Skip Navigation


Human Molecular Genetics Advance Access originally published online on March 14, 2007
Human Molecular Genetics 2007 16(5):567-572; doi:10.1093/hmg/ddm016
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrowOA All Versions of this Article:
16/5/567    most recent
ddm016v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (35)
Google Scholar
Right arrow Articles by Sharp, A. J.
Right arrow Articles by Eichler, E. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sharp, A. J.
Right arrow Articles by Eichler, E. E.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 2006 The Author(s)
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Characterization of a recurrent 15q24 microdeletion syndrome

Andrew J. Sharp1, Rebecca R. Selzer2, Joris A. Veltman3, Stefania Gimelli4, Giorgio Gimelli5, Pasquale Striano6,7, Antonietta Coppola6, Regina Regan8, Sue M. Price9, Nine V. Knoers3, Peggy S. Eis2, Han G. Brunner3, Raoul C. Hennekam10, Samantha J.L. Knight8, Bert B.A. de Vries3, Orsetta Zuffardi4,11 and Evan E. Eichler1,12,*

1 Department of Genome Sciences, University of Washington School of Medicine, 1705 NE Pacific Street Seattle, WA 98195, USA, 2 NimbleGen Systems Inc., Madison, WI 53711, USA, 3 Department of Human Genetics, Nijmegen Centre for Molecular Life Sciences, Radboud University Nijmegen Medical Centre, Nijmegen, The Netherlands, 4 Biologia Generale e Genetica Medica, Università di Pavia, Pavia, Italy, 5 Citogenetica Ospedale Gaslini, Genova, Italy, 6 Dipartimento di Scienze Neurologiche, Università Federico II, Napoli, Italy, 7 Unità Neuromuscolare Ospedale Gaslini, Genova, Italy, 8 Oxford Genetics Knowledge Park, The Wellcome Trust Centre for Human Genetics, Churchill Hospital, Oxford, UK, 9 Department of Clinical Genetics, Oxford Radcliffe Hospitals NHS Trust, Churchill Hospital, Oxford OX3 7LJ, UK, 10 Clinical and Molecular Genetics Unit, Institute of Child Health, UCL, London, UK and Department of Pediatrics, AMC, University of Amsterdam, The Netherlands, 11 Fondazione IRCSS Policlinico San Matteo, Pavia, Italy and 12 Howard Hughes Medical Institute, 1705 NE Pacific Street Seattle, WA 98195, USA

* To whom correspondence should be addressed at: Department of Genome Sciences, University of Washington and Howard Hughes Medical Institute, Foege Building S413A, Box 355065, 1705 NE Pacific Street, Seattle, WA 98195, USA. Tel: +1 2065439526; Fax: +1 2066857301; Email: eee{at}gs.washington.edu


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
We describe multiple individuals with mental retardation and overlapping de novo submicroscopic deletions of 15q24 (1.7–3.9 Mb in size). High-resolution analysis showed that in three patients both proximal and distal breakpoints co-localized to highly identical segmental duplications (>51 kb in length, > 94% identity), suggesting non-allelic homologous recombination as the likely mechanism of origin. Sequencing studies in a fourth individual provided base pair resolution and showed that both breakpoints in this case were located in unique sequence. Despite the differences in the size and location of the deletions, all four individuals share several major features (growth retardation, microcephaly, digital abnormalities, hypospadias and loose connective tissue) and resemble one another facially (high anterior hair line, broad medial eyebrows, hypertelorism, downslanted palpebral fissures, broad nasal base, long smooth philtrum and full lower lip), indicating that this represents a novel syndrome caused by haploinsufficiency of one or more dosage-sensitive genes in the minimal deletion region. Our results define microdeletion of 15q24 as a novel recurrent genomic disorder.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
With the widespread use of array-based techniques for the measurement of DNA copy number, the list of human diseases that result from recurrent DNA rearrangements is steadily increasing (http://www.sanger.ac.uk/PostGenomics/decipher/). Termed genomic disorders, these are usually mediated by flanking blocks of duplicated sequence which predispose specific chromosomal regions to high frequencies of rearrangement via non-allelic homologous recombination (NAHR), leading to the deletion, duplication or inversion of the intervening sequence (1). Previously, we defined a region of chromosome 15q24 as a probable site of recurrent microdeletion associated with mental retardation (2). Here we report detailed studies of four patients with 15q24 deletions. Significantly, we show that all patients share a set of common congenital anomalies and that three of these four patients also share common deletion breakpoints that map to clusters of highly identical sequence, defining 15q24 as a site of recurrent microdeletion.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
All four patients were initially referred for clinical genetic testing, and the presence of 15q24 deletions were ascertained by CGH using either targeted (IMR349, IMR371) (2) or whole genome BAC (ID204) (3) or oligonucleotide arrays (C45/06, this study) (Agilent Technologies, Palo Alto, CA, USA), and subsequently confirmed by FISH (Supplementary Material, Fig. S1). On the basis of the resolution of BAC microarray and FISH studies, it was unclear whether these patients shared common breakpoints, constituting a recurrent microdeletion syndrome. We set out to characterize the breakpoints and the phenotypes of these four cases in greater detail.

