Skip Navigation


Human Molecular Genetics Advance Access originally published online on March 5, 2008
Human Molecular Genetics 2008 17(12):1825-1837; doi:10.1093/hmg/ddn076
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
17/12/1825    most recent
ddn076v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Corry, G. N.
Right arrow Articles by Underhill, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Corry, G. N.
Right arrow Articles by Underhill, D. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2008. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Subnuclear localization and mobility are key indicators of PAX3 dysfunction in Waardenburg syndrome

Gareth N. Corry1, Michael J. Hendzel2 and D. Alan Underhill1,2,*

1 Department of Medical Genetics, University of Alberta, Edmonton, Alberta, Canada T6G 2H7 2 Department of Oncology, Cross Cancer Institute, Edmonton, Alberta, Canada T6G 1Z2

* To whom correspondence should be addressed at: Department of Medical Genetics, 829 Medical Sciences Building, University of Alberta, Edmonton, Alberta, Canada T6G 2H7. Tel: 780 492 4359; Fax: 780 492 1998; Email: alan.underhill{at}ualberta.ca

Received February 5, 2008; Accepted March 4, 2008


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
Mutations in the transcription factor PAX3 cause Waardenburg syndrome (WS) in humans and the mouse Splotch mutant, which display similar neural crest-derived defects. Previous characterization of disease-causing mutations revealed pleiotropic effects on PAX3 DNA binding and transcriptional activity. In this study, we evaluated the impact of disease alleles on PAX3 localization and mobility. Immunofluorescence analyses indicated that the majority of PAX3 occupies the interchromatin space, with only sporadic colocalization with sites of transcription. Interestingly, PAX3 disease alleles fell into two distinct categories when localization and dynamics in fluorescence recovery after photobleaching (FRAP) were assessed. The first group (class I), comprising N47H, G81A and V265F exhibit a diffuse distribution and markedly increased mobility when compared with wild-type PAX3. In contrast, the G42R, F45L, S84F, Y90H and R271G mutants (class II) display evidence of subnuclear compartmentalization and mobility intermediate between wild-type PAX3 and class I proteins. However, unlike class I mutants, which retain DNA binding, class II proteins are deficient for this activity, indicating that DNA binding is not a primary determinant of PAX3 distribution and movement. Importantly, class I properties prevail when combined with a class II mutation, which taken with the proximity of the two mutant classes within the PAX3 protein, suggests class I mutants act by perturbing PAX3 conformation. Together, these results establish that altered localization and dynamics play a key role in PAX3 dysfunction and that loss of the underlying determinants represents the principal defect for a subset of Waardenburg mutations.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
The PAX3 transcription factor is a key regulator of developmentally important processes in metazoan organisms and also carries out distinct postnatal functions (13). The mammalian PAX gene family comprises nine members, all of which feature a DNA-binding paired domain (PD) related to that of the Drosophila paired (Prd) protein (46). Like Prd, PAX3 contains a homeodomain (HD), which is known to functionally interact with the PD to modulate DNA binding activity (712). During murine embryogenesis, Pax3 is expressed in the dorsal neural tube, neural crest cells, and dermomyotome (3,4), all of which are affected by mutation of Pax3 in the mouse Splotch (Sp) mutants (1315). Specifically, homozygous Sp embryos exhibit neural tube and cardiac defects, as well as an absence of limb and diaphragm muscle, while heterozygotes are characterized by pigmentary defects (1618). In humans, PAX3 haploinsufficiency causes Waardenburg Syndrome (WS) types 1 and 3 (1922), where individuals present with sensorineural deafness, pigmentary defects and dystopia canthorum. In addition, WS3 patients are distinguished by limb musculature defects. Lastly, a translocation involving PAX3 in the childhood cancer alveolar rhabdomyosarcoma results in an oncogenic fusion protein (PAX3-FKHR) comprising both DNA-binding domains of PAX3 and the carboxy-terminal region of the FOXO1A transcription factor (23,24).

Characterization of the PAX3 locus from WS patients has revealed a broad spectrum of lesions, including roughly 30 missense mutations, most of which occur in either the PD or HD. Biochemical analyses of these mutants have revealed pleiotropic effects on DNA binding that range from relatively inert to greatly reduced to elevated (9,2528). In addition, reporter gene assays using two melanocyte-specific targets of PAX3, microphthalmia-associated transcription factor (MITF) (28) and tyrosinase-related protein-1 (Tyrp-1) (29), indicate disease-causing mutations have disparate effects on promoter activity (26). As a result, it has not been straightforward to understand the molecular basis of PAX3 loss of function or establish relationships between phenotype and genotype, particularly in accounting for the differences in WS types 1 and 3. This is further complicated by the fact that the same PAX3 mutant allele can produce distinct phenotypes, even within the same family. As a result, it appears other aspects of PAX3 function may be compromised by disease-causing mutations and could potentially account for the variable phenotypic expressivity seen in WS.

The eukaryotic nucleus is a highly organized structure (3033). Notably, the positioning of nuclear constituents relative to each other plays a vital role in the regulation of nuclear processes, and disruptions to this organization can be pathogenic (reviewed in 34). Within this scheme, transcription factors can exhibit distinct distributions and also display varying degrees of mobility that likely facilitates movement between different compartments in response to signaling events or interactions with other nuclear elements (33,35,36). Live cell studies show that chromosomes undergo constrained diffusion within a given territory (37,38) and long-range, actin-dependent chromosomal movement has also been proposed (39,40). On the other hand, individual chromatin loci have been shown to exhibit fast, short-range motion (41,42). Together, these observations suggest that the coordinated and dynamic interaction between the transcriptional machinery and target chromosomal loci is critical for proper regulation of eukaryotic gene expression (43). With this in mind, we have assessed the subnuclear localization and mobility of PAX3 and disease-causing variants. Collectively, our analyses indicate that PAX3 appears to contain multiple determinants for subnuclear localization and dynamics, although DNA binding does not appear to be a significant determinant of either. Importantly, we find that adjacent mutations can have markedly distinct effects on PAX3 dysfunction and establish altered dynamics as a key aspect of PAX3 disease alleles, regardless of their effect on DNA binding or reporter gene activity.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
Subnuclear localization of wild-type PAX3
To investigate the subnuclear distribution of PAX3, we performed immunofluorescence on endogenous PAX3 in B16F10 mouse melanoma cells and primary limb bud cultures, as well as in mouse 10T1/2 cells after transient transfection with PAX3 expression plasmids. An important objective of these analyses was to establish a reference point for the characterization of PAX3 disease alleles. In B16F10 cells, PAX3 adopted a reticular pattern, which was largely excluded from Hoechst-stained pericentromeric heterochromatin, perinuclear and perinucleolar heterochromatin, and nucleoli (Fig. 1A). Characterization of PAX3 localization in primary limb bud cultures also revealed a reticular distribution that did not overlap with condensed chromatin (Fig. 1B). As in the B16F10 cells, several foci of elevated PAX3 staining were present and typically occupied the nuclear periphery (arrows, Fig. 1A and B). Moreover, PAX3 immunofluorescence in whole embryo sections (10.5 dpc) was excluded from heterochromatin over the entire PAX3 expression domain (cells of the dorsal neural tube, dorsal root ganglia, dermomyotome and migrating myoblasts; data not shown) and is therefore consistent with data from B16F10 and primary cells. In both B16F10 cells and primary cultures, an identical pattern was observed with a second PAX3-specific antibody that recognizes a different epitope (data not shown; described in Materials and Methods). In 10T1/2 fibroblast cells transiently transfected with plasmids expressing untagged PAX3 (Fig. 1C, top row) or PAX3 with a carboxy-terminal green fluorescent protein (GFP) tag (PAX3-GFP; Fig. 1C, bottom row), we observed similar intranuclear distributions to that of endogenous PAX3. In the latter case, this pattern was observed in ~80% of transfected cells, while in the remaining cells, PAX3-GFP co-localized to a large extent with heterochromatic areas (data not shown).


Figure 1
View larger version (67K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. Intranuclear compartmentalization of PAX3. Indirect immunofluorescence was used to examine the subnuclear localization of endogenous PAX3 in (A) B16F10 murine melanoma cells, (B) 11.5 dpc primary limb bud cultures, and (C) exogenous untagged (top row) or green-fluorescent protein (GFP)-tagged (bottom row) PAX3 transiently transfected into 10T1/2 mouse embryonic fibroblasts. Cells in (A) and (B) were treated with a PAX3-specific antibody (green) and co-stained with Hoechst 33258 (red). Merged panels in (A) and (B) include X–Y (main), X–Z (bottom), and Y–Z (side) projections; arrows in (A) and (B) indicate bright foci characteristic of endogenous PAX3. (D) Indirect immunofluorescence of unsynchronized B16F10 cells using a PAX3-specific antibody was used to analyze spatial and temporal distribution of PAX3 during mitotic stages. Cells in different stages of mitosis were identified by staining with Hoechst. Panels are comprised of merged, deconvolved Hoechst (red) and PAX3 (green) signals. Bar, 10 µm.

