMN expression (Fig. 8A, indicated with arrowheads). The axon length of SMN-recovered SMA-like motor neurons can extend long distances (Fig. 8A, indicated with a dotted line) in the same way as Smn+/+ motor neurons (Fig. 7A). However, SMA-like motor neurons without SMN transfection showed neurite-less or shorter axon patterns (Fig. 8A, indicated with arrowheads). This result demonstrates that SMN is an important factor for motor neurons to extend their axons. Stat5A1*6 transfection also diminished the axon outgrowth defects in SMA-like motor neurons (Fig. 8B, indicated with arrows), 59.6% motor neurons with Stat5A1*6 transfection extended axons (Fig. 8C), and the axon length was significantly longer compared with SMA-like motor neurons without Stat5A1*6 over-expression (251.2 ± 97.40 versus 148.2 ± 65.07 µm, Fig. 8D). These results demonstrate that Stat5A1*6 expression in cultured conditions contributes to motor neuron axon outgrowth and diminishes defects found in SMA-like motor neurons.
|
|
| DISCUSSION |
|---|
|
|
|---|
In this paper, we found that the Stat5 molecule can be induced in SMN2-NSC34 cells by treatment with three compounds. Stat5 constitutive activation facilitated SMN2 expression, increased the number of nuclear gems and diminished defects in primary cultured SMA-like motor neurons, suggesting that it can be used as a therapeutic target in treating SMA.
TSA, aclarubicin and sodium vanadate have distinct properties and were previously thought to induce different signaling pathways and cause different cellular events. In our studies, these compounds were found to enhance SMN2 expression in both SMA-like MEFs and motor neuron-like NSC34 cells. It is not yet clear, however, through what mechanism these compounds influence SMN2 activation or alternative splicing. An FDA approved drug VPA has been found to significantly increase the SMN protein level in fibroblast cultures derived from SMA patients. The effect of VPA may result from up-regulation of the SMN protein level via Tra2-ß1, which has shown to be a trans-acting factor in changing the SMN2 alternative splicing, and through activation of SMN gene transcription, most probably due to the AP1- and/or Sp1-dependent pathway (24). It is believed that compounds that lead to the up-regulation of SMN levels may do so by both transcriptional activation and alternative splicing of the SMN2 gene. However, in this study, we did not identify splicing factors, such as Tra2-ß1, which according to this hypothesis should be up-regulated in NSC34 cells after sodium vanadate treatment (data not shown). Stat5 was highly phosphorylated after treatment with these three compounds in SMN2-NSC34 cells, and our results suggest Stat5 activation contributed to SMN2 expression. Nevertheless, using synthetic dsRNA knockdown of Stat5A expression in SMN2-NSC34 cells decreased SMN protein levels. This result directly demonstrated that Stat5A enhances SMN2 expression; however, knockdown of Stat5A expression did not completely block the effects of sodium vanadate treatment in SMN2-NSC34 cells. The fact that full-length SMN2 transcripts remain increased suggests that there are dual effects caused by treatment with these compounds. Stat5 may be induced by effective compounds and facilitate transcriptional activation of SMN2 in motor neurons. Another signaling pathway may be involved in the SR protein regulation and contribute to SMN2 exon 7 incorporation into SMN2 transcripts. Stat5 is regulated through Jak2 tyrosine kinase, and Jak2 tyrosine kinase signaling is involved in the neuroprotective mechanism, which might be useful in preventing the loss of nerve cells in some neurodegenerative diseases (50,51). Stat5-induced cell survival promotion is due to regulation of anti-apoptotic protein expression of proteins such as the Bcl-2 family members or caspases, which inhibit or trigger cell death (5255). SMN protein is thought to be an anti-apoptotic protein (56,57) and its anti-apoptotic pathway also involves Bcl-2 protein. It is confusing that sequence analysis showed two conserved Stat5 binding sites (TTCNNNGAA and TTCNNNTAA) in murine Smn promoter but no Stat5 conserved binding site could be found in human SMN2 promoter. We identified an element (CTCNNNTAA) which was similar to the Stat5 binding site that emerged three times in SMN2 promoter. In vitro binding analysis showed that Stat5 has binding affinity to the CTCNNNTAA element (Fig. 4). This result suggests that Stat5 may regulate SMN2 expression through directly recognizing the putative Stat5 binding element in the SMN2 promoter. Nevertheless, it is also possible that Stat5 works in coordination with other transcription factors and contributes to SMN2 regulation, because we also found other Stat family proteins activated by the three effective compounds. However, in vitro binding assays were not able to prove that the SMN gene is a downstream target for Stat5 in vivo. More experiments such as chromatin immunoprecipiation assay will be needed to further clarify this interaction.
SMN protein is thought to be responsible for ß-Actin mRNA transport in axon processes. Lack of SMN protein in motor neurons results in shorter axons and smaller growth cones (49,58). We found a large population of primary culture embryonic stage SMA-like motor neurons (Smn/; SMN2) deficient in axons and dendrite extension and without communication between motor neuron clusters. Loss of communication ability among motor neurons may be caused by axon outgrowth defects and reduced size of growth cones and implicated in some defects in transmitting neural signals. Stat5 activation diminishes motor axon defects in SMA-like motor neurons. This may be the cause of transcriptional activation of SMN2, suggesting that SMN protein is necessary for motor axon outgrowth.
Transcriptional activation of SMN2 could be a practical approach in SMA therapy. Drugs which can change the SMN2 alternative spicing pattern through influencing SR factor expression may also be toxic to cells, because they influence the normal splicing progression of other genes. Bi-functional antisense oligos (59) or specific synthetic exon activators (60) which have been reported to specifically correct SMN2 alternative splicing pattern in vitro also have the potential to treat SMA, although their application still needs to be demonstrated in vivo. To sum up, we propose a model for SMN2 regulation through treating motor neuron-like NSC34 with any of three compounds: TSA, aclarubicin and sodium vanadate (Fig. 9). In this model, the Jak2/Stat signaling pathway may be induced by the compounds and Stat molecules, especially Stat5, could form a homodimer, or a heterodimer with other activated forms of Stat proteins, to regulate SMN2 expression. Our findings demonstrate that Stat5 expression enhances SMN2 expression and reduces defects found in SMA, and therefore the Stat5 signaling pathway could be a target for SMA therapy.
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
Generation of the human SMN antibody
The pQE expression system (Qiagen, Valencia, CA, USA) was used to express human full-length SMN protein in M15 strain Escherichia coli. Induction and purification of SMN protein by affinity chromatography on nitrilotriacetic acid-chelating agarose were conducted according to the manufacturer's protocols. The purified SMN protein was injected into rabbits with Freund's complete adjuvant (Sigma, St Louis, MO, USA). The antisera obtained from rabbits were used for western blot analysis. Proteins blotted onto polyvinylidene difluoride membranes were incubated with at 1/1000 dilution and labeled with an HRP-conjugated anti-rabbit secondary antibody (Chemicon, Temecula, CA, USA).
Chemicals and dsRNA
The chemicals used to treat the SMA-like MEFs or SMN2-NSC34 cells were purchased from Sigma or Calbiochem (San Diego, CA, USA). Mouse Stat5A dsRNA was purchased from Dharmacon (siGENOMETM, Lafayette, CO, USA).
Constructs
Human SMN2 gene (35.5 kb) was digested from human SMN2 BAC clone 7C by using BamHI and was inserted into the multiple cloning site of Super COS I expression vector (Stratagene, La Jolla, CA, USA). For luciferase assay, the SMN2 promoter (5.4 kb) was digested out using NheI and XhoI and ligated into the pGL3-basic vector (Promega, Madison, WI, USA). The pMX-puro-Stat5A1*6 plasmid was a gift from Dr T. Kitamaura (University of Tokyo, Tokyo, Japan). The cDNA for the Stat5A1*6 (constitutive activation mutant with H299R/S711F) was sub-cloned into pGEM-T-Easy vector (Promega) using a primer set (forward: 5'-CATGGCGGGC- TGGATTCA-3'; backward: 5'-TCAGGACAGGGAGCTTCT- 3'). The restriction enzymes NotI and SpeI were used to excise a 2.3 kb fragment and were inserted into pFlag-CMV2 expression vector (Sigma).
Cell culture and chemical/dsRNA treatment
MEFs were prepared using the standard protocol. Briefly, E13.5-day embryo was isolated; the uterine deciduas were cut away and the yolk sac was removed. The embryo was then scraped out to remove non-fibroblastic tissue, and the head severed for genotyping. Embryo body was minced in 0.25% trypsin-EDTA and incubated for 30 min. It was then added to MEF culture media, and the cell suspension spun for
5 min at 200 g. in the tissue culture centrifuge to pellet cells. The supernatant was aspirated off and the cell pellet immediately resuspended in 10 ml of fresh MEF culture media. The MEFs were allowed to reach confluency so the cells could be passaged for further experiments. Cultured MEFs and SMN2-NSC34 cells were maintained in Dulbecco's modified Eagle's medium (Invitrogen, Carlsbad, CA, USA) containing 10% heat-inactivated fetal bovine serum (Hyclone, Logan, UT, USA) and 1% penicillinstreptomycin (Invitrogen) and were incubated at 37°C in a 5% CO2 humidified atmosphere. The cells were plated the day preceding the treatment with each chemical and harvested at the indicated time. For the Stat5A knockdown experiment, SMN2-NSC34 cells were grown to 70% confluence in a 12-well culture plate and treated with dsRNA for 48 h, and then treated with sodium vanadate for 4 h. Later, duplicated cells were harvested for RTPCR or western blot analysis. EB-virus-transformed normal and SMA patient lymphocytes were cultured in
-MEM (Invitrogen), 10% heat-inactivated fetal bovine serum (Hyclone), 1% penicillinstreptomycin as previously described (23). Isolation and primary culture of motor neuron cells and genotyping of individual embryos were also carried out as previously described (6163). Briefly, the ventrolateral parts of individual lumbar spinal cords were dissected and transferred to HBSS (Hank's Balanced Salt Solution, Sigma). After treatment with trypsin (0.05%, 15 min) (Invitrogen) single-cell suspensions were triturated and the cell suspension passed through a nylon mesh (100 µm pore size). The cells were overlaid on 10% HistoDenz (Sigma) in HBSS. The HistoDenz cushion was centrifuged for 20 min at 250g, and cells from the inter-phase were taken out and transferred to culture medium. Cells were plated at a density of 2000 cells/cm2 in a four-well chamber slide (Nalge Nunc), pre-coated with poly-ornithine and laminin (Sigma). Cells were grown in neurobasal medium (Invitrogen) with 5% horse serum (Invitrogen), 5% fetal bovine serum and 500 µM glutamax (Invitrogen) and 1% penicillinstreptomycin at 37°C in a 5% CO2 atmosphere. Fifty percent of the medium was replaced at day 1 and changed every second day. Cells were cultured in the presence of CNTF and BDNF (10 ng/ml) (CytoLab Ltd, Rehovot, Israel). Motor neurons were cultured for 3 days and harvested for further transfection or immunocytochemical analysis.
Semi-quantification PCR/RTPCR
The genomic DNA from E13.5 SMA embryos was extracted. A specific primer pair (5'-TGTAGTGGAAAGTTGGGGA C-3', 5'-CCTGGCATTGGGGGTGGTGG AGG -3') was designed for recognition of both murine Smn and human SMN2. The PCR program initially started with a 95°C denaturation for 10 min, followed by 1926 cycles at 95°C/1 min, 53°C/1.5 min, 72°C/2 min to assay the linear range for both Smn and SMN2. For RTPCR assay, total RNA was extracted at indicated time points from SMN2-NSC34 cells with sodium vanadate, TSA and aclarubicin treatment or with an increasing amount of Stat5A1*6 transfection by using the TRizol reagent (Invitrogen). To amplify the exon 7 inclusion/exclusion form of SMN2 transcripts, RTPCR was performed using a primer set P5P6 as previously described (15). The transcript from the mouse glyceraldehyde-3-phosphate dehydrogenase (Gapdh) gene or the ß-Actin gene was amplified using the primer pairs: Gapdh forward: 5'-CCCTTCA TTGACCTCAACTA -3', backward: 5'-CCAAAGTTGTCATGGATGAC-3' (56°C). ß-Actin forward: 5'-ATGGTGGGAATGGGTCAGAAGGAC-3', backward 5'-CTCTTTGATGTCAC GCACGATTTC-3' (59°C), and this allowed control of equal amounts of template. To analyze total SMN2 transcripts, primer sets were designed to specifically recognize SMN2 exons 2a and 6 (exon 2a forward: 5'-CTGACAT TTGGGATGATACAGCAC-3'; exon 6 backward: 5'-TGGT GGAGG GAGAAAAGAG TTCC-3'). The PCR program initially started with a 95°C denaturation for 5 min, followed by 1525 cycles at 95°C/1 min, 54°C/1 min and 72°C/1.5 min to assay the linear range for SMN2. The resulting PCR products were electrophoresed on 1.2 or 1.5% agarose gels in TBE buffer (89 mM Tris-base pH 7.6, 89 mM boric acid, 2 mM EDTA) and stained with ethidium bromide (10 µg/ml) and photographed on top of a 280 nm UV light box. The gel images were digitally captured with a CCD camera and analyzed with the AlphaImagerTM. To specify the SMN2 copy number, the SMN2 signal was normalized with the endogenous mouse Smn signal. RTPCR values are presented as a ratio of the FL-SMN2 signal divided by
7-SMN2 in the selected linear amplification cycle normalized by Gapdh, or ß-Actin signal. Relative total SMN2 transcript levels were determined from Stat5A1*6- transfected SMN2-NSC34 cells in a minimum of three independent experiments. Differences in ratios were determined to be significant by an independent two-tailed t-test, with *P < 0.05, **P < 0.005 and ***P < 0.001.
Western blot analysis
Cells treated with dsRNA, compounds or Stat5A1*6 transfected were detached by scraping, pelletting and rinsing in phosphate-buffered saline (PBS). Cell pellets were collected after centrifugation and lysed on ice in modified RIPA buffer [50 mM TrisHCl, pH7.4, 1% NP-40, 0.25% deoxycholic acid, 0.15 M NaCl, 1 mM EDTA, 1 mM PMSF/NaF/sodium orthovanadate and protease inhibitors cocktail (Roche, Mannheim, Germany)] for 30 min. After centrifugation, the supernatants were collected and kept frozen at 20°C. Protein concentrations were determined by Bio-Rad protein assay method. For western blot analysis, protein samples were boiled for 5 min and electrophoresed on 8 or 10% SDSpolyacrylamide gel in a 1 x running buffer (25 mM Tris, 192 mM glycine, 3.4 mM SDS, pH 8.3) and subsequently electrotransferred to Polyvinylidene Fluoride tansfer membrane (Pall, Pensacola, FL, USA) using a TE 22 mini-tank transfer unit (Amersham Biosciences, San Francisco, CA, USA) at 35 V overnight in transfer buffer (25 mM Tris, 192 mM glycine, 20% methanol, pH8.3). The blotting membranes were incubated in blocking solution (PBS, 5% non-fat milk, 0.2% Tween-20) for 1 h at room temperature, and then incubated in the same solution with the primary antibody (rabbit-SMN/1:1000; SMN/1:5000, Transduction Laboratories, Lexington, KY, USA; phospho-Stat5a/b/1:1000, Cell signaling, Beverly, MA, USA; phospho-Jak2/1:1000, Upstate, Lake Placid, NY, USA; Flag BioM2/1:1000, Sigma; c-myc/1:200, Santa Cruz Biotech, Santa Cruz, CA, USA;
-tubilin/1:10000, Upstate) overnight at 4°C. The membranes were washed and incubated in the blocking solution with the proper HRP-conjugated secondary antibody at 1/5000 dilution (Chemicon, Temecula, CA, USA) for 1 h at room temperature. After washing three times in PBS containing 0.1% Tween-20, the signals were visualized by autoradiography (Fuji Medical X-ray film, Fuji Photos, Tokyo, Japan) using enhanced chemiluminescence (ECL detection system; Perkin-Elmer, Boston, CA, USA). Western blot quantification was performed by scanning the autoradiographs with a computerized densitometer. Signal intensities were determined by densitometry analysis (Fuji film LAS-1000 plus pictography) using the program Phoreticx 1D (Phoreticx International).
Reporter analysis
For SMN2 gene promoter-derived luciferase assay, the pSMN2-luciferase vector (0.75 µg) was co-transfected with pSV40-Renilla luciferase vector (0.25 µg) and flag-tagged Stat5A1*6 (2 µg) into the 2 x 105 NSC34 cells using lipofectAMINE2000 reagent (Invitrogen). Cells were harvested 24 h after transfection and relative luciferase activities were measured according to manufacturer's standard procedures (Promega). Statistical analysis comparing SMN2 promoter activity between Stat5A1*6-transfected to non-transfected NSC34 cells was conducted using an independent two-sided t-test, with ***P < 0.0001.
Sequence analysis
Sequence analysis of the mouse Smn promoter region (NCBI accession number: AF027688
[GenBank]
) and the human SMN2 promoter region (NCBI accession no. AF187725
[GenBank]
) were obtained using MacVector software (Accelrys Inc.).
In vitro binding assay
The binding assay was performed by using the NoShift Transcription factor assay kit (Novagen). Briefly, two oligonucleotides that define a putative Stat5 binding site in the SMN2 promoter were synthesized and the 3' end labeled with biotin. After annealing, the dsDNA was incubated with the chemical treated or non-treated SMN2-NSC34 nuclear extract for 30 min on ice, and then transferred to a streptavidin plate and incubated for 1 h at 37°C. One hour later, the primary antibody (anti-phospho-Stat5/1:200, Santa Cruz, CA, USA) was added and incubated for 1 h at 37°C. After washing, the secondary antibody conjugated with horseradish peroxidase was added and incubated for 30 min at 37°C. After washing five times, TMB substrate was added and incubated at room temperature in the dark until the blue color developed and then the reaction stopped by adding 1 N HCl; finally, the absorbance at 450 nm was measured with PowerWave 340 reader (BIO-TEK Instruments). Each experiment was performed three times and SEM was calculated. Differences in ratios were determined to be significant by an independent two-tailed t-test, with **P < 0.01 and ***P < 0.0001.
Transfection and immunocytochemical analysis
The super COS I-SMN2 was first transfected into NSC34 cells using the LipofectAMINETM2000 following manufacturer's protocol and several transfectants were obtained through 500 µg/ml G418 (Calbiochem) selection. Transfectant D9 was used for further studies. For SMA patient lymphocyte transfection, cells were pelleted (
5 x 106) cells by centrifugation at 200 g. for 3 min and washed twice with ice-cold PBS. The cells were then re-suspended in the pellet in 600 µl PBS, and 10 µg of DNA was added (empty vector or flag tagged Stat5A1*6 constructs). The cell suspension was then transferred to a cold 0.4 cm gene pulser cuvette (Bio-Rad, Hercules, CA) and the cells were electroporated at 0.95 kV/27 µF. The electroporated cells were then cultured for 36 h and fixed with 4% PFA for 10 min and permeablized on 0.3% Triton X-100 in PBS for 5 min. After blocking with 3% BSA, the cells were incubated overnight at 4°C with the following primary antibodies: Flag polyclonal (1:500; Sigma) and SMN (1:500, Transduction Laboratories). Cells were then washed three times with TBS-T (20 mM TrisHCl, pH 7.4, 137 mM NaCl and 0.1% Tween-20) and incubated for 1 h at RT with appropriate fluorescence dye conjugated secondary antibodies (1:500; Molecular Probes, Eugene, OR, USA). DAPI (Sigma) was used for nucleus staining. After mounting with fluorescent mounting medium (DAKO, Carpinteria, CA), the suspended cells were transferred into a chamber, and images were obtained with an LSM 510 laser-scanning confocal microscope. The LSM5 Image Browser software was used for image acquisition. Statistical analysis comparing gem number of control vector transfected group to Stat5A1*6 transfected lymphocytes was conducted using an independent two-sided t-test, with *P < 0.01. For dsRNA knockdown experiment, dsRNA was transfected into SMN2-NSC34 cells by using siIMPORTER reagent (Upstate), followed by manufacturer's standard procedure. For primary motor neuron transfection, 0.1 M polyethylenimine (PEI) reagent (Sigma) was used as previously reported (64). Opti-MEM (Invitrogen) diluted plasmid DNA (Stat5A1*6) was added to opti-MEM diluted PEI solution (in 5% glucose) in the same volume while vortexing (giving rise to an N/P ratio of 10). After 15 min incubation, the mixture was added into the culture medium. After 48 h, cells were harvested for immunocytochemical analysis. Neurite outgrowth was quantified by using NeuronJ (65), a JAVA program for neurite tracing and quantification (http://imagescience.bigr.nl/meijering/software/neuronj/) the same as that previously described (66). Neurons and their axons were identified by using the Hb9, ßIII-tubulin, ChAT or neurofilament-H antibodies (Chemicon). Axon length was measured by tracing and recording the length of all ßIII-tubulin and ChAT-positive axons. Cells with axons that were not in full view were not included. Total axon length was then divided by the total number of cells, generating a mean axon length per cell within each test group. The SEM was determined and mean axon outgrowth was plotted as a percentage of the control group. Statistical significance: ***P < 0.0001, when Stat5A1*6-transfected SMA-like motor neurons were compared with control vector transfected groups.
Statistical analysis
Experiments were confirmed in at least three independent results. Data were analyzed by Prism 4 software (GraphPad Inc.). The statistical significance of any difference was determined by applying the two-tailed t-test. The difference was considered statistically significant at P < 0.05.
| SUPPLEMENTARY MATERIAL |
|---|
|
|
|---|
Supplementary Material is available at HMG Online.
| ACKNOWLEDGEMENTS |
|---|
We thank Dr Harry Wilson and Ms M. Loney for their critical reading of this manuscript. We would also like to thank Dr T. Kitamaura (University of Tokyo, Tokyo, Japan) for providing the pMX-puro-Stat5A1*6 plasmid and Dr Neil Cashman for kindly providing the NSC34 cell line. This work was supported in part by a research grant AS92IMB3 from Academia Sinica, Taipei, Taiwan, and a grant from National Health Research Institute (NHRI-EX95-9309NI), Taiwan.
Conflict of Interest statement. None declared.
| REFERENCES |
|---|
|
|
|---|
- Talbot K. (1999) Spinal muscular atrophy. J. Inherit. Metab. Dis. 22:545554.[CrossRef][Web of Science][Medline]
- Lefebvre S., Burglen L., Reboullet S., Clermont O., Burlet P., Viollet L., Benichou B., Cruaud C., Millasseau P., Zeviani M., et al. (1995) Identification and characterization of a spinal muscular atrophy-determining gene. Cell 80:155165.[CrossRef][Web of Science][Medline]
- Ogino S. and Wilson R.B. (2002) Genetic testing and risk assessment for spinal muscular atrophy (SMA). Hum. Genet. 111:477500.[CrossRef][Web of Science][Medline]
- Parsons D.W., McAndrew P.E., Iannaccone S.T., Mendell J.R., Burghes A.H., Prior T.W. (1998) Intragenic telSMN mutations: frequency, distribution, evidence of a founder effect, and modification of the spinal muscular atrophy phenotype by cenSMN copy number. Am. J. Hum. Genet. 63:17121723.[CrossRef][Web of Science][Medline]
-
Rodrigues N.R., Owen N., Talbot K., Ignatius J., Dubowitz V., Davies K.E. (1995) Deletions in the survival motor neuron gene on 5q13 in autosomal recessive spinal muscular atrophy. Hum. Mol. Genet. 4:631634.
[Abstract/Free Full Text] -
Coovert D.D., Le T.T., McAndrew P.E., Strasswimmer J., Crawford T.O., Mendell J.R., Coulson S.E., Androphy E.J., Prior T.W., Burghes A.H. (1997) The survival motor neuron protein in spinal muscular atrophy. Hum. Mol. Genet. 6:12051214.
[Abstract/Free Full Text] - Lefebvre S., Burlet P., Liu Q., Bertrandy S., Clermont O., Munnich A., Dreyfuss G., Melki J. (1997) Correlation between severity and SMN protein level in spinal muscular atrophy. Nat. Genet. 16:265269.[CrossRef][Web of Science][Medline]
- McAndrew P.E., Parsons D.W., Simard L.R., Rochette C., Ray P.N., Mendell J.R., Prior T.W., Burghes A.H. (1997) Identification of proximal spinal muscular atrophy carriers and patients by analysis of SMNT and SMNC gene copy number. Am. J. Hum. Genet. 60:14111422.[Web of Science][Medline]
- Burglen L., Lefebvre S., Clermont O., Burlet P., Viollet L., Cruaud C., Munnich A., Melki J. (1996) Structure and organization of the human survival motor neurone (SMN) gene. Genomics 32:479482.[CrossRef][Web of Science][Medline]
-
Monani U.R., Lorson C.L., Parsons D.W., Prior T.W., Androphy E.J., Burghes A.H., McPherson J.D. (1999) A single nucleotide difference that alters splicing patterns distinguishes the SMA gene SMN1 from the copy gene SMN2. Hum. Mol. Genet. 8:11771183.
[Abstract/Free Full Text] - Jong Y.J., Chang J.G., Lin S.P., Yang T.Y., Wang J.C., Chang C.P., Lee C.C., Li H., Hsieh-Li H.M., Tsai C.H. (2000) Analysis of the mRNA transcripts of the survival motor neuron (SMN) gene in the tissue of an SMA fetus and the peripheral blood mononuclear cells of normals, carriers and SMA patients. J. Neurol. Sci. 173:147153.[CrossRef][Web of Science][Medline]
- Gennarelli M., Lucarelli M., Capon F., Pizzuti A., Merlini L., Angelini C., Novelli G., Dallapiccola B. (1995) Survival motor neuron gene transcript analysis in muscles from spinal muscular atrophy patients. Biochem. Biophys. Res. Commun. 213:342348.[CrossRef][Web of Science][Medline]
-
Lorson C.L. and Androphy E.J. (2000) An exonic enhancer is required for inclusion of an essential exon in the SMA-determining gene SMN. Hum. Mol. Genet. 9:259265.
[Abstract/Free Full Text] -
Hofmann Y., Lorson C.L., Stamm S., Androphy E.J., Wirth B. (2000) Htra2-beta 1 stimulates an exonic splicing enhancer and can restore full-length SMN expression to survival motor neuron 2 (SMN2). Proc. Natl Acad. Sci. USA 97:96189623.
[Abstract/Free Full Text] - Hsieh-Li H.M., Chang J.G., Jong Y.J., Wu M.H., Wang N.M., Tsai C.H., Li H. (2000) A mouse model for spinal muscular atrophy. Nat. Genet. 24:6670.[CrossRef][Web of Science][Medline]
-
Monani U.R., Sendtner M., Coovert D.D., Parsons D.W., Andreassi C., Le T.T., Jablonka S., Schrank B., Rossol W., Prior T.W., et al. (2000) The human centromeric survival motor neuron gene (SMN2) rescues embryonic lethality in Smn(/) mice and results in a mouse with spinal muscular atrophy. Hum. Mol. Genet. 9:333339.
[Abstract/Free Full Text] - Boda B., Mas C., Giudicelli C., Nepote V., Guimiot F., Levacher B., Zvara A., Santha M., LeGall I., Simonneau M. (2004) Survival motor neuron SMN1 and SMN2 gene promoters: identical sequences and differential expression in neurons and non-neuronal cells. Eur. J. Hum. Genet. 12:729737.[CrossRef][Web of Science][Medline]
- Baron-Delage S., Abadie A., Echaniz-Laguna A., Melki J., Beretta L. (2000) Interferons and IRF-1 induce expression of the survival motor neuron (SMN) genes. Mol. Med. 6:957968.[Web of Science][Medline]
-
Majumder S., Varadharaj S., Ghoshal K., Monani U., Burghes A.H., Jacob S.T. (2004) Identification of a novel cyclic AMP-response element (CRE-II) and the role of CREB-1 in the cAMP-induced expression of the survival motor neuron (SMN) gene. J. Biol. Chem. 279:1480314811.
[Abstract/Free Full Text] - Rouget R., Vigneault F., Codio C., Rochette C., Paradis I., Drouin R., Simard L.R. (2005) Characterization of the survival motor neuron (SMN) promoter provides evidence for complex combinatorial regulation in undifferentiated and differentiated P19 cells. Biochem. J. 385:433443.[CrossRef][Web of Science][Medline]
- Andreassi C., Patrizi A.L., Monani U.R., Burghes A.H., Brahe C., Eboli M.L. (2002) Expression of the survival of motor neuron (SMN) gene in primary neurons and increase in SMN levels by activation of the N-methyl-D-aspartate glutamate receptor. Neurogenetics 4:2936.[CrossRef][Web of Science][Medline]
-
Andreassi C., Jarecki J., Zhou J., Coovert D.D., Monani U.R., Chen X., Whitney M., Pollok B., Zhang M., Androphy E., et al. (2001) Aclarubicin treatment restores SMN levels to cells derived from type I spinal muscular atrophy patients. Hum. Mol. Genet. 10:28412849.
[Abstract/Free Full Text] -
Chang J.G., Hsieh-Li H.M., Jong Y.J., Wang N.M., Tsai C.H., Li H. (2001) Treatment of spinal muscular atrophy by sodium butyrate. Proc. Natl Acad. Sci. USA 98:98089813.
[Abstract/Free Full Text] -
Brichta L., Hofmann Y., Hahnen E., Siebzehnrubl F.A., Raschke H., Blumcke I., Eyupoglu I.Y., Wirth B. (2003) Valproic acid increases the SMN2 protein level: a well-known drug as a potential therapy for spinal muscular atrophy. Hum. Mol. Genet. 12:24812489.
[Abstract/Free Full Text] - Sumner C.J., Huynh T.N., Markowitz J.A., Perhac J.S., Hill B., Coovert D.D., Schussler K., Chen X., Jarecki J., Burghes A.H., et al. (2003) Valproic acid increases SMN levels in spinal muscular atrophy patient cells. Ann. Neurol. 54:647654.[CrossRef][Web of Science][Medline]
- Andreassi C., Angelozzi C., Tiziano F.D., Vitali T., De Vincenzi E., Boninsegna A., Villanova M., Bertini E., Pini A., Neri G., et al. (2004) Phenylbutyrate increases SMN expression in vitro: relevance for treatment of spinal muscular atrophy. Eur. J. Hum. Genet. 12:5965.[CrossRef][Web of Science][Medline]
- Mercuri E., Bertini E., Messina S., Pelliccioni M., D'Amico A., Colitto F., Mirabella M., Tiziano F.D., Vitali T., Angelozzi C., et al. (2004) Pilot trial of phenylbutyrate in spinal muscular atrophy. Neuromuscul. Disord. 14:130135.[CrossRef][Web of Science][Medline]
- Brahe C., Vitali T., Tiziano F.D., Angelozzi C., Pinto A.M., Borgo F., Moscato U., Bertini E., Mercuri E., Neri G. (2005) Phenylbutyrate increases SMN gene expression in spinal muscular atrophy patients. Eur. J. Hum. Genet. 13:256259.[CrossRef][Web of Science][Medline]
- Zhang M.L., Lorson C.L., Androphy E.J., Zhou J. (2001) An in vivo reporter system for measuring increased inclusion of exon 7 in SMN2 mRNA: potential therapy of SMA. Gene Ther. 8:15321538.[CrossRef][Web of Science][Medline]
- Sakurai H., Fugono J., Yasui H. (2004) Pharmacokinetic study and trial for preparation of enteric-coated capsule containing insulinomimetic vanadyl compounds: implications for clinical use. Mini Rev. Med. Chem. 4:4148.[CrossRef][Web of Science][Medline]
- Cheta D., Orasanu G., Nicolaie T., Iordachescu D., Buligescu S., Constantin C., Hassanain M., Coman A., Enache M., Negru R., et al. (2003) The influence of sodium metavanadate on the process of diabetogenesis in BB rats. J. Cell. Mol. Med. 7:447454.[Web of Science][Medline]
- Gerling N., Culmsee C., Klumpp S., Krieglstein J. (2004) The tyrosine phosphatase inhibitor orthovanadate mimics NGF-induced neuroprotective signaling in rat hippocampal neurons. Neurochem. Int. 44:505520.[CrossRef][Web of Science][Medline]
- Lu X., Maysinger D., Hagg T. (2002) Tyrosine phosphatase inhibition enhances neurotrophin potency and rescues nigrostriatal neurons in adult rats. Exp. Neurol. 178:259267.[CrossRef][Web of Science][Medline]
-
Yoshida M., Kijima M., Akita M., Beppu T. (1990) Potent and specific inhibition of mammalian histone deacetylase both in vivo and in vitro by trichostatin A. J. Biol. Chem. 265:1717417179.
[Abstract/Free Full Text] - Gieseler F., Bauer E., Nuessler V., Clark M., Valsamas S. (1999) Molecular effects of topoisomerase II inhibitors in AML cell lines: correlation of apoptosis with topoisomerase II activity but not with DNA damage. Leukemia 13:18591863.[CrossRef][Web of Science][Medline]
- Singh J., Nordlie R.C., Jorgenson R.A. (1981) Vanadate: a potent inhibitor of multifunctional glucose-6-phosphatase. Biochim. Biophys. Acta 678:477482.[Medline]
- Gouilleux F., Wakao H., Mundt M., Groner B. (1994) Prolactin induces phosphorylation of Tyr694 of Stat5 (MGF), a prerequisite for DNA binding and induction of transcription. EMBO J. 13:43614369.[Web of Science][Medline]
- Azam M., Erdjument-Bromage H., Kreider B.L., Xia M., Quelle F., Basu R., Saris C., Tempst P., Ihle J.N., Schindler C. (1995) Interleukin-3 signals through multiple isoforms of Stat5. EMBO J. 14:14021411.[Web of Science][Medline]
-
Liu X., Robinson G.W., Wagner K.U., Garrett L., Wynshaw-Boris A., Hennighausen L. (1997) Stat5a is mandatory for adult mammary gland development and lactogenesis. Genes Dev. 11:179186.
[Abstract/Free Full Text] - Teglund S., McKay C., Schuetz E., van Deursen J.M., Stravopodis D., Wang D., Brown M., Bodner S., Grosveld G., Ihle J.N. (1998) Stat5a and Stat5b proteins have essential and nonessential, or redundant, roles in cytokine responses. Cell 93:841850.[CrossRef][Web of Science][Medline]
-
Udy G.B., Towers R.P., Snell R.G., Wilkins R.J., Park S.H., Ram P.A., Waxman D.J., Davey H.W. (1997) Requirement of STAT5b for sexual dimorphism of body growth rates and liver gene expression. Proc. Natl Acad. Sci. USA 94:72397244.
[Abstract/Free Full Text] -
Miyoshi K., Shillingford J.M., Smith G.H., Grimm S.L., Wagner K.U., Oka T., Rosen J.M., Robinson G.W., Hennighausen L. (2001) Signal transducer and activator of transcription (Stat) 5 controls the proliferation and differentiation of mammary alveolar epithelium. J. Cell Biol. 155:531542.
[Abstract/Free Full Text] -
Bunting K.D., Bradley H.L., Hawley T.S., Moriggl R., Sorrentino B.P., Ihle J.N. (2002) Reduced lymphomyeloid repopulating activity from adult bone marrow and fetal liver of mice lacking expression of STAT5. Blood 99:479487.
[Abstract/Free Full Text] -
Snow J.W., Abraham N., Ma M.C., Abbey N.W., Herndier B., Goldsmith M.A. (2002) STAT5 promotes multilineage hematolymphoid development in vivo through effects on early hematopoietic progenitor cells. Blood 99:95101.
[Abstract/Free Full Text] -
Sexl V., Piekorz R., Moriggl R., Rohrer J., Brown M.P., Bunting K.D., Rothammer K., Roussel M.F., Ihle J.N. (2000) Stat5a/b contribute to interleukin 7-induced B-cell precursor expansion, but abl- and bcr/abl-induced transformation are independent of stat5. Blood 96:22772283.
[Abstract/Free Full Text] -
Ariyoshi K., Nosaka T., Yamada K., Onishi M., Oka Y., Miyajima A., Kitamura T. (2000) Constitutive activation of STAT5 by a point mutation in the SH2 domain. J. Biol. Chem. 275:2440724413.
[Abstract/Free Full Text] - Sierke S.L. and Koland J.G. (1993) SH2 domain proteins as high-affinity receptor tyrosine kinase substrates. Biochemistry (Mosc.) 32:1010210108.
-
Darnell J.E., Jr J.E., Kerr I.M., Stark G.R. (1994) Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 264:14151421.
[Abstract/Free Full Text] -
McWhorter M.L., Monani U.R., Burghes A.H., Beattie C.E. (2003) Knockdown of the survival motor neuron (Smn) protein in zebrafish causes defects in motor axon outgrowth and pathfinding. J. Cell Biol. 162:919931.
[Abstract/Free Full Text] - Yao G.L., Kato H., Khalil M., Kiryu S., Kiyama H. (1997) Selective upregulation of cytokine receptor subchain and their intracellular signalling molecules after peripheral nerve injury. Eur. J. Neurosci. 9:10471054.[Medline]
- Digicaylioglu M. and Lipton S.A. (2001) Erythropoietin-mediated neuroprotection involves cross-talk between Jak2 and NF-kappaB signalling cascades. Nature 412:641647.[CrossRef][Medline]
-
Rui H., Xu J., Mehta S., Fang H., Williams J., Dong F., Grimley P.M. (1998) Activation of the Jak2-Stat5 signaling pathway in Nb2 lymphoma cells by an anti-apoptotic agent, aurintricarboxylic acid. J. Biol. Chem. 273:2832.
[Abstract/Free Full Text] -
Silva M., Benito A., Sanz C., Prosper F., Ekhterae D., Nunez G., Fernandez-Luna J.L. (1999) Erythropoietin can induce the expression of bcl-x(L) through Stat5 in erythropoietin-dependent progenitor cell lines. J. Biol. Chem. 274:2216522169.
[Abstract/Free Full Text] - Morcinek J.C., Weisser C., Geissinger E., Schartl M., Wellbrock C. (2002) Activation of STAT5 triggers proliferation and contributes to anti-apoptotic signalling mediated by the oncogenic Xmrk kinase. Oncogene 21:16681678.[CrossRef][Web of Science][Medline]
-
Kirito K., Watanabe T., Sawada K., Endo H., Ozawa K., Komatsu N. (2002) Thrombopoietin regulates Bcl-xL gene expression through Stat5 and phosphatidylinositol 3-kinase activation pathways. J. Biol. Chem. 277:83298337.
[Abstract/Free Full Text] - Iwahashi H., Eguchi Y., Yasuhara N., Hanafusa T., Matsuzawa Y., Tsujimoto Y. (1997) Synergistic anti-apoptotic activity between Bcl-2 and SMN implicated in spinal muscular atrophy. Nature 390:413417.[CrossRef][Medline]
- Sato K., Eguchi Y., Kodama T.S., Tsujimoto Y. (2000) Regions essential for the interaction between Bcl-2 and SMN, the spinal muscular atrophy disease gene product. Cell Death Differ. 7:374383.[CrossRef][Web of Science][Medline]
-
Rossoll W., Jablonka S., Andreassi C., Kroning A.K., Karle K., Monani U.R., Sendtner M. (2003) Smn, the spinal muscular atrophy-determining gene product, modulates axon growth and localization of beta-actin mRNA in growth cones of motoneurons. J. Cell. Biol. 163:801812.
[Abstract/Free Full Text] -
Skordis L.A., Dunckley M.G., Yue B., Eperon I.C., Muntoni F. (2003) Bifunctional antisense oligonucleotides provide a trans-acting splicing enhancer that stimulates SMN2 gene expression in patient fibroblasts. Proc. Natl Acad. Sci. USA 100:41144119.
[Abstract/Free Full Text] - Cartegni L. and Krainer A.R. (2003) Correction of disease-associated exon skipping by synthetic exon-specific activators. Nat. Struct. Biol. 10:120125.[CrossRef][Web of Science][Medline]
- Schnaar R.I. and Schaffner A.E. (1981) Separation of cell types from embryonic chicken and rat spinal cord: characterization of motoneuron-enriched fractions. J. Neurosci. 1:204217.[Abstract]
- Arakawa Y., Sendtner M., Thoenen H. (1990) Survival effect of ciliary neurotrophic factor (CNTF) on chick embryonic motoneurons in culture: comparison with other neurotrophic factors and cytokines. J. Neurosci. 10:35073515.[Abstract]
- Wiese S., Metzger F., Holtmann B., Sendtner M. (1999) The role of p75NTR in modulating neurotrophin survival effects in developing motoneurons. Eur. J. Neurosci. 11:16681676.[CrossRef][Web of Science][Medline]
- Scherer F., Schillinger U., Putz U., Stemberger A., Plank C. (2002) Nonviral vector loaded collagen sponges for sustained gene delivery in vitro and in vivo. J. Gene Med. 4:634643.[CrossRef][Web of Science][Medline]
- Meijering E., Jacob M., Sarria J.C., Steiner P., Hirling H., Unser M. (2004) Design and validation of a tool for neurite tracing and analysis in fluorescence microscopy images. Cytometry A. 58:167176.[Medline]
-
Harper J.M., Krishnan C., Darman J.S., Deshpande D.M., Peck S., Shats I., Backovic S., Rothstein J.D., Kerr D.A. (2004) Axonal growth of embryonic stem cell-derived motoneurons in vitro and in motoneuron-injured adult rats. Proc. Natl Acad. Sci. USA 101:71237128.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
N. thi Man, E. Humphrey, L. T. Lam, H. R. Fuller, T. A. Lynch, C. A. Sewry, P. R. Goodwin, A. E. MacKenzie, and G. E. Morris A two-site ELISA can quantify upregulation of SMN protein by drugs for spinal muscular atrophy Neurology, November 25, 2008; 71(22): 1757 - 1763. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. L. McGovern, T. O. Gavrilina, C. E. Beattie, and A. H.M. Burghes Embryonic motor axon development in the severe SMA mouse Hum. Mol. Genet., September 15, 2008; 17(18): 2900 - 2909. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

0.0075 and ***P 