In order to localize the breakpoints of each deletion, we designed a custom oligonucleotide array (NimbleGen Systems, Madison WI, USA) covering 7.5 Mb of 15q23–q25 (mean density, one probe per 147 bp). Results are shown in Figure 1A and Supplementary Material, Figure S2 and demonstrate that all four individuals carry overlapping deletions, defining a minimal region for this syndrome (hg17, chr15:72.15–73.85 Mb). Although the deletion in one individual appears atypical (IMR371, del chr15:70.40–74.21 Mb), the proximal breakpoints in the three other cases all map to a common region, which we designate breakpoint 1 (BP1). Two of these cases (IMR349 and C45/06, del chr15:72.15–76.01 Mb) also share a common distal breakpoint region (designated BP3), with an alternate distal breakpoint (BP2) in the third case (ID204, del chr15: 72.15–73.85 Mb). Comparison of the deletions with the reference assembly (http://genome.ucsc.edu/) shows that all three of these breakpoints occur in segmental duplication clusters (BP1, 32 pair-wise alignments spanning 68.5 kb; BP2, 74 pair-wise alignments spanning 174.3 kb; BP3, 66 pair-wise alignments spanning 141.9 kb, Supplementary Material, Fig. S2, http://humanparalogy.gs.washington.edu/). Notably, a shared 51–59 kb sequence is located precisely coincident with BP1, BP2 and BP3. Analysis of the reference assembly shows that while BP1 and BP3 share 51 kb of directly orientated sequence with 95% identity, the structure at BP2 is more complex, with a 59 kb sequence having split into multiple fragments in both direct and inverted orientation with an average of 94% identity to those at BP1 and BP3 (Fig. 1, Supplementary Material, Fig. S2).


Figure 1
View larger version (24K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 1. (A) Structural resolution of four 15q24 microdeletions using high-density oligonucleotide arrays (mean density, one probe per 147 bp). Each plot shows the log2 ratio (y-axis) for probes within hg17 (x-axis). The region shows a 6.5 Mb region of 15q23–q25.1 (chr15:70,000,000–76,500,000) containing overlapping deletions in four individuals, defining a minimal deletion region for this syndrome (hg17, chr15:72.15–73.85 Mb). For three of these rearrangements, the breakpoints map to clusters of flanking segmental duplications. A shared segmental duplication is present at BP1, BP2 and BP3 (>51 kb, > 94% identity, represented by green/red arrows, indicating identity to BP2 and BP3, respectively). Although the repeats at BP1 and BP2 are in direct orientation, the copy at BP2 is split into multiple fragments of both direct and inverted orientation. (B) Ultra-high resolution oligonucleotide array analysis of 135 kb (hg17, chr15:72 095 000–72 230 000) surrounding the common proximal breakpoint BP1 of the 15q24 microdeletion in the family of IMR349 (mean probe density, one probe per 4.3 bp). Pair-wise segmental duplication relationships between BP1 and BP2/BP3 are represented by green and red arrows, respectively. Previous studies have demonstrated the presence of a polymorphic ~30 kb VNTR motif at BP1 (4,5) (gray bar). Increased copy number of this VNTR in the parent in whom the deletion arose (IMR349 mother) is evident. Because of the presence of this polymorphic repeat and cross-hybridization of probes within the segmental duplication cluster, the exact extent of the deletion in IMR349 is difficult to define (solid/dashed black bar), but occurs in the interval chr15:72 145 000–72 180 000. For each individual, deviations of probe log2 ratios from zero are depicted by gray/black bars, with those exceeding a threshold of 1.5 standard deviations from the mean probe ratio colored green and red to represent relative gains and losses, respectively. Tracks above each plot indicate segmental duplications (gray/yellow/orange bars representing duplications with 90–98%/98–99%/99–100% sequence identity, respectively).

 
In order to further characterize the deletion breakpoints, we designed a second ultra-high density oligonucleotide array targeted specifically to BP1 and BP3 (mean density, one probe per 4.3 bp) (Fig. 1B). Although cross-hybridization of probes within the segmental duplication cluster made it difficult to define the exact extent of the deletion in IMR349, the proximal breakpoint occurs in the interval chr15:72 145 000–72 180 000. This breakpoint coincides exactly with a polymorphic ~30 kb variable number tandem repeat (VNTR) which shows increased copy number in the mother of IMR349 (4,5).

Oligonucleotide array analysis of the atypical deletion in IMR371 precisely localized both breakpoints, allowing PCR amplification and sequencing of the breakpoint junction (Fig. 2). This revealed that the deletion spans 3 810 551 bp (chr15:70 397 546–74 208 096) and that unlike the other three cases, both breakpoints were located within non-repetitive unique sequence with no apparent pair-wise homology.


Figure 2
View larger version (39K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 2. Sequencing of the breakpoint in patient IMR371 shows the deletion spans 3810551 bp in 15q24.1–q24.2 (hg17, chr15:70397546–74208096), with both breakpoints located in unique sequence with no apparent homology. Seven nucleotides (gagacag) 221 bp proximal to the deletion breakpoint were also deleted relative to the reference assembly, although the significance of this observation is unclear. Sequencing primers which spanned the microdeletion were designed directly from the results of the oligonucleotide array, which localized each breakpoint within 100–200 bp.

 
Parental DNA samples were available for three of the four patients described. In each case, array CGH showed that the deletions were de novo. Microsatellite marker analysis also demonstrated that all three deletions were of maternal origin (Table 1, data not shown). FISH analysis in the mother of C45/06 using probes outside and within the deletion region did not show any evidence for inversions of 15q24 (data not shown).


View this table:
[in this window]
[in a new window]

  		Table 1. Molecular and phenotype details of four 15q24 microdeletions

 
Detailed clinical examination of each case revealed that they share several major phenotypic features, including mild/moderate developmental delay, growth retardation, microcephaly, digital abnormalities, hypospadias and loose connective tissue, and also resemble one another facially (Table 1, Fig. 3, Supplementary Material, Fig. S3).


Figure 3
View larger version (63K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 3. Patient images of (A) IMR349, (B) ID204 and (C) IMR371. All four deletion cases share several major features (growth retardation, microcephaly, hypospadias, loose connective tissue) and resemble one another facially (high anterior hair line, broad medial eyebrows, hypertelorism, downslanted palpebral fissures, broad nasal base, long and smooth philtrum and full lower lip).

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Our analysis of several cases of 15q24 microdeletion defines a novel site of recurrent rearrangement associated with mental retardation and congenital anomalies. High-resolution mapping studies revealed that both proximal and distal breakpoints of three of these deletions co-localize to highly identical segmental duplications. The presence of a shared sequence located precisely at BP1, BP2 and BP3 suggests NAHR as the likely mechanism underlying these rearrangements. Thus, recurrent deletions of 15q24 are analogous to those of 15q11–q13 observed in Prader–Willi/Angelman syndrome, exhibiting a common proximal breakpoint and alternate distal breakpoints mapping to large, highly identical repeats (6).

A common phenotype is apparent for these 15q24 deletions, indicating that this could potentially represent a clinically identifiable syndrome (Table 1, Fig. 3). All cases presented with mild to moderate developmental delay, digital abnormalities and unusual facial features (high anterior hair line, broad medial eyebrows, hypertelorism, downslanted palpebral fissures, broad nasal base with flaring of alae nasi, long and smooth philtrum and full lower lip). Three of the four had a prenatal and postnatal growth deficiency, microcephaly, mild hypospadias, recurrent infections and loose connective tissue manifesting in joint laxity, scoliosis and inguinal hernia. Hearing loss, bowel atresia and growth hormone deficiency were also observed in two of the four individuals. We anticipate that this shared phenotypic spectrum will lead to the identification of additional cases of this syndrome.

Despite the differing extent of the deletions in our patients, the phenotypic similarities observed between all four cases suggest that the deletion of 15q24 may represent a clinically distinct entity and suggest that a haploinsufficient gene or genes within the minimal deletion region underlie this syndrome. This minimal region is gene rich, containing 32 RefSeq genes, making the identification of specific candidate genes difficult at this stage based on their currently known functions. Characterization of additional 15q24 deletion patients may help refine this critical region, potentially allowing the identification of the underlying gene(s) by mutation screening of phenotypically similar patients or mouse modeling approaches.

Array CGH and microsatellite analysis demonstrated that in all three cases where parental samples were available, the deletions were de novo and of maternal origin. Although the observation that all three deletions occur in the maternal lineage may simply be chance, our results do not exclude the possibility that genomic imprinting may underlie the deletion phenotype. However, no known imprinted genes reside within the deletions we describe (http://www.geneimprint.com/). Alternatively, if a parent-of-origin bias exists, it may indicate that the mechanism underlying deletions of 15q24 occurs preferentially in the maternal germline, as is observed for some other genomic disorders (7). Although it is not possible to accurately estimate the frequency of deletions of 15q24 from this study, the four cases we describe were ascertained by array CGH screening of ~1200 individuals with unexplained mental retardation and congenital anomalies.

There are several reports of deletions encompassing 15q24 in the literature (8), many of which show overlapping clinical features with the cases we describe here, including digital, genital, eye and ear abnormalities. However, from the available data, the breakpoints of these previously reported deletions appear distinct from the recurrent events that we describe. Although some deletions of 15q, such as that observed in IMR371, are likely sporadic events, chromosome 15q contains numerous clusters of highly identical segmental duplications, and we hypothesize that these likely mediate a number of different rearrangements of this region.

There is growing evidence that a number of chromosomal deletions and translocations occur preferentially on chromosomes with a predisposing polymorphic architecture (reviewed in 9). FISH testing in the mother of patient C45/06 did not provide any evidence for inversion of the deletion region, as has been shown to occur in the transmitting parent for a number of other recurrent genomic disorders (2,10–16). However, our observations are consistent with the possibility of an alternate predisposing architecture for these microdeletions. Previous studies have shown the presence of a polymorphic ~30 kb VNTR coincident with the common proximal breakpoint, BP1 (4,5). Our oligonucleotide array studies indicated the presence of increased copies of this BP1 tandem repeat motif in the mother of IMR349 (Fig. 1B). Although our array data do not provide allelic discrimination of VNTR copy number, we hypothesize that the presence of additional copies of this repeat on the parental chromosome on which the deletion arose may facilitate NAHR by increasing the length of perfect homology between BP1 and BP2/BP3, leading to an increased propensity for generation of the 15q24 microdeletion. A similar phenomenon is observed for the recurrent 11q23;22q11 translocation, in which length variation of palindromic repeats at the breakpoints results in altered translocation frequencies during meiosis (17). As structural variation is also apparent at the breakpoints of many other recurrent genomic disorders (18), we speculate that an altered propensity for the generation of de novo microdeletions/duplications as a result of variation in the flanking repeat structures which mediate these events may represent a common theme at other genomic loci. Concerted efforts, such as the detailed characterization of multiple transmitting parents of genomic disorder patients or sperm studies to determine specific rates of de novo rearrangement in individuals with different genomic architecture, will be necessary to test this hypothesis.

Our results define a novel genomic disorder at 15q24 associated with a distinct clinical phenotype. Although not observed in our study, the homology between BP2 and BP3 suggests that deletions of the intervening sequence may also occur. Because of the recurrent nature of 15q24 deletions, we also predict the existence of the reciprocal duplication products, although the phenotype, if any, associated with these rearrangements awaits identification.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
SUPPLEMENTARY MATERIAL
 REFERENCES
 
In order to localize the breakpoints of each microdeletion, we designed a custom oligonucleotide array (NimbleGen Systems), consisting of 51 140 probes covering 7.5 Mb of 15q23–q25 (mean density, one probe per 147 bp). Probe length varied from 45 to 70 bp to yield an isothermal array design (Tm=76°C), and probes whose sequence mapped to non-unique genomic locations were excluded. A second ultra-high density isothermal array composed of 93 765 probes covering 400 kb at the BP1 and BP3 regions (mean density, one probe per 4.3 bp) was also designed, with probes only excluded from any 15 bp window with > 100 identical genome-wide matches. All hybridizations were performed as described previously (19) and used the same reference individual as the BAC array hybridizations (GM15724, Coriell, Camden, NJ, USA). Oligonucleotide microarray data discussed in this publication are available at http://humanparalogy.gs.washington.edu/structuralvariation/.

Parental origin studies were performed using fluorescently labeled PCR of microsatellite markers mapping within the deletion region (D15S160, D15S984, D15S965; Operon Biotechnologies, Huntsville, AL, USA), resolved using an ABI3100 and analyzed using Genescan software. Sequencing primers (A: atgtggactagccgggatagag, B: gaaaaagtggcagcagtttcct) were designed using Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) and used to amplify across the deletion breakpoints in IMR371. Sequencing reactions (ABI BigDye v3.0; Applied Biosystems, Foster City, CA, USA) were cleaned using Exonuclease I/Shrimp Alkaline Phosphatase (New England Biolabs, Ipswich MA), followed by precipitation with ethanol/EDTA prior to separation using an ABI3100.

FISH studies for confirmation of each deletion and inversion studies of 15q24 were performed on fixed stimulated T-lymphocytes by standard techniques using BAC (RPCI-11 library) and fosmid (G248 library) clones mapping to 15q24.


   SUPPLEMENTARY MATERIAL
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
REFERENCES
 
Supplementary Material is available at HMG Online.


   ACKNOWLEDGEMENTS
 
This work was supported by NIH grant HD043569 (EEE), a fellowship from Merck Research Laboratories (AJS), funding from The Oxford Genetics Knowledge Park and The Health Foundation (RR, SJLK), ZonMW grants 907-00-058 (BBAdV); 912-04-047 (JAV, HGB) and 917-66-363 (JAV), and Fondazione Mariani and CARIPLO (OZ). EEE is an Investigator of the Howard Hughes Medical Institute.

Conflict of Interest statement. P.S.E. and R.R.S. are employees of NimbleGen Systems, Inc. and have stock options in the company.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 

  1. Stankiewicz P. and Lupski J.R. (2002) Genome architecture, rearrangements and genomic disorders. Trends Genet. 18:74–82.[CrossRef][Web of Science][Medline]

  2. Sharp A.J., Hansen S., Selzer R., Cheng Z., Regan R., Hurst J.A., Blair E., Hennekam R.C., Fitzpatrick C.A., Segraves R., et al. (2006) Discovery of previously unidentified genomic disorders from the duplication architecture of the human genome. Nat. Genet. 38:1038–1042.[CrossRef][Web of Science][Medline]

  3. de Vries B.B., Pfundt R., Leisink M., Koolen D.A., Vissers L.E., Janssen I.M., Reijmersdal S., Nillesen W.M., Huys E.H., Leeuw N., et al. (2005) Diagnostic genome profiling in mental retardation. Am. J. Hum. Genet. 77:606–616.[CrossRef][Web of Science][Medline]

  4. Goy A., Passalaris T., Xiao Y.H., Miller W.H., Siegel D.S., Zelenetz A.D. (1995) The PML gene is linked to a megabase-scale insertion/deletion restriction fragment length polymorphism. Genomics 26:327–333.[CrossRef][Web of Science][Medline]

  5. Gilles F., Goy A., Remache Y., Manova K., Zelenetz A.D. (2000) Cloning and characterization of a Golgin-related gene from the large-scale polymorphism linked to the PML gene. Genomics 70:364–374.[CrossRef][Web of Science][Medline]

  6. Amos-Landgraf J.M., Ji Y., Gottlieb W., Depinet T., Wandstrat A.E., Cassidy S.B., Driscoll D.J., Rogan P.K., Schwartz S., Nicholls R.D. (1999) Chromosome breakage in the Prader-Willi and Angelman syndromes involves recombination between large, transcribed repeats at proximal and distal breakpoints. Am. J. Hum. Genet. 65:370–386.[CrossRef][Web of Science][Medline]

  7. López Correa C., Brems H., Lazaro C., Marynen P., Legius E. (2000) Unequal meiotic crossover: a frequent cause of NF1 microdeletions. Am. J. Hum. Genet. 66:1969–1974.[CrossRef][Web of Science][Medline]

  8. Cushman L.J., Torres-Martinez W., Cherry A.M., Manning M.A., Abdul-Rahman O., Anderson C.E., Punnett H.H., Thurston V.C., Sweeney D., Vance G.H. (2005) A report of three patients with an interstitial deletion of chromosome 15q24. Am. J. Med. Genet. 137:65–71.

  9. Sharp A.J., Cheng Z., Eichler E.E. (2006) Structural variation of the human genome. Ann. Rev. Genomics Hum. Genet. 7:407–442.[CrossRef][Web of Science][Medline]

  10. Giglio S., Broman K.W., Matsumoto N., Calvari V., Gimelli G., Neumann T., Ohashi H., Voullaire L., Larizza D., Giorda R., et al. (2001) Olfactory receptor-gene clusters, genomic-inversion polymorphisms, and common chromosome rearrangements. Am. J. Hum. Genet. 68:874–883.[CrossRef][Web of Science][Medline]

  11. Osborne L.R., Li M., Pober B., Chitayat D., Bodurtha J., Mandel A., Costa T., Grebe T., Cox S., Tsui L.C., et al. (2001) A 1.5 million-base pair inversion polymorphism in families with Williams–Beuren syndrome. Nat. Genet. 29:321–325.[CrossRef][Web of Science][Medline]

  12. Gimelli G., Pujana M.A., Patricelli M.G., Russo S., Giardino D., Larizza L., Cheung J., Armengol L., Schinzel A., Estivill X., et al. (2003) Genomic inversions of human chromosome 15q11–q13 in mothers of Angelman syndrome patients with class II (BP2/3) deletions. Hum. Mol. Genet. 12:849–858.[Abstract/Free Full Text]

  13. Visser R., Shimokawa O., Harada N., Kinoshita A., Ohta T., Niikawa N., Matsumoto N. (2005) Identification of a 3.0-kb major recombination hotspot in patients with Sotos syndrome who carry a common 1.9-Mb microdeletion. Am. J. Hum. Genet. 76:52–67.[CrossRef][Web of Science][Medline]

  14. Kurotaki N., Stankiewicz P., Wakui K., Niikawa N., Lupski J.R. (2005) Sotos syndrome common deletion is mediated by directly oriented subunits within inverted Sos-REP low-copy repeats. Hum. Mol. Genet. 14:535–542.[Abstract/Free Full Text]

  15. Koolen D.A., Vissers L.E., Pfundt R., de Leeuw N., Knight S.J., Regan R., Kooy R.F., Reyniers E., Romano C., Fichera M., et al. (2006) A new chromosome 17q21.31 microdeletion syndrome associated with a common inversion polymorphism. Nat. Genet. 38:999–1001.[CrossRef][Web of Science][Medline]

  16. Shaw-Smith C., Pittman A.M., Willatt L., Martin H., Rickman L., Gribble S., Curley R., Cumming S., Dunn C., Kalaitzopoulos D., et al. (2006) Microdeletion encompassing MAPT at chromosome 17q21.3 is associated with developmental delay and learning disability. Nat. Genet. 38:1032–1037.[CrossRef][Web of Science][Medline]

  17. Kato T., Inagaki H., Yamada K., Kogo H., Ohye T., Kowa H., Nagaoka K., Taniguchi M., Emanuel B.S., Kurahashi H. (2006) Genetic variation affects de novo translocation frequency. Science 311:971.[Abstract/Free Full Text]

  18. Redon R., Ishikawa S., Fitch K.R., Feuk L., Perry G.H., Andrews T.D., Fiegler H., Shapero M.H., Carson A.R., Chen W., et al. (2006) Global variation in copy number in the human genome. Nature 444:444–454.[CrossRef][Medline]

  19. Selzer R.R., Richmond T.A., Pofahl N.J., Green R.D., Eis P.S., Nair P., Brothman A.R., Stallings R.L. (2005) Analysis of chromosome breakpoints in neuroblastoma at sub-kilobase resolution using fine-tiling oligonucleotide array CGH. Genes Chromosomes Cancer 44:305–319.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Hum Mol GenetHome page
L. E.L.M. Vissers, S. S. Bhatt, I. M. Janssen, Z. Xia, S. R. Lalani, R. Pfundt, K. Derwinska, B. B.A. de Vries, C. Gilissen, A. Hoischen, et al.
Rare pathogenic microdeletions and tandem duplications are microhomology-mediated and stimulated by local genomic architecture
Hum. Mol. Genet., October 1, 2009; 18(19): 3579 - 3593.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
B W M van Bon, H C Mefford, B Menten, D A Koolen, A J Sharp, W M Nillesen, J W Innis, T J L de Ravel, C L Mercer, M Fichera, et al.
Further delineation of the 15q13 microdeletion and duplication syndromes: a clinical spectrum varying from non-pathogenic to a severe outcome
J. Med. Genet., August 1, 2009; 46(8): 511 - 523.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
F. Antonacci, J. M. Kidd, T. Marques-Bonet, M. Ventura, P. Siswara, Z. Jiang, and E. E. Eichler
Characterization of six human disease-associated inversion polymorphisms
Hum. Mol. Genet., July 15, 2009; 18(14): 2555 - 2566.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. Rev.Home page
M. Dierssen, Y. Herault, and X. Estivill
Aneuploidy: From a Physiological Mechanism of Variance to Down Syndrome
Physiol Rev, July 1, 2009; 89(3): 887 - 920.
[Abstract] [Full Text] [PDF]

Home page
 J AndrolHome page
H. M. Wood, U. J. Lee, D. Vurbic, E. Sabanegh, J. H. Ross, T. Li, and M. S. Damaser
Sexual Development and Fertility of Loxl1-/- Male Mice
J Androl, July 1, 2009; 30(4): 452 - 459.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
C. N. Henrichsen, E. Chaignat, and A. Reymond
Copy number variants, diseases and gene expression
Hum. Mol. Genet., April 15, 2009; 18(R1): R1 - R8.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
F D Hannes, A J Sharp, H C Mefford, T de Ravel, C A Ruivenkamp, M H Breuning, J-P Fryns, K Devriendt, G Van Buggenhout, A Vogels, et al.
Recurrent reciprocal deletions and duplications of 16p13.11: the deletion is a risk factor for MR/MCA while the duplication may be a rare benign variant
J. Med. Genet., April 1, 2009; 46(4): 223 - 232.
[Abstract] [Full Text] [PDF]

Home page
 NEJMHome page
H. C. Mefford, A. J. Sharp, C. Baker, A. Itsara, Z. Jiang, K. Buysse, S. Huang, V. K. Maloney, J. A. Crolla, D. Baralle, et al.
Recurrent Rearrangements of Chromosome 1q21.1 and Variable Pediatric Phenotypes
N. Engl. J. Med., October 16, 2008; 359(16): 1685 - 1699.
[Abstract] [Full Text] [PDF]

Home page
 GeneticsHome page
A. Duchon, V. Besson, P. L. Pereira, L. Magnol, and Y. Herault
Inducing Segmental Aneuploid Mosaicism in the Mouse Through Targeted Asymmetric Sister Chromatid Event of Recombination
Genetics, September 1, 2008; 180(1): 51 - 59.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrowOA All Versions of this Article:
16/5/567    most recent
ddm016v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (35)
Google Scholar
Right arrow Articles by Sharp, A. J.
Right arrow Articles by Eichler, E. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sharp, A. J.
Right arrow Articles by Eichler, E. E.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?