 
We also monitored PAX3 localization throughout mitosis in unsynchronized B16F10 cells stained with Hoechst (Fig. 1D). In prophase, PAX3 was initially confined to the nucleus at early stages and eventually redistributed to the cytoplasm. This pattern was maintained until cells entered telophase and the chromosomes began to decondense, at which point PAX3 once again appeared in proximity to loosely packed chromatin, with the majority of PAX3 found in nuclei by late telophase. As observed during interphase, PAX3 was clearly excluded from regions of Hoechst staining, which was most apparent with highly condensed chromosomes at metaphase. Despite the redistribution of PAX3 during mitosis, the protein retained evidence of the reticular pattern observed during interphase where PAX3 immunofluorescence often appears as ‘strands’ (arrows in Fig. 1D). Together, these analyses reveal that the steady state distribution of PAX3, both in vivo and in situ, involves a mesh-like pattern during interphase (and to a lesser extent in mitosis) and does not show obvious localization to heterochromatic landmarks demarcated by Hoechst staining at any point during the cell cycle.

Localization of wild-type PAX3 and post-translational histone modifications
The DNA-binding dyes Hoechst 33258 and 4',6-diamidino-2-phenylindole (DAPI) exhibit a preference for AT-rich DNA, which is more abundant in heterochromatin and, as a result, do not efficiently demarcate the euchromatic compartment. To further assess PAX3 subnuclear localization, immunofluorescence was used to delimit either active or inactive chromatin using antibodies that recognize histone modifications enriched in these chromatin domains. These included acetylated histone H3 and H4, which mark transcriptionally competent euchromatin (44), trimethyl Lys4 of histone H3 (H3K4me3), which marks promoter regions of transcriptionally active genes (45,46), and trimethyl Lys36 of histone H3 (H3K36me3), which is associated with transcriptional elongation by RNA Polymerase II (4749). Modifications associated with heterochromatin and silenced chromatin were also investigated; these included trimethyl Lys9 of histone H3, found primarily in condensed silenced heterochromatin (50,51) and trimethyl Lys20 of histone H4, a marker of pericentromeric heterochromatin (52). Not surprisingly, PAX3 failed to localize with these heterochromatin marks, given that they largely recapitulate the Hoechst pattern (data not shown). As the euchromatin-associated histone modifications revealed qualitatively similar localization with respect to each other, H3K4me3 was used to demonstrate their relationship with PAX3. Although more diffuse than PAX3, H3K4me3 also produced a reticular pattern that was excluded from Hoechst (Fig. 2A). PAX3 immunofluorescence was in close proximity to H3K4me3 throughout the nucleus, where the signals appeared interdigitated or intertwined and also intersected at some points (arrows in Fig. 2B). This is more obvious upon introducing an intensity threshold (Fig. 2C) and reveals that PAX3 is closely apposed to euchromatin with a small subset displaying co-localization. Lastly, rendering images in three dimensions (3D) illustrate the clear difference in localization of PAX3 with respect to euchromatin and heterochromatin (Fig. 2D). Based on this spatial relationship, we propose that the vast majority of PAX3 occupies the interchromatin space and that only a subset appears to be engaged with euchromatin.


Figure 2
View larger version (84K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. Intranuclear distribution of PAX3 relative to sites of transcriptional activity. (A) Co-localization between PAX3 and H3K4me3 was analyzed in B16F10 cells by indirect immunofluorescence. Gray-scale panels are unaltered; merged panels have been deconvolved. (B) Three-dimensional rendering of PAX3 and H3K4me3 in B16F10 cells. X–Y (main), X–Z (bottom), and Y–Z (side) projections are shown; arrows indicate sites of overlap between PAX3 and H3K4me3. (C) Detail of co-localization between PAX3 and H3K4me3 in B16F10 cells. Top and bottom rows represent unique regions of nucleus in (B) with thresholds to illustrate their spatial proximity. (D) Three-dimensional rendering of nuclear segments from Figure 1A (left) and Figure 2B (right) detailing localization of endogenous PAX3 with respect to Hoechst-stained chromatin and H3K4me3, respectively. (E) Co-localization between PAX3 and sites of RNA synthesis in B16F10 cells. Cells were grown for 24 h with or without transfection, incubated with 1 mM 5-FUrd at 37°C for 30 min, then examined by indirect immunofluorescence using antibodies specific for PAX3 and bromodeoxyuridine. Inset, details of co-localization between PAX3 and 5-FUrd foci (yellow). Gray-scale panels are unaltered; merged panels have been deconvolved. Bar, 10 µm.

 
The spatial relationship of PAX3 with euchromatin was further evaluated in cells incubated with 5-fluorouridine (5-FUrd), a nucleotide analog that is incorporated into newly synthesized RNA and can be recognized by a bromodeoxyuridine (BrdU)-specific antibody. We incubated B16F10 cells plasmid with 5-FUrd for 30 min and then performed co-immunofluorescence with PAX3 and BrdU-specific antibodies. The BrdU antibody recognized numerous small punctate nuclear foci corresponding to sites of 5-FUrd incorporation (Fig. 2E) and the PAX3 signal showed partial overlap with several 5-FUrd foci per nucleus. A similar pattern of co-localization was observed in 10T1/2 nuclei transiently transfected with PAX3 (data not shown). Consistent with the juxtaposition of PAX3 and H3K4me3, these results provide evidence that PAX3 is found in regions of transcriptional activity, but suggest that only a small number of PAX3 sites contain transcriptionally active loci at any given time.

Effects of disease-associated mutations on PAX3 subnuclear localization
The above findings establish that PAX3-GFP recapitulates the distribution of untagged and endogenous PAX3, and provides a means to characterize PAX3 mutants independent of effects the mutations may have on antibody recognition. For this purpose, seven missense mutations causing WS were selected (F45L, N47H, G81A, S84F and Y90H in the PD, and V265F and R271G in the HD), as well as the G42R PD mutation found in the Splotch-delayed (Spd) mouse (15). We have previously shown that this cohort of mutations has variable effects on DNA binding and reporter gene transactivation (26). We also assessed the effects of two WS-associated mutations outside the DNA-binding domains, A196T in the linker and Q391H in the carboxy-terminus (see Fig. 3A for positions of mutations). To compare the localization of wild-type and mutant PAX3 proteins, each was expressed as a GFP fusion protein in 10T1/2 cells. As noted for wild-type PAX3-GFP (Fig. 3B), all mutants were excluded from Hoechst-stained chromatin (Fig. 3C–E). The Spd mutant displayed a more uniform distribution than wild-type PAX3-GFP (Fig. 3C, top row), was less abundant in perinucleolar areas, and tended to display one or two large bright foci in some cells rather than the multiple bright foci characteristic of PAX3-GFP. The F45L mutant displayed a similar pattern to the wild-type protein, with a number of bright foci and concentrations around nucleoli (Fig. 3C, second row). Both the N47H (Fig. 3C, third row) and G81A (Fig. 3C, fourth row) proteins showed consistently lower expression levels than the other PAX3 variants, tended to be excluded from perinucleolar areas, and generally showed a more diffuse staining pattern than the wild-type protein. These mutants also showed a moderate level of cytoplasmic localization, suggesting the N47H and G81A mutations may interfere with nuclear localization or retention of PAX3. In addition, the N47H mutant consistently showed exclusion from the nuclear periphery. The S84F mutant was similar in appearance to wild-type and F45L (Fig. 3C, fifth row), although it tended to exhibit a noticeably more diffuse background localization pattern than either. Likewise, the Y90H mutant displayed numerous bright foci against a less intense, diffuse background (Fig. 3C, bottom row). The HD mutant V265F was distributed throughout the nucleus and cytoplasm (Fig. 3D, top row), closely resembling the N47H and G81A mutants. Finally, the R271G HD variant showed a pattern similar to Spd, having a uniform distribution in Hoechst-free areas with less enrichment around the nucleoli and one or more large bright foci (Fig. 3D, bottom row). The A196T and Q391H mutants showed similar characteristics to wild-type PAX3-GFP, including a punctate pattern and enrichment in perinucleolar areas (Fig. 3E), although we did not observe the same bright foci distinctive of PAX3-GFP. In this regard, the A196T and Q391H mutants more closely resembled the Spd and R271G patterns. Together, these observations demonstrate that PAX3 disease mutations influence subnuclear compartmentalization to differing degrees, which was most severe for N47H, G81A and V265F, and represents another aspect of PAX3 dysfunction.


Figure 3
View larger version (78K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3. Disease mutations alter the subnuclear localization of PAX3. (A) Schematic of PAX3 (not to scale) showing locations of disease-causing mutations analyzed for effects on distribution in the nucleus. Subnuclear compartmentalization of wild-type PAX3-GFP (B) and variants of PAX3-GFP containing mutations in the PD (C), HD (D), linker (E; top row), or carboxy-terminus (E; bottom row) is shown. Gray-scale panels are unaltered; merged panels have been deconvolved. Bar, 10 µm.

 
Nuclear dynamics of wild-type and mutant PAX3
In addition to transcription factor compartmentalization within the cell, protein mobility has emerged as essential component of gene regulation. We therefore used fluorescence recovery after photobleaching (FRAP) experiments to analyze the mobility of wild-type PAX3-GFP and disease-causing mutants. At the same time, this provided an opportunity to compare the localization of wild-type PAX3-GFP fusions to those containing disease-causing mutants in live and fixed cells. The post-bleach recovery profiles of wild-type and mutant PAX3-GFP proteins show that their localization in live cells can be generally correlated with that observed in fixed cells and also allow categorization of the mutants into two groups. The first includes Spd, F45L, S84F, Y90H and R271G, which retain a compartmentalized appearance similar to that of wild-type PAX3 (Fig. 4A; cf. Fig. 3). The N47H, G81A and V265F mutants form a second group characterized by diffuse distribution and, as noted in fixed cells (Fig. 3), display varying degrees of cytoplasmic localization, although fluorescence intensity in the nucleus is greater in each case (Fig. 4B). As will be elaborated below, the presence or absence of a compartmentalized distribution correlates with mobility.


Figure 4
Figure 4
View larger version (136K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4. Behavior of wild-type and mutant PAX3-GFP in live cells. Intranuclear mobility of full-length wild-type and mutant PAX3-GFP was analyzed using FRAP. Proteins that exhibit similar recoveries, (A; class II) wt, Spd, F45L, S84F, Y90H, A196T, R271G and Q391H, and (B; class I) N47H, G81A, and V265F, are grouped together. (C) FRAP recovery curves for wild-type and mutant PAX3-GFP proteins expressed in 10T1/2 cells. Plots show recovery versus time; each plot represents the average of thirty individual FRAP experiments. The location of each mutation (PD, paired domain; HD, homeodomain; TAD, transactivation domain) and the mutational class (I or II) each mutant belongs to is indicated. Plots for individual mutants compared with wild-type PAX3-GFP are shown in Supplementary Material, Figure S1.

 
The analysis of PAX3 disease allele dynamics provides two major findings: with the exception of PAX3-GFP A196T and Q391H, all mutants tested displayed an obvious increase in mobility when compared with the wild-type protein and had essentially recovered to 100% by 90s (Fig. 4C; see also "Supplementary Material, Fig. S1"), indicating they lack the immobile fraction seen with wild-type PAX3. Nevertheless, the mutants fell into two categories that could be distinguished in terms of overall mobility and free pool sizes, the free pool being estimated by the value at the first time point after photobleaching (1.5 s). The first group, designated as class I, which includes the N47H and G81A mutations in the PD and V265F in the HD, showed the highest recovery rates and possessed the largest freely diffusing pool of all the PAX3-GFP proteins (Fig. 4C). The remaining mutants (Spd, F45L, S84F, Y90H and R271G), which we have called class II, displayed recovery rates and ‘free pools’ intermediate between wild-type PAX3 and class I mutants (Fig. 4C), with Spd being the fastest and Y90H the slowest amongst this cohort. As noted above, these differences in mobility also correlate with localization, where the class I mutants displayed a diffuse distribution that included a cytoplasmic fraction, while the class II mutants retained clear evidence of subnuclear compartmentalization. The specificity of these findings is underscored by the properties of the only two WS missense mutations outside of either DNA-binding domain, A196T and Q391H. Consistent with the idea they occur at intron–exon junctions and are thought to contribute to PAX3 dysfunction by aberrant splicing, neither mutant had an appreciable affect on PAX3 mobility (Fig. 4C). Importantly, the differences in mobility among the two mutant classes and wild-type PAX3-GFP are independent of protein expression levels. Specifically, none of the PAX3 variants were expressed at abnormally high levels, indicating that the increased mobility and unbound fraction of the fastest-recovering PAX3 variants is not due to the saturation of binding sites or other nuclear constituents that constrain PAX3 movement. Together, these observations indicate that disease-causing alleles of PAX3 exert significant effects on mobility and provide the first measure of PAX3 activity that is consistently altered in this collection of mutations.

The segregation of PAX3 mutants into two discrete categories based on localization and dynamics was unanticipated. To address whether these reflect completely separate effects and to further refine their mechanistic basis, representative mutants from each class were combined. This involved the creation of F45L/G81A (class II/class I) and F45L/S84F (class II/class II) PAX3-GFP fusions. In each case, DNA binding was assessed and compared with wild-type PAX3 and the singly mutated counterparts (F45L, G81A and S84F). As previously shown (26), the presence of a class II mutation was associated with a loss or reduction in PDHD DNA binding compared with wild-type (Fig. 5A). Significantly, this impairment was increased in severity in the class II/class II double mutant, suggesting that the effects of these mutations on DNA binding are additive. Nevertheless, the class II/class II combination did not display defects in localization or mobility over and above each individual mutation (Figs 5B and C). The class II/class I double mutant, however, fully recapitulated the mobility and localization of the class I mutant (Figs 5B and C), but with reduced (MITF) or absent (Tyrp-1) DNA binding (Fig. 5A). From a mechanistic standpoint, this indicates that robust DNA binding by class I proteins is not required for their increase in mobility or diffuse distribution and that these attributes supersede those of class II mutants when combined in cis. Moreover, it clearly establishes that class I and II mutations lead to PAX3 dysfunction via distinct means, such that altered nuclear dynamics appears to be the primary defect of the N47H, G81A and V265F proteins.


Figure 5
View larger version (41K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5. Mutations causing compartmentalization defects exert a dominant effect on PAX3 behavior in the nucleus. (A) Effects of class I (G81A), class II (F45L, S84F), class I/II (F45L/G81A), or class II/II (F45L/S84F) mutations on DNA binding properties of a recombinant protein encompassing the PAX3 paired domain and homeodomain (PDHD) were analyzed in mobility shift assays. Affinity of each mutant for the PAX3-binding elements of the MITF (top panel) and Tyrp-1 (middle panel) promoter sequences was compared with the wild-type PDHD protein (lane 1). Free probe is shown for the bottom panel only; all PDHD proteins were equalized to the same concentration, as indicated in the Coomassie gel (bottom panel). (B) FRAP experiments showing recovery properties of wild-type PAX3-GFP (top row) and mutant PAX3-GFP proteins containing the F45L and G81A (middle row) or F45L and S84F (bottom row) mutations. (C) FRAP recovery curves for wild-type and double mutant PAX3-GFP in 10T1/2 cells. Plots show recovery versus time; wild-type PAX3-GFP plot represents the average of 30 individual FRAP experiments; mutant plots represent the average of 10 FRAP experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
In this study, we have examined the subnuclear distribution and dynamics of the developmentally important transcription factor PAX3 and numerous disease-causing mutants. Immunofluorescence of endogenous and exogenous PAX3 revealed a reticular pattern that was excluded from regions of heterochromatin (Fig. 1), but closely apposed to euchromatin (Fig. 2). This was most apparent with its global proximity to epigenetic marks of transcriptionally active chromatin, notably H3K4me3 and H3K36me3, which are associated with promoter (45,46) and transcribed regions (4749), respectively. In this regard, the distribution of PAX3 resembles that described for proteins that localize to the interchromatin space, exemplified by the RNAPII-associated transcription factor TFIIH (53,54), the ubiquitous SP1 and SP3 proteins (55), the POU domain transcription factor OCT1 (53), the HOX family member TLX1 (56), and the forkhead protein FOXC1 (57), among others (33). This subnuclear compartment appears as a complex, channel-like network that traverses between and within chromosome territories in the interphase nucleus (58). Moreover, PAX3 mobility (t50 of ~7.9 s) is similar to many other DNA-binding and chromatin-associated proteins with half maximal recovery times on the order of several seconds (59). Lastly, the fact that only a small subset of PAX3 co-localizes with H3K4me3 or sites of transcription delineated by 5'-FUrd incorporation also correlates with studies that found only a fraction of the total nuclear transcription factor population coincided with foci formed by RNAPII (53,6062). As a result, our findings with PAX3 are consistent with models where transcription factors accumulate predominantly in subnuclear domains within the interchromatin compartment, which may modulate their local concentration or serve as assembly sites for regulatory complexes and allow dynamic exchange with target sites (6365).

Disease mutations have been shown to disrupt or alter the in vivo action and in vitro biochemical properties of numerous transcription factors (6671). In the case of PAX3, disease-causing alterations range from complete deletions of the locus to single nucleotide substitutions. These lesions can lead to an absence of protein product, internal deletions or truncations, or missense mutations, which together establish that the WS phenotype arises from haploinsufficiency. With only two exceptions, A196T and Q391H, all known missense mutations occur in one of the two PAX3 DNA-binding domains (72), and loss-of-function analyses have therefore focused on DNA binding and reporter gene assays. These studies have revealed a range of effects on PAX3 DNA binding and reporter gene activity and demonstrate that these parameters do not always correlate–reductions in DNA binding did not necessarily lead to decreased values in reporter gene assays (79,2528). Given this disparity, it is significant that disease alleles were found to have more consistent effects on PAX3 mobility and that these correlate with localization and DNA binding (discussed below). Specifically, all mutations present within the PD or HD were characterized by increased mobility, which is further underscored by the fact that A196T and Q391H resembled wild-type PAX3 in terms of localization and mobility. This latter finding was not unexpected, as both mutations occur at intron–exon junctions and have been suggested to disrupt PAX3 function through aberrant splicing. From a mechanistic standpoint, the increase in mobility of PAX3 mutants represents a thermodynamic defect that may impede their ability to form functional complexes during transcription, an idea that is supported by the dynamic interdependence of the glucocorticoid receptor and high mobility group-B1 proteins (73). Lastly, based on the fact that increased mobility was a shared feature amongst a randomly selected cohort of seven WS mutations (and one Sp mutation), we suggest this may be a general characteristic of disease-causing missense alleles.

The increase in the mobility of PAX3 mutants reflects a loss of molecular interactions that constrain movement of the wild-type protein, the severity of which led to stratification of mutants into two groups. Accordingly, the mutants exhibiting the greatest mobility (class I: N47H, G81A and V265F) can be considered to manifest the most severe defect in these interactions and is consistent with their diffuse localization and lack of compartmentalization. Likewise, the intermediate effect of class II mutants (Spd, F45L, S84F, Y90H and R271G) on PAX3 movement suggests they retain sufficient interactions to confer a compartmentalized appearance. In this regard, PAX3 is similar to other transcription factors, where altered nuclear distribution (68,70,71,74,75) and increased mobility (7679) have been seen upon mutation of the DNA-binding domain, and are thought to derive from defects in protein-DNA interactions. For instance, analyses of wild-type and mutant forms of the NF-{kappa}B subunit p65 found that high mobility correlated with low DNA binding affinity and a more random distribution in the nucleus (78), and an analogous relationship was also demonstrated for the glucocorticoid receptor (80). Similarly, disease-causing mutations in the POU-class HD factor PIT1/POU1F1 lead to reductions in DNA binding activity and increase nuclear mobility (67). A key difference in the behavior of PAX3 mutants, however, is that their DNA binding properties are inversely correlated with their intranuclear localization and mobility, since these parameters are most severely affected by mutations (class I) that permit interaction with target sites at levels similar to wild-type PAX3. Although this suggests that DNA binding might be required for the rapid mobility and diffuse distribution of class I mutants, these attributes are retained even with the loss or reduction of DNA binding that occurs by combining with a class II mutation (Fig. 5). Together, these data indicate altered localization and mobility are important aspects of PAX3 dysfunction in WS, and represent the principal defect in class I mutants where they supersede DNA binding.

Class I and II mutants can be separated by a single amino acid in the PAX3 primary structure, as seen for F45L and N47H. Moreover, when these mutants are examined in the context of the DNA-bound PD or HD crystal structures, or models where the domains are bound to the composite PH0 motif (81), there is no obvious correlation between the position of mutations and their effects on localization and mobility (summarized in Fig. 6A). For instance, mutations in separate DNA-binding domains could belong to the same mutant class, while those that were spatially close were just as likely to segregate to different classes. This can be illustrated by the proximity of F45L (class II) and N47H (class I), which both project side chains toward the minor groove in the PD crystal structure, while G81A (class I) and S84F (class II) lie on the same surface of helix 3 of the amino-terminal PD subdomain, facing the major groove (Fig. 6A). As a result of this spatial relationship, it is unlikely that each mutational class affects a distinct interaction surface. Rather, these data suggest that class II proteins retain determinants that constrain their localization, but attenuation of the underlying interaction(s) that support compartmentalization leads to increased mobility (Fig. 6B). In contrast, class I mutations would cause a loss of key interaction surfaces altogether, which is underscored by finding that rapid mobility and diffuse localization prevail when class I and II mutations are present in the same polypeptide (Fig. 6B).


Figure 6
View larger version (28K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 6. Disease mutations exert differential effects on determinants that constrain PAX3 activity in the nucleus. (A) Ribbon structures of the PAX3 homeodomain (left) and amino-terminal paired subdomain (right) showing the spatial proximity of selected class I (dark gray) and class II (light gray) mutations. The model depicts the DNA binding surface of the PD and HD oriented as they would appear on a composite PH0 motif. (B) Summary of the effects of class I and II mutations on PAX3 behavior in vivo. Wild-type PAX3 and proteins from the two mutant classes each display unique recovery profiles in FRAP experiments; the increase in mobility among class II mutants reflects impairments in molecular interactions that constrain local movement of PAX3, while conformational alterations (indicated by the change in structure, middle) appear to underlie the further increase in mobility of class I mutants. Schematic diagrams on the right summarize the compartmentalized pattern of class II mutants (bottom) and diffuse, uncompartmentalized phenotype of class I mutants (top). Green, PAX3; red, Hoechst; black, pericentromeric heterochromatin foci (PCH).

 
When combined with our observation that all class I mutants exhibit a cytoplasmic fraction, reflecting a defect in nuclear import or retention, the most likely explanation for the behavior of class I mutants would involve altered conformation (Fig. 6B). In this context, protein chaperones have important roles in regulating transcription factor mobility, as well as their transport to and from the nucleus (reviewed in 82), and more recently in ‘buffering’ phenotypic variability (83). This idea is particularly attractive given the ability of the Hsp90 chaperone to modulate the developmental phenotype caused by a missense mutation in zebrafish pax6b, leading to the suggestion that phenotypic variability may derive from alterations in chaperone activity (84). Applying this concept to PAX3, altered mobility is likely an important parameter in accounting for the seemingly stochastic phenotypic diversity in WS. Together, these data highlight the molecular complexity of disease-causing mutations in PAX3 and indicate that mutations in close proximity in both the primary and tertiary structure can have remarkably diverse effects.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
Cell culture
Mouse embryonic fibroblast C3H 10T1/2 cells and B16F10 murine melanoma cells were obtained from American Type Culture Collection. Cells were maintained in DMEM supplemented with 2 mM L-glutamine and 10% FBS at 37°C and 5% CO2.

Antibodies
Two commercially available PAX3-specific antibodies were used, one, a mouse monoclonal antibody developed by C. Ordahl (University of California, San Francisco) and obtained from the Developmental Studies Hybridoma Bank, NICHD/University of Iowa (1:200) and the other, a goat polyclonal antibody from R&D Biosystems (1:100). Other antibodies were specific for BrdU (1:1000; Sigma) and H3K4me3 (1:500; Abcam).

Expression constructs
The untagged PAX3 expression plasmid has been described previously (26). An EcoRI-BamHI PCR fragment containing the entire PAX3 coding sequence was inserted into pEGFP-N1 (Clontech) to allow expression of PAX3 with a carboxy-terminal GFP tag (PAX3-GFP); primers used were: GFP.PAX3.F 5'-CAGAATTCTGATGACCACGCTGGCC and GFP.PAX3.R 5'-CAGGATCCTGGAACGTCCAAGGCTT. Mutant PAX3-GFP constructs were created by exchanging an XmaI fragment from wild-type PAX3-GFP for one containing the mutation from a construct previously mutated by site directed mutagenesis (26).

The wild-type PAX3 PDHD expression construct has been described previously (26). Mutant versions of the pET21a-PDHD plasmid were created by PCR-amplifying an insert containing amino acids 34–279 of PAX3 from the corresponding pEGFP-N1-PAX3 construct (discussed above). Primers used were: pET.PD.F 5'- CAGGATCCGGCCAGGGCCGAGTCAA and pET.HD.R 5'- CCTGCGGCCGCAAGCTTTCCAGCTTGTTTCCTCC.

Immunocytochemistry
Cells were seeded on glass cover slips in 6-well plates at a density of ~1.0 x 106 cells/ml. After 24 h growth, cells were transfected with 1 µg DNA in DMEM containing polyethylenimine (PEI). At 24 h post-transfection, cells were washed in PBS and fixed for 5 min at room temperature with 4% paraformaldehyde in PBS. Cells were then permeabilized with 10% Triton X-100 in PBS. Cells transfected with GFP constructs were mounted onto glass slides with 20 µl Mowiol containing 1 µg/ml Hoechst 33258 (Sigma). For immunofluