Skip Navigation


Human Molecular Genetics Advance Access originally published online on February 26, 2007
Human Molecular Genetics 2007 16(8):907-918; doi:10.1093/hmg/ddm035
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/8/907    most recent
ddm035v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Whiteman, P.
Right arrow Articles by Handford, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Whiteman, P.
Right arrow Articles by Handford, P. A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Cellular and molecular studies of Marfan syndrome mutations identify co-operative protein folding in the cbEGF12–13 region of fibrillin-1

Pat Whiteman1, Antony C. Willis2, Andrew Warner1, James Brown1, Christina Redfield1 and Penny A. Handford1,*

1 Department of Biochemistry and 2 Medical Research Council Immunochemistry Unit, University of Oxford, South Parks Road, Oxford OX1 3QU, UK

* To whom correspondence should be addressed. Tel: +44 1865285347; Fax: +44 1865285327; Email: penny.handford{at}bioch.ox.ac.uk

Received January 11, 2007; Accepted February 18, 2007


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Human fibrillin-1 is an extra-cellular matrix glycoprotein with a modular organisation that includes 43 calcium-binding epidermal growth factor-like (cbEGF) domains arranged as multiple tandem repeats interspersed with transforming growth factor ß binding protein-like (TB) domains. We have studied Marfan syndrome-causing mutations which affect calcium binding to cbEGF13, and demonstrate that in human fibroblast cells they cause unexpected endoplasmic reticulum retention, indicative of a folding defect. Biochemical and biophysical studies of in vitro refolded fragments from the TB3-cbEGF14 region indicate long-range and unidirectional effects of these substitutions on the adjacent N-terminal domain cbEGF12. In contrast, only short-range effects of a pathogenic mutation affecting calcium binding to cbEGF19 are observed, and secretion of this mutant protein occurs. Further NMR studies on wild-type cbEGF12–13 and cbEGF12–14 identify a co-operative dependence of domain folding where calcium binding to cbEGF13 is required before cbEGF12 can adopt a native Ca2+-dependent fold. These data demonstrate that during biosynthesis of fibrillin-1, multiple tandem repeats of cbEGF domains may not necessarily fold independently and therefore missense mutations resulting in identical substitutions may have different effects on the fate of the mutant protein. Complex folding of modular proteins should therefore be considered when interpreting the molecular pathology of single-gene disorders.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Human fibrillin-1 is a 350 kDa modular glycoprotein (Fig. 1) and a major component of the 10–12 nm extra-cellular matrix (ECM) microfibrils (1). Mutations in the gene for fibrillin-1 (FBN1) cause Marfan syndrome (MFS), OMIM #154700, an autosomal dominant hereditary disorder of connective tissue (2). The disease has prominent manifestations in the skeletal, ocular and cardiovascular systems and exhibits significant phenotypic variability ranging from a severe neonatal form (nMFS) to abnormalities in individual organ systems (related disorders) (reviewed in 3,4). The use of mouse models has demonstrated that a critical threshold of microfibrils is needed to maintain normal connective tissue function (5–7). This is, in part, due to the structural role of microfibrils in the maintenance of cell–matrix interactions, but also due to their modulation of transforming growth factor-ß (TGF-ß) levels in ECM via the binding of the TGF-ß binding proteins (LTBPs) to fibrillin-1 (8,9). Both haploinsufficiency and dominant negative mechanisms of pathogenesis have been proposed for MFS, consistent with the range of fibrillin-1 biosynthetic and secretory defects observed in patient-derived fibroblast lines (10–13).


Figure 1
View larger version (18K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 1. The domain organization of fibrillin-1. The cbEGF domains are arranged as multiple tandem repeats separated usually by a single TB domain. Other domains include two hybrid domains which contain characteristics of both the EGF and TB domains, a proline-rich region and unique N- and C-termini. The positions of the neonatal region and the constructs studied here are indicated. Constructs expressed as His-tag fusion proteins, purified and refolded in vitro are indicated above the fibrillin-1 illustration and the eukaryotic expression fragment indicated below. An asterisk shows the position of cbEGF13.

 
The most common module type in fibrillin-1 is the epidermal growth factor-like (EGF) domain, which is approximately 45 residues in length and characterized by six highly conserved cysteine residues that form three intra-domain disulphide bonds and stabilize the global domain fold. For 43 of the 47 EGF domains in fibrillin-1 an additional consensus sequence confers on the domain the ability to bind Ca2+ (Fig. 2) (14). The bound calcium, together with a hydrophobic packing interaction, performs a key structural role in restricting inter-domain flexibility that may facilitate protein–protein interactions (15–17) and also protects the domains against proteolytic cleavage (18,19).


Figure 2
View larger version (27K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 2. Schematic representation of cbEGF13. Conserved cysteine residues involved in the formation of intramolecular disulphide bonds are coloured yellow. Calcium binding in the N-terminal region of the wild-type domain is mediated by the consensus sequence shown in red, (D/N)-X-(D/N)(E/Q)Xm(D/N)*Xn(Y/F) (m and n are variables, and asterisk denotes a potential site for ß-hydroxylation). The serine residue on the central ß-sheet may also donate a ligand (14). The substitutions in cbEGF13 studied here are indicated. The positions corresponding to E1073K in cbEGF12 and N1382S in cbEGF19 are also shown in parentheses.

 
In common with other genetic disorders, missense mutations account for a major fraction (~60%) of pathogenic mutations associated with MFS which currently number greater than 600 (http://www.umd.be) (20,21). The majority of these are localized to cbEGF domains, and include those which result in substitution of calcium-binding residues or cysteine residues involved in the formation of disulphide bonds. Recent studies have suggested some emerging phenotype–genotype correlations (22–25), but the most striking remains a clustering of mutations that cause nMFS in exons 24–32 encoding TB3 and cbEGF11–18 (26). However, mutations which cause classic MFS as well as milder phenotypes are also found in this region. The phenotypic diversity observed in this region, in particular in cbEGF13, suggests that it plays a critical role in fibrillin-1 folding, early assembly or interactions with other matrix components.

Here we present cellular trafficking, biochemical and biophysical studies of FBN1 missense mutations in cbEGF13 which affect the cbEGF consensus residues involved in calcium binding (Fig. 2). D1113G and N1131Y affect side-chain ligands for the same calcium ion and give rise to classic MFS (27) and nMFS (28), respectively, while D1115G is involved in stabilization of the calcium-binding site and gives rise to classic disease (26). From previous studies, one would predict that a dominant negative pathogenic mechanism would underlie substitutions affecting calcium binding and involve normal trafficking and secretion of the mutant protein to the ECM, since the global fold of the cbEGF domain should not be affected. Here we demonstrate that in a eukaryotic recombinant expression system these substitutions in cbEGF13 cause unexpected endoplasmic reticulum (ER) retention consistent with a protein-folding defect. To understand the structural basis for retention of these proteins, the substitutions have been introduced into multi-domain constructs expressed in a prokaryotic system and refolded in vitro. Their molecular properties have been compared with those of the wild-type constructs by limited proteolysis, chemical chelation and NMR analysis. Our data demonstrate that cbEGF13 calcium-binding substitutions result in long-range and unidirectional structural effects on this region by impairing the folding of cbEGF12 and indicate a previously unrecognized dependence of domain folding on the adjacent module. These findings differ from those we observe for a pathogenic mutation, N1382S (29), affecting calcium binding in cbEGF19, which causes short-range structural effects and results in normal secretion. These structural data provide an explanation for the different trafficking effects associated with apparently identical substitutions in cbEGF domains and indicate that complex folding behaviour must be considered when interpreting the effects of missense mutations on cbEGF domains in fibrillin-1 and other modular proteins.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Substitution of residues involved in calcium binding to cbEGF13 result in ER retention
The trafficking of recombinant fragments was investigated in the MSU-1.1 human fibroblast cell line which has been shown to assemble extra-cellular microfibrils, and contains all the cellular factors required for fibrillin-1 folding, processing, secretion and assembly (30). A fibrillin-1 cDNA fragment encoding the N-terminus to the proline-rich region was cloned into the pKG52(poly A) expression vector, as previously described (31). A second fragment encoding wild-type cbEGF11–22, or cbEGF11–22 containing pathogenic calcium-binding substitutions D1113G, D1115G, N1131Y(S) all in cbEGF13, E1073K in cbEGF12 and N1382S in cbEGF19, was cloned downstream of the N-terminal fragment (Figs 1 and 2). SDS–PAGE of conditioned medium from pools of transfected clones followed by western blot analysis with an antibody raised against the proline-rich region of fibrillin-1 is shown in Figure 3A. The wild-type NterPro-cbEGF11–22 construct was detected in the conditioned medium. However, no fragment was evident in the medium in the case of D1113G, D1115G, N1131Y or N1131S. In contrast, E1073K in cbEGF12 (data not shown) and N1382S in cbEGF19, were detectable at levels comparable with that of the wild-type fragment.


Figure 3
View larger version (28K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 3. MSU-1.1 expression of the NterPro-cbEGF11–22 wild-type and mutant-containing fragments. Conditioned media and cell lysate samples were analysed on 4–15% gradient SDS–PAGE under reducing conditions followed by western blot analysis and detection with anti-Pro antibody. Molecular masses (kilo Daltons) of marker proteins are indicated. (A) The recombinant fragment was detected in the media samples of the wild-type (wt) and N1382S pools of clones but not from the D1113G, D1115G, N1131Y or N1131S pools. (B) Although undetectable in the conditioned medium, NterPro-cbEGF11–22 D1115G is present in the cell lysate. D1113G and N1131Y(S) behave similarly (data not shown). (C) The retained NterPro-cbEGF11–22 D1115G fragment, as well as the wild-type fragment detectable in the cell, are sensitive to Endo H. (D) Summary of the fate of the NterPro-cbEGF11–22 calcium-binding mutant fragments studied here. The secretion of the G1127S folding substitution was described previously (31).

 
Western blot analysis of the cell lysate fractions of pools of clones containing D1113G, D1115G, N1131Y or N1131S showed that these fragments were expressed but retained inside the cell to high levels (this is illustrated for D1115G in Fig. 3B). We reported previously (31) that the wild-type NterPro-cbEGF11–22 construct detected in conditioned medium is N-glycosylated. As a consequence it displays susceptibility to hydrolysis by Peptide: N-Glycosidase F (PNGase F), which hydrolyses nearly all types of N-glycan chains from glycoproteins but is resistant to Endoglycosidase H (Endo H), which cleaves only simple sugars, not the more complex glycosylation structures. In contrast to the secreted wild-type, the intracellular wild-type and the D1113G, D1115G, N1131Y or N1131S retained fragments showed a reduction in molecular weight to the deglycosylated form on both Endo H and PNGase F treatment and therefore contain only simple carbohydrate structures (the effect of Endo H on intracellular wild-type and D1115G is shown in Figure 3C). This is consistent with retention in the ER compartment, where simple sugar addition takes place. A summary of the expression profiles of the NterPro-cbEGF11–22 constructs containing the calcium-binding substitutions studied here is shown in Figure 3D.

Purification of wild-type and mutant constructs from the TB3-cbEGF11–14 and cbEGF18–20 regions
The observed ER retention associated with the cbEGF13 substitutions suggests that protein misfolding is the cause of the underlying defect. To probe their structural effects, we have placed each substitution in a native context in triple and multi-domain constructs that have been expressed in a prokaryotic system and refolded in vitro essentially as described previously (32–34). The purified in vitro refolded constructs were analysed on non-reducing and reducing SDS–PAGE and showed the presence of a single protein species. The experimental molecular masses, determined by electrospray mass spectrometry, agreed well with the predicted values confirming the identity of the purified constructs (Supplementary Material, Table S1).

Native folding of cbEGF domains in the wild-type constructs was confirmed by NMR analysis and limited proteolysis (see below). NMR analysis also confirmed native folding of TB3 in the TB3-cbEGF11–13 wild-type and D1115G constructs by the presence of two structural markers associated with the TB fold that have been identified previously (35) in NMR spectra of wild-type TB3-cbEGF11 (data not shown).

Limited proteolysis indicates a long-range N-terminal effect of cbEGF13 calcium-binding substitutions
Fibrillin-1 cbEGF domains are resistant to in vitro proteolysis in the presence of Ca2+. However, a number of substitutions have been shown to increase susceptibility to proteolysis (19,36) and this technique can be used to identify their structural effects on each domain (34,37). SDS–PAGE analysis of tryptic digests of cbEGF12–14 constructs showed Ca2+-dependent protection (50 mM) of the wild-type but not the mutant constructs (Fig. 4A and B). N-terminal sequence analysis (Supplementary Material, Table S2) of digestion products from wild-type cbEGF12–14 in the presence of EGTA (25 mM) identified the same cleavage sites as were observed in a previous study (34) in both cbEGF12 and cbEGF14 and all sites displayed a Ca2+-dependent protection. In contrast, the three mutant constructs (D1113G, N1131Y and N1131S) investigated here did not show protection of the sites in the N-terminal domain (cbEGF12), although sites in cbEGF14 were protected as in the wild-type protein. The locations of the cleavage sites are mapped on to the structure of cbEGF12–14 in Figure 5A.


Figure 4
View larger version (42K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 4. Trypsin digestion of wild-type and mutant triple constructs. Samples were analysed on 16% SDS–PAGE under reducing conditions after 30 min digestion in the presence of CaCl2 (50 mM) or EGTA (25/50 mM) followed by Coomassie staining. (A and B) The cbEGF12–14 wild-type (wt) construct is protected by Ca2+, however the (A) D1113G (DG) and (B) N1131Y (NY) constructs demonstrated a loss of protection by Ca2+. (C) The cbEGF18–20 wild-type (wt) and N1382S (NS) constructs both show a reduced level of digestion in the presence of Ca2+ indicative of the protection afforded by Ca2+-binding. Molecular masses (kilo Daltons) of marker proteins are indicated.

 


Figure 5
View larger version (28K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 5. Schematic representations of (A) the TB3-cbEGF11–14 region and (B) cbEGF18–20 to show tryptic cleavage sites. The positions of calcium ions bound in wild-type constructs (red) and aromatic residues used as structural markers for NMR analysis—tyrosine (blue), phenylalanine (green) and histidine (grey) are indicated. The mutated residues are indicated in red. Disulphide bonds of cbEGF11, 12 and 13 are indicated by dashed lines as they may not form correctly in the mutant constructs. Tryptic digestion was carried out on wild-type and mutant constructs in the presence of 25/50 mM EGTA or 50 mM CaCl2. The sites that lose calcium protection in the mutant constructs are shown as black arrows. The sites that show calcium protection in both wild-type and mutant constructs are shown as white arrows. Additional cleavage sites identified in the mutant constructs are indicated with asterisks. The site 1126GGVCH in cbEGF13 was only revealed in TB3-cbEGF11–13 mutant digests.

 
In order to determine the extent of disruption in the N-terminal direction by the calcium-binding substitutions in cbEGF13 and to confirm that the observed effects on cbEGF12 are similar when this domain is placed in a native context, the larger TB3-cbEGF11–13 construct was also subjected to tryptic digestion. SDS–PAGE analysis (data not shown) again showed a protection by calcium for the wild-type construct but not for the D1115G or N1131Y constructs. The cleavage sites identified by N-terminal sequence analysis for this larger construct are shown in Supplementary Material, Table S3. The wild-type TB3-cbEGF11–13 in the presence of EGTA (50 mM) displays the same sites in cbEGF12 as revealed in cbEGF12–14 and calcium-dependent protection from proteolysis of these sites was observed. Significantly, as demonstrated above for the triple construct, the introduction of a calcium-binding substitution into cbEGF13 of TB3-cbEGF11–13 again abolished the protection by calcium of these sites in cbEGF12. In cbEGF11, sites 1046NTIGSFKC, 1053CRCDSGFA and 1055CDSGFALD which were protected by calcium in the wild-type TB3-cbEGF11–13, lost protection in the TB3-cbEGF11–13 D1115G and N1131Y constructs (Fig. 5A). Other novel trypsin cleavage sites observed in the mutants but not the wild-type construct appear in cbEGF11 (1028DINECK) and cbEGF13 (1126GGVCH) and may indicate the presence of a non-native fold in these domains.

In contrast to the cbEGF12–14 mutant constructs, analysis of the calcium-binding substitution, N1382S, introduced into cbEGF19 of cbEGF18–20, demonstrated protection against digestion by calcium (Fig. 4C). N-terminal sequence analysis of cbEGF18–20 wild-type and N1382S constructs (Supplementary Material, Table S4) showed cleavage sites in domains 18 and 19 and all sites were protected by Ca2+. The protection observed in cbEGF19 of the N1382S mutant domain can be attributed to the low-affinity Ca2+-binding, which is retained in the mutant (see below). The positions of these cleavage sites are mapped on to a schematic structure of cbEGF18–20 in Figure 5B. These experiments reveal significant qualitative differences between the calcium-binding substitutions in cbEGF19 and cbEGF13, with the effects of N1382S confined to the mutant domain. This is not due to the difference in charge of the amino acid substituted in cbEGF19, since the protein engineered N1131S gave identical results to the other cbEGF13 mutants studied (Supplementary Material, Table S2). Given the fact that these proteolysis studies demonstrate a long-range effect of each cbEGF13 substitution on cbEGF12, suggesting a loss of the Ca2+-dependent native fold in this domain despite the fact that it has the native sequence, one may speculate that protein misfolding underlies the trafficking defects observed.

Chemical chelation provides Kd values for high-affinity Ca2+-binding sites in wild-type and mutant constructs
Calcium titration assays with the chromophoric chelator, 5,5'-Br2BAPTA were used in conjunction with NMR to provide domain-specific Kd values of high-affinity Ca2+-binding sites of wild-type and mutant constructs (Fig. 6). These data provided further detailed insight into the extent of disruption introduced by the calcium-binding substitutions than obtainable from proteolysis alone.


Figure 6
View larger version (11K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 6. Representative Ca2+ titration curves of cbEGF12–14 wild-type and mutant constructs in the presence of 5,5'-Br2BAPTA. The figure shows titration of 27 µM 5,5'-Br2BAPTA alone (open squares), and 5,5'-Br2BAPTA plus 22.0 µM cbEGF12–14 wild-type (closed squares), 25.0 µM cbEGF12–14 G1127S (open triangles), 22.5 µM cbEGF12–14 D1115G (open circles) and 23.0 µM cbEGF12–14 D1113G (closed circles).

 
Wild-type cbEGF12–14 contained two high-affinity calcium-binding sites, which on the basis of previous studies (32,38) could be assigned to cbEGF13 and cbEGF14 (Table 1). The cbEGF12–14 D1113G, D1115G and N1131Y constructs were each found to have only a single high-affinity calcium-binding site in cbEGF14, consistent with the introduction of a substitution predicted to reduce calcium binding to cbEGF13. The titration curve for a previously studied folding substitution, G1127S in cbEGF13, appeared more like that of the wild-type protein than did those for the Ca2+-binding mutants (Fig. 6) and the data gave a good fit to a model with two high-affinity calcium-binding sites demonstrating that this mutant is able to bind calcium in both cbEGF13 and cbEGF14. This is consistent with previous data obtained from proteolysis which showed that cleavage sites in cbEGF12, cbEGF13 and cbEGF14 were protected by calcium despite the presence of the G1127S substitution (34).


View this table:
[in this window]
[in a new window]

  		Table 1. Summary of Kd values (expressed as mean ± SD) obtained by chemical chelation and NMR (denoted by asterisk) for wild-type (wt) and mutant cbEGF12–14 constructs

 
The wild-type TB3-cbEGF11–13 fragment could be fitted to a model with three calcium-binding sites with Kd values of 4, 7 and 18 µM. High-affinity calcium binding in the range that is measurable with 5,5'-Br2BAPTA was not detected for the TB3-cbEGF11–13 D1115G construct.

The wild-type cbEGF18–20 construct showed only one high-affinity calcium-binding site with a Kd value of 1.4 ± 0.2 µM (n = 3) expressed as mean ± SD. This high-affinity site was lost in cbEGF18–20 N1382S and can therefore be assigned to the cbEGF19 domain; this was subsequently confirmed by NMR analysis (see below).

NMR analysis identifies a low-affinity calcium-binding site in cbEGF12 of the wild-type, but not the D1115G, cbEGF12–14 construct
Previously, we have used shifts of NMR resonances assigned to the calcium-binding consensus aromatic residue to quantitate the low-affinity calcium binding typically observed in cbEGF domains located at the N-terminus of a multidomain fragment. In this study we monitored F1093 (Fig. 5A) to gain insight into the loss of structural integrity of cbEGF12 revealed by proteolysis experiments. Residue F1093 in cbEGF12 gives rise to two peaks, H{delta} and H{epsilon}, that can be monitored in 1D NMR spectra of wild-type cbEGF12–14 (Fig. 7A). Chemical shift changes of these peaks were monitored as the calcium concentration was raised from 0.6 to 35 mM. The changes in chemical shift of F1093 allowed a Kd value of 1.8 mM to be assigned to cbEGF12. This is similar to a published value of 1.6 mM determined for the cbEGF12–13 pair and is as expected for an N-terminal cbEGF domain (38). The absence of a chemical shift change for F1093 in the spectrum of D1115G cbEGF12–14 indicates that calcium binding is abolished in cbEGF12, despite the fact that this domain has a native sequence (Fig. 7B).


Figure 7
View larger version (27K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 7. A comparison of the aromatic regions of one-dimensional 1H NMR spectra of the cbEGF12–14 wild-type (A) and D1115G (B) constructs. Spectra were collected with 0.3 mM protein and with 0, 0.6, 3.6, 10 and 35 mM Ca2+ as indicated. The H{delta} and H{varepsilon} resonances of F1093, Y1101, Y1136 and Y1178 are indicated with purple, green, blue and red lines, respectively. The resonances arising from H1144 are indicated with grey arrows. (A) Changes in the positions of the resonances arising from Y1101/Y1136 (green/blue) and H1144/Y1178 (grey/red) observed upon the addition of 0.6 mM Ca2+ in the wild-type spectrum are indicative of high-affinity Ca2+ binding in domains 13 and 14, respectively. The change observed for the resonances of F1093 (purple) with 0.6 mM Ca2+ in the wild-type spectrum results from the conformational change in domain 12 induced by high-affinity Ca2+ binding in domain 13. The gradual shifts in the resonances of F1093 (purple) as Ca2+ is increased from 0.6 mM to 35 mM arise from low-affinity Ca2+ binding in domain 12. (B) Changes in the positions of the resonances of H1144/Y1178 (grey/red) observed upon the addition of 0.6 mM Ca2+ in the D1115G spectrum are indicative of high-affinity Ca2+ binding in domain 14. The absence of chemical shift changes for Y1101/Y1136 (green/blue) upon the addition of Ca2+ indicate that domain 13 does not bind calcium in D1115G. In addition, the absence of chemical shift changes for F1093 (purple) indicates that calcium binding to domain 12 is also lost in D1115G.

 
Domain-specific assignments of Kd values to wild-type and mutant cbEGF12–14 constructs by NMR
NMR analysis was used to confirm the domain-specific assignments of Kd values obtained by chelation analysis and provide further insight into the structural effects of cbEGF13 substitutions. Figure 7A shows that cbEGF13 binds calcium with high affinity in the wild-type protein as demonstrated by changes in the chemical shifts of Y1136, the consensus Ca2+-binding residue in cbEGF13, and of Y1101, the packing residue in cbEGF12, on going from 0 to 0.6 mM Ca2+. In the spectrum of the D1115G mutant (Fig. 7B) the absence of chemical shift changes for Y1101 and Y1136, confirms the loss of Ca2+ binding in cbEGF13, the site of the D1115G mutation.

In the spectrum of the wild-type construct (Fig. 7A), the observed change in chemical shift for the peak arising from Y1178, the marker for calcium binding to cbEGF14 and of H1144, the packing residue in cbEGF13, on going from 0 to 0.6 mM Ca2+ is indicative of high-affinity binding. The spectrum of the D1115G mutant (Fig. 7B) shows that these peaks have shifted in the same way on going from 0 to 0.6 mM Ca2+ and confirms the retention of high-affinity Ca2+-binding in cbEGF14 and the formation of an inter-domain packing interaction between cbEGF13 and cbEGF14. NMR analyses with cbEGF12–14 containing an N1131S substitution produced analogous results (data not shown) also demonstrating a loss of Ca2+ binding in cbEGF12 and 13 with retention of high-affinity binding in cbEGF14. These data thus allow domain-specific assignments of Kd values obtained by chelation to cbEGF12–14, and indicate a loss of calcium binding to both cbEGF12 and cbEGF13 in the cbEGF13 mutants.

NMR analysis of wild-type cbEGF18–20 and the N1382S mutant demonstrates Ca2+ binding to cbEGF18, cbEGF19 and cbEGF20
The NMR spectrum for cbEGF18–20 wild-type (Fig. 8A) shows high-affinity behaviour for Y1387, which allows the 1.4 µM Kd, determined by chelation, to be assigned to cbEGF19. The change in chemical shift of resonances assigned to F1346 and Y1427, the calcium-binding consensus aromatic residues at the N-terminus of cbEGF18 and cbEGF20, respectively, gave Kd values of 3.6 mM and 60 µM for these domains in the cbEGF18–20 wild-type construct. In the spectrum of the N1382S mutant (Fig. 8B) chemical shift changes for F1346 and Y1427 indicate Ca2+ affinities close to wild-type values (3.9 mM and 58 µM). The consequences of this substitution are thus confined to the mutant domain and differ from the long-range effects of calcium-binding substitutions in cbEGF13. Further, the observed chemical shift change for Y1387 indicates that weak Ca2+ binding, with a Kd value of 14 mM, is maintained in cbEGF19 despite the N1382S substitution. This low-affinity binding explains the Ca2+-dependent protection against proteolysis of a cleavage site in cbEGF19.


Figure 8
View larger version (17K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 8. Aromatic region of two-dimensional 1H NMR spectra of the cbEGF18–20 wild-type (A) and N1382S (B) constructs. Two-dimensional NOESY spectra were recorded at varying concentrations of CaCl2; spectra in the absence of Ca2+ (black) and in the presence of 25 mM Ca2+ (red) are overlaid. The observed shifts for F1346, Y1387 and Y1395/Y1427 are indicative of Ca2+ binding in cbEGF18, cbEGF19 and cbEGF20, respectively. The shifts for Y1387, observed at low Ca2+ concentrations in wild-type cbEGF18–20 are indicative of high-affinity binding in cbEGF19. In the N1382S mutant construct similar changes are observed for Y1387, but only at higher Ca2+ concentrations; this represents a significant weakening (104) of Ca2+ affinity in cbEGF19.

 
Evidence for Ca2+-dependent co-operative folding of cbEGF12
Our data for mutant constructs indicate that loss of calcium binding to cbEGF13 prevents cbEGF12 adopting a Ca2+-dependent fold, suggesting that cbEGF12 does not fold independently. If correct, then NMR analysis of calcium binding to wild-type constructs containing cbEGF12 and 13 should reveal evidence for ordered structural changes in this region. The changes in chemical shift of peaks assigned to F1093, the consensus aromatic residue in cbEGF12, in the cbEGF12–13 and cbEGF12–14 wild-type constructs are associated with the low-affinity binding to cbEGF12 (see above). However, it was noted that on the addition of small amounts of calcium there were unexpected changes in the peaks arising from F1093 in both cbEGF12–13 (data not shown) and cbEGF12–14 (Fig. 7A). The addition of calcium early in the titration should lead to changes in the peaks arising from residues associated with high-affinity binding rather than those involved in low-affinity binding. The changes in the peaks of F1093 observed in the spectra at low calcium concentrations indicate that residues close to the N-terminus of cbEGF12 are affected by the high-affinity calcium binding in cbEGF13. We propose that calcium binding to cbEGF13 causes a conformational change in the interface between cbEGF12 and cbEGF13 and that this change is essential to stabilize cbEGF12 allowing it to bind calcium. In the absence of calcium binding to cbEGF13 this conformational change does not occur and cbEGF12 is also unable to bind calcium.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 
Our study has revealed that pathogenic mutations which affect calcium binding to cbEGF13 of fibrillin-1 cause unexpected ER retention of the mutant protein, consistent with a protein folding defect, while an identical mutation affecting cbEGF19 results in secretion. Since genetic mutations affecting calcium binding to cbEGF domains are a common cause of disease and may affect a variety of different proteins, the molecular basis for these trafficking effects was investigated. On detailed analysis of purified recombinant fragments it was found that the mutant proteins associated with ER retention not only demonstrated loss of calcium binding to cbEGF13 but also to cbEGF12. Since calcium binding is a marker for the correct fold of a cbEGF domain, these data indicated that cbEGF12 was unable to adopt a Ca2+-dependent fold as a consequence of the cbEGF13 substitution.

Our data are consistent with a post-translational, rather than co-translational model of folding for this region and suggest that cbEGF13 adopts its native fold earlier than cbEGF12 despite the fact that it is C-terminal to cbEGF12 and would be synthesized later. Evidence for this was provided by analysing the early stages in the binding of Ca2+ to cbEGF12 and 13 by NMR and demonstrating that residue F1093, located close to the low-affinity calcium-binding site in cbEGF12, showed a conformational change as calcium was bound to the high-affinity site in cbEGF13. It is hypothesized that the conformational change in the interface between cbEGF12 and 13 stabilizes cbEGF12 allowing it to bind calcium. In keeping with this post-translational model, if the cbEGF13 domain is unable to bind calcium due to the effect of a mutation this conformational change will not occur and cbEGF12 will also be unable to bind calcium, thus resulting in a protein-folding defect. Such co-operative Ca2+-dependent folding of cbEGF12 is substantiated by our molecular and cellular data for the calcium-binding substitutions in cbEGF13. In contrast to the effects of the calcium-binding substitutions, cbEGF13 in the G1127S mutant construct is still able to bind calcium although with a reduced affinity. This site is still likely to be saturated in vivo due to the high concentrations of Ca2+ in the ER, thus facilitating cbEGF12 folding and resulting in this mutant's observed normal secretion from the fibroblast (31). Our proteolytic data for TB3-cbEGF11–13, demonstrating loss of protection to cleavage sites in cbEGF11, also suggest that cbEGF11 is affected by cbEGF13 substitutions, although the inability to examine this construct in detail by NMR due to size constraints prevented us from conclusively demonstrating the absence of a Ca2+-dependent fold, as with cbEGF12.

Mechanisms, beyond a simple co-translational model, for how the nascent polypeptide chains of multi-domain proteins fold in vivo are beginning to emerge. The LDL receptor (LDL-R) is, like fibrillin-1, a multi-domain protein and has been shown to undergo extensive post-translational folding. A study of LDL-R has suggested that folding is non-vectorial and occurs by way of ‘collapsed’ intermediates that contain long-range non-native disulphide bonds (39). It is suggested that these subsequently isomerize to form the native disulphide pairings. The relevance of these findings to other multi-domain proteins remains an area for speculation, though there appears no reason to assume that all proteins fold in a similar manner. While LDL-R appears to undergo a post-translational, global folding process, our results define a type of folding mechanism involving domain–domain interactions. A combination of the molecular properties of the particular protein as well as the involvement of cellular chaperones may determine whether or not folding is co-translational or more complex. Sequential and co-translational folding may occur in other proteins with a multi-domain organization and other regions of fibrillin-1 provided that the individual domains are stable in the absence of the remainder of the polypeptide chain, and/or the newly synthesized sequence is not prevented from folding as it enters the ER lumen due to a missense substitution.

The mechanisms by which misfolded proteins, arising as a consequence of genetic mutation, cause cellular dysfunction and disease appear diverse. The misfolded proteins may be prevented from reaching their correct cellular location due to their retention and/or degradation causing haploinsufficiency, or they may exert a dominant negative effect by interfering with the function of interacting partners. In contrast to N1382S in cbEGF19, which was expressed into conditioned medium in a manner identical to the wild-type fragment, each of the calcium-binding substitutions in cbEGF13 caused an intracellular retention of the recombinant fragment. The accumulation of protein observed in these experiments appears to be in the ER where further modification of the core carbohydrate structures is prevented. A growing number of diseases with an ER storage phenotype have been recognized including Class 2 hypercholesterolemia, which arises from mutations in the LDL-R locus, producing proteins that are blocked in transport between the ER and the Golgi complex. Accumulation of misfolded LDL-R in the ER causes ER stress and activates the unfolded protein response (UPR) (40). The contribution of the UPR to MFS pathology is unknown.

In pulse chase studies of MFS fibroblast cells containing cysteine substitutions in fibrillin-1 cbEGF domains, two different cellular phenotypes of normal or delayed secretion have been observed (10,12). It is possible that, like the calcium-binding substitutions studied here, the heterogeneous trafficking profiles are highlighting regions of the protein which undergo more complex co-operative folding. A study (37) of the structural effects of two cysteine substitutions in cbEGF30 identified surprisingly short-range and unidirectional effects, which resulted in local misfolding of cbEGF30 and loss of intra-domain calcium binding. However, calcium binding to flanking domains cbEGF 29 and 31 was maintained.

The pathogenic mechanism of MFS and related fibrillinopathies is complex and currently the focus of much research (for review see 41). Comparison of the consequences of the substitutions in cbEGF13 with calcium-binding substitutions in cbEGF19 demonstrates that these findings in the neonatal region are distinct from those observed in another region of fibrillin-1. However, neither the type nor position of the altered residue, the location of the affected domain in fibrillin-1 or the involvement of complex folding behaviour, is sufficient to predict genotype–phenotype correlations. For example N1131Y (nMFS) has the same cellular and molecular phenotype as D1113G and D1115G (classic MFS) although it causes a different severity of disease. However, the normal secretion of the nMFS-causing E1073K (in cbEGF12) compared with N1131Y (in cbEGF13) would suggest that pleiotropic mechanisms underlie nMFS. Significant intrafamilial variability implies that environmental or other modifying factors are important for the phenotypic expression of disease, but the clustering of mutations causing nMFS would still indicate that this region has a vital role to play in microfibril structure and function. Future studies will focus on whether the mutant proteins retained as a consequence of this misfolding have an intracellular dominant effect or cause MFS via haploinsufficiency.

This study has highlighted further complexity in the molecular pathology of MFS by demonstrating that identical mutations expressed in the same domain context result in alternative trafficking fates of mutant proteins. A co-operative dependence of protein folding of cbEGF12 on cbEGF13 accounted for the ER retention associated with defective calcium binding to cbEGF13. Such complex folding behaviour must be taken into account when considering the molecular mechanisms that underlie MFS and other diseases of cbEGF-containing proteins.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
SUPPLEMENTARY MATERIAL
 REFERENCES
 
Cloning of mammalian expression vectors
The DNA fragment encompassing residues 134–1471 of human fibrillin-1 and encoding amino acids 1–446 (numbering according to 42) was cloned into the pKG52(poly A) mammalian expression vector to generate a construct containing the N-terminus to the proline-rich region of fibrillin-1 (NterPro fragment). The cbEGF11–22 fragment (nucleotides 3212–4714; amino acid residues 1027–1527) was subsequently cloned downstream of the NterPro fragment to produce a pKG52(poly A) vector containing the NterPro-cbEGF11–22 fragment. Details of the cloning procedures were as described previously (31).

Missense mutations to generate D1113G, D1115G, N1131Y, N1131S, E1073K and N1382S in the cbEGF11–22 fragment were introduced by a PCR-based site-directed mutagenesis method with Pfu DNA polymerase in pBluescript II vector as described previously (31). The primers used are given in Supplementary Material, Table S5. The mutated fragments were excised from the pBluescript vector and religated into the pKG(poly A) expression vector. The correct orientation of inserts and generation of the desired mutation was confirmed by DNA sequencing.

DNA transfection and expression of wild-type and mutant eukaryotic constructs
Transfection of the human dermal fibroblast line MSU-1.1 by plasmid DNA to generate pools of clones was described previously (31). The expression of wild-type and mutant constructs was compared with pools of clones rather than isolated clones to eliminate the effects of clonal variability on the level of expression. Conditioned media and cell lysates were sampled, run on SDS–PAGE and immunoblotted with anti-Pro antibody as described previously (31). Glycosylation assays of conditioned media and cell lysates were carried out with PNGase F and Endo H according to the manufacturer's instructions (New England BioLabs Inc.).

Cloning and purification of wild-type and mutant cbEGF domain constructs
The wild-type sequences of cbEGF12–13 and cbEGF12–14 were amplified as described previously (34). The multi-domain construct TB3-cbEGF11–13 (nucleotides 2987–3595, amino acid residues 952–1154) was amplified with a forward primer: 5' -TAGTAGGGATCCATAGAAGGACGA TCAGCAGATATCCGCCTGGAAACC and the reverse primer for cbEGF13 described previously (33).

DNA fragment (nucleotides 4094–4468 of human fibrillin-1 cDNA) encoding the wild-type sequence of the cbEGF18–20 triple construct (amino acid residues 1321–1445) was amplified by standard PCR techniques using Pfu polymerase. The DNA was amplified using a forward primer that includes a Factor Xa cleavage site: 5'-TAGTAGGGATCCATAGAAGGACGATCAGCAACAGACATCAATGAATGTGAAATTG and a reverse primer: 5'-TAGTAGGTCGACCTATTATTCACAGGCTTTCCCGTCAGC.

The mutations in cbEGF13 and cbEGF19 were introduced into pQE30 recombinant plasmids containing the cDNA sequences of the wild-type constructs by site-directed mutagenesis with the forward and reverse primers given above for the eukaryotic constructs.

Protein purification, refolding and His-tag cleavage were carried out as described previously (32–34) and the identity of the purified proteins was confirmed by electrospray mass spectrometry.

Limited proteolysis of wild-type and mutant cbEGF domain constructs
Proteolysis with trypsin (Sigma) 1:80 w/w was performed as described previously (34) with peptides dissolved at a final concentration of 1.6 mg/ml. N-terminal sequencing was carried out after digestion for 30 min in the presence of 50 mM Ca2+ or 25–50 mM EGTA. Samples were purified under non-reducing conditions by reverse phase HPLC and sequenced on an Applied Biosystems 494A Procise sequencer (PE Biosystems).

Calcium chelator competition assays
Ca2+ dissociation constants of high-affinity sites were determined with the chromophoric chelator 5,5'-Br2BAPTA (43) as described previously (35,37). The titrations were repeated at least three times to provide an estimate of the experimental error. The Kd values were calculated by least squares fitting to the data as described previously using in-house software (43–46).

NMR studies of wild-type and mutant cbEGF domain constructs
1H NMR experiments were performed at 500 MHz using a home-built spectrometer in the Oxford Centre for Molecular Sciences NMR facility. Wild-type, D1115G mutant and N1131S mutant cbEGF12–14, and wild-type and N1382S mutant cbEGF18–20 samples were dissolved in 550 µl of matrix solution (99.9% D2O containing 5 mM Tris–HCl and 150 mM NaCl, pH 6.5) to produce final protein concentrations of 0.3 mM. Calcium titrations were performed by adding small aliquots of CaCl2 solutions in D2O; calcium concentrations ranged from 0 to 55 mM. All experiments were conducted at 35°C. The Kd values of the lower affinity sites in cbEGF12, cbEGF18 and cbEGF20 were calculated as described previously (38).

One-dimensional NMR spectra were collected with a spectral width of 5494.51 Hz, 4096 complex points and 512 acquisitions. Two-dimensional NOESY spectra were recorded with a spectral width of 5494.51 Hz in both dimensions, with 96 acquisitions and with 1024 and 256 complex points in the F2 and F1 dimensions, respectively. A mixing time of 150 ms was used. Assignments for aromatic residues were determined using 2D DQFCOSY, TOCSY and NOESY spectra.


   SUPPLEMENTARY MATERIAL
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
REFERENCES
 
Supplementary Material is available at HMG Online.


   ACKNOWLEDGEMENTS
 
This work was supported by the Medical Research Council, the Wellcome Trust and the EPA Cephalosporin Trust.

Conflict of Interest statement. The authors have no conflicting interests or connections to declare.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 REFERENCES
 

  1. Sakai L.Y., Keene D.R., Engvall E. Fibrillin, a new 350-kD glycoprotein, is a component of extracellular microfibrils. J. Cell. Biol. (1986) 103:2499–2509.[Abstract/Free Full Text]

  2. Dietz H.C., Cutting G.R., Pyeritz R.E., Maslen C.L., Sakai L.Y., Corson G.M., Puffenberger E.G., Hamosh A., Nanthakumar E.J., Curristin S.M., et al. Marfan syndrome caused by a recurrent de novo missense mutation in the fibrillin gene. Nature (1991) 352:337–339.[CrossRef][Medline]

  3. Pyeritz R.E. The Marfan syndrome. Annu. Rev. Med. (2000) 51:481–510.[CrossRef][Web of Science][Medline]

  4. Robinson P.N., Godfrey M. Marfan Syndrome: A Primer for Clinicians and Scientists (2004) USA. LandesBioscience/Eurekah.com.

  5. Pereira L., Andrikopoulos K., Tian J., Lee S.Y., Keene D.R., Ono R., Reinhardt D.P., Sakai L.Y., Biery N.J., Bunton T., et al. Targeting of the gene encoding fibrillin-1 recapitulates the vascular aspect of Marfan syndrome. Nat. Genet. (1997) 17:218–222.[CrossRef][Web of Science][Medline]

  6. Pereira L., Lee S.Y., Gayraud B., Andrikopoulos K., Shapiro S.D., Bunton T., Biery N.J., Dietz H.C., Sakai L.Y., Ramirez F. Pathogenetic sequence for aneurysm revealed in mice underexpressing fibrillin-l. Proc. Natl Acad. Sci. USA (1999) 96:3819–3823.[Abstract/Free Full Text]

  7. Judge D.P., Biery N.J., Keene D.R., Geubtner J., Myers L., Huso D.L., Sakai L.Y., Dietz H.C. Evidence for a critical contribution of haploinsufficiency in the complex pathogenesis of Marfan syndrome. J. Clin. Invest. (2004) 114:172–181.[CrossRef][Web of Science][Medline]

  8. Neptune E.R., Frischmeyer P.A., Arking D.E., Myers L., Bunton T.E., Gayraud B., Ramirez F., Sakai L.Y., Dietz H.C. Dysregulation of TGF-beta activation contributes to pathogenesis in Marfan syndrome. Nat. Genet. (2003) 33:407–411.[CrossRef][Web of Science][Medline]

  9. Ng C.M., Cheng A., Myers L.A., Martinez-Murillo F., Jie C., Bedja D., Gabrielson K.L., Hausladen J.M., Mecham R.P., Judge D.P., et al. TGF-beta-dependent pathogenesis of mitral valve prolapse in a mouse model of Marfan syndrome. J. Clin. Invest. (2004) 114:1586–1592.[CrossRef][Web of Science][Medline]

  10. Aoyama T., Francke U., Dietz H.C., Furthmayr H. Quantitative differences in biosynthesis and extracellular deposition of fibrillin in cultured fibroblasts distinguish five groups of Marfan syndrome patients and suggest distinct pathogenetic mechanisms. J. Clin. Invest. (1994) 94:130–137.[Web of Science][Medline]

  11. Halliday D., Hutchinson S., Kettle S., Firth H., Wordsworth P., Handford P.A. Molecular analysis of eight mutations in FBN1. Hum. Genet. (1999) 105:587–597.[CrossRef][Web of Science][Medline]

  12. Schrijver I., Liu W., Brenn T., Furthmayr H., Francke U. Cysteine substitutions in epidermal growth factor-like domains of fibrillin-1: distinct effects on biochemical and clinical phenotypes. Am. J. Hum. Genet. (1999) 65:1007–1020.[CrossRef][Web of Science][Medline]

  13. Schrijver I., Liu W., Odom R., Brenn T., Oefner P., Furthmayr H., Francke U. Premature termination mutations in FBN1: distinct effects on differential allelic expression and on protein and clinical phenotypes. Am. J. Hum. Genet. (2002) 71:223–237.[CrossRef][Web of Science][Medline]

  14. Lee S.S., Knott V., Jovanovic J., Harlos K., Grimes J.M., Choulier L., Mardon H.J., Stuart D.I., Handford P.A. Structure of the integrin binding fragment from fibrillin-1 gives new insights into microfibril organization. Structure (Camb.) (2004) 12:717–729.[Medline]

  15. Downing A.K., Knott V., Werner J.M., Cardy C.M., Campbell I.D., Handford P.A. Solution structure of a pair of calcium-binding epidermal growth factor-like domains: implications for the Marfan syndrome and other genetic disorders. Cell (1996) 85:597–605.[CrossRef][Web of Science][Medline]

  16. Werner J.M., Knott V., Handford P.A., Campbell I.D., Downing A.K. Backbone dynamics of a cbEGF domain pair in the presence of calcium. J. Mol. Biol. (2000) 296:1065–1078.[CrossRef][Web of Science][Medline]

  17. Smallridge R.S., Whiteman P., Werner J.M., Campbell I.D., Handford P.A., Downing A.K. Solution structure and dynamics of a calcium binding epidermal growth factor-like domain pair from the neonatal region of human fibrillin-1. J. Biol. Chem. (2003) 278:12199–12206.[Abstract/Free Full Text]

  18. Reinhardt D.P., Ono R.N., Sakai L.Y. Calcium stabilizes fibrillin-1 against proteolytic degradation. J. Biol. Chem. (1997) 272:1231–1236.[Abstract/Free Full Text]

  19. McGettrick A.J., Knott V., Willis A., Handford P.A. Molecular effects of calcium binding mutations in Marfan syndrome depend on domain context. Hum. Mol. Genet. (2000) 9:1987–1994.[Abstract/Free Full Text]

  20. Beroud C., Hamroun D., Collod-Beroud G., Boileau C., Soussi T., Claustres M. UMD (Universal Mutation Database): 2005 update. Hum. Mutat. (2005) 26:184–191.[CrossRef][Web of Science][Medline]

  21. Collod-Beroud G., Le Bourdelles S., Ades L., Ala-Kokko L., Booms P., Boxer M., Child A., Comeglio P., De Paepe A., Hyland J.C., et al. Update of the UMD-FBN1 mutation database and creation of an FBN1 polymorphism database. Hum. Mutat. (2003) 22:199–208.[CrossRef][Web of Science][Medline]

  22. Rommel K., Karck M., Haverich A., von Kodolitsch Y., Rybczynski M., Muller G., Singh K.K., Schmidtke J., Arslan-Kirchner M. Identification of 29 novel and nine recurrent fibrillin-1 (FBN1) mutations and genotype–phenotype correlations in 76 patients with Marfan syndrome. Hum. Mutat. (2005) 26:529–539.[CrossRef][Web of Science][Medline]

  23. Ades L.C., Holman K.J., Brett M.S., Edwards M.J., Bennetts B. Ectopia lentis phenotypes and the FBN1 gene. Am. J. Med. Genet. A (2004) 126:284–289.[Medline]

  24. Robinson P.N., Booms P., Katzke S., Ladewig M., Neumann L., Palz M., Pregla R., Tiecke F., Rosenberg T. Mutations of FBN1 and genotype–phenotype correlations in Marfan syndrome and related fibrillinopathies. Hum. Mutat. (2002) 20:153–161.[CrossRef][Web of Science][Medline]

  25. Comeglio P., Evans A.L., Brice G., Cooling R.J., Child A.H. Identification of FBN1 gene mutations in patients with ectopia lentis and marfanoid habitus. Br. J. Ophthalmol. (2002) 86:1359–1362.[Abstract/Free Full Text]

  26. Tiecke F., Katzke S., Booms P., Robinson P.N., Neumann L., Godfrey M., Mathews K.R., Scheuner M., Hinkel G.K., Brenner R.E., et al. Classic, atypically severe and neonatal Marfan syndrome: twelve mutations and genotype–phenotype correlations in FBN1 exons 24–40. Eur. J. Hum. Genet. (2001) 9:13–21.[CrossRef][Web of Science][Medline]

  27. Liu W.O., Oefner P.J., Qian C., Odom R.S., Francke U. Denaturing HPLC-identified novel FBN1 mutations, polymorphisms, and sequence variants in Marfan syndrome and related connective tissue disorders. Genet. Test. (1997) 1:237–242.[Medline]

  28. Wang M., Wang J.Y., Cisler J., Imaizumi K., Burton B.K., Jones M.C., Lamberti J.J., Godfrey M. Three novel fibrillin mutations in exons 25 and 27: classic versus neonatal Marfan syndrome. Hum. Mutat. (1997) 9:359–362.[CrossRef][Web of Science][Medline]

  29. Nijbroek G., Sood S., McIntosh I., Francomano C.A., Bull E., Pereira L., Ramirez F., Pyeritz R.E., Dietz H.C. Fifteen novel FBN1 mutations causing Marfan syndrome detected by heteroduplex analysis of genomic amplicons. Am. J. Hum. Genet. (1995) 57:8–21.[Web of Science][Medline]

  30. Kettle S., Cardy C.M., Hutchinson S., Sykes B., Handford P.A. Characterisation of fibrillin-1 cDNA clones in a human fibroblast cell line that assembles microfibrils. Int. J. Biochem. Cell. Biol. (2000) 32:201–214.[CrossRef][Web of Science][Medline]

  31. Whiteman P., Handford P.A. Defective secretion of recombinant fragments of fibrillin-1: implications of protein misfolding for the pathogenesis of Marfan syndrome and related disorders. Hum. Mol. Genet. (2003) 12:727–737.[Abstract/Free Full Text]

  32. Whiteman P., Downing A.K., Smallridge R., Winship P.R., Handford P.A. A Gly -> Ser change causes defective folding in vitro of calcium-binding epidermal growth factor-like domains from factor IX and fibrillin-1. J. Biol. Chem. (1998) 273:7807–7813.[Abstract/Free Full Text]

  33. Whiteman P., Downing A.K., Handford P.A. NMR analysis of cbEGF domains gives new insights into the structural consequences of a P1148A substitution in fibrillin-1. Protein Eng. (1998) 11:957–959.[Abstract/Free Full Text]

  34. Whiteman P., Smallridge R.S., Knott V., Cordle J.J., Downing A.K., Handford P.A. A G1127S change in calcium-binding epidermal growth factor-like domain 13 of human fibrillin-1 causes short range conformational effects. J. Biol. Chem. (2001) 276:17156–17162.[Abstract/Free Full Text]

  35. Jensen S.A., Corbett A.R., Knott V., Redfield C., Handford P.A. Ca2+-dependent interface formation in fibrillin-1. J. Biol. Chem. (2005) 280:14076–14084.[Abstract/Free Full Text]

  36. Reinhardt D.P., Ono R.N., Notbohm H., Muller P.K., Bachinger H.P., Sakai L.Y. Mutations in calcium-binding epidermal growth factor modules render fibrillin-1 susceptible to proteolysis. A potential disease-causing mechanism in Marfan syndrome. J. Biol. Chem. (2000) 275:12339–12345.[Abstract/Free Full Text]

  37. Suk J.Y., Jensen S., McGettrick A., Willis A.C., Whiteman P., Redfield C., Handford P.A. Structural consequences of cysteine substitutions C1977Y and C1977R in calcium-binding epidermal growth factor-like domain 30 of human fibrillin-1. J. Biol. Chem. (2004) 279:51258–51265.[Abstract/Free Full Text]

  38. Smallridge R.S., Whiteman P., Doering K., Handford P.A., Downing A.K. EGF-like domain calcium affinity modulated by N-terminal domain linkage in human fibrillin-1. J. Mol. Biol. (1999) 286:661–668.[CrossRef][Web of Science][Medline]

  39. Jansens A., van Duijn E., Braakman I. Coordinated nonvectorial folding in a newly synthesized multidomain protein. Science (2002) 298:2401–2403.[Abstract/Free Full Text]

  40. Sorensen S., Ranheim T., Bakken K.S., Leren T.P., Kulseth M.A. Retention of mutant low density lipoprotein receptor in endoplasmic reticulum (ER) leads to ER stress. J. Biol. Chem. (2006) 281:468–476.[Abstract/Free Full Text]

  41. Robinson P.N., Arteaga-Solis E., Baldock C., Collod-Beroud G., Booms P., De Paepe A., Dietz H.C., Guo G., Handford P.A., Judge D.P., et al. The molecular genetics of Marfan syndrome and related disorders. J. Med. Genet. (2006) 43:769–787.[Abstract/Free Full Text]

  42. Pereira L., D'Alessio M., Ramirez F., Lynch J.R., Sykes B., Pangilinan T., Bonadio J. Genomic organization of the sequence coding for fibrillin, the defective gene product in Marfan syndrome [published erratum appears in Hum. Mol. Genet. (1993) 2, 1762]. Hum. Mol. Genet. (1993) 2:961–968.[Abstract/Free Full Text]

  43. Linse S., Brodin P., Drakenberg T., Thulin E., Sellers P., Elmden K., Grundstrom T., Forsen S. Structure-function relationships in EF-hand Ca2+-binding proteins. Protein engineering and biophysical studies of calbindin D9k. Biochemistry (1987) 26:6723–6735.[CrossRef][Medline]

  44. Stenberg Y., Julenius K., Dahlqvist I., Drakenberg T., Stenflo J. Calcium-binding properties of the third and fourth epidermal-growth- factor-like modules in vitamin-K-dependent protein S. Eur. J. Biochem. (1997) 248:163–170.[Web of Science][Medline]

  45. Stenberg Y., Muranyi A., Steen C., Thulin E., Drakenberg T., Stenflo J. EGF-like module pair 3–4 in vitamin K-dependent protein S: modulation of calcium affinity of module 4 by module 3, and interaction with factor X. J. Mol. Biol. (1999) 293:653–665.[CrossRef][Web of Science][Medline]

  46. Rand M.D., Lindblom A., Carlson J., Villoutreix B.O., Stenflo J. Calcium binding to tandem repeats of EGF-like modules. Expression and characterization of the EGF-like modules of human Notch-1 implicated in receptor–ligand interactions. Protein Sci. (1997) 6:2059–2071.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
16/8/907    most recent
ddm035v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Whiteman, P.
Right arrow Articles by Handford, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Whiteman, P.
Right arrow Articles by Handford, P. A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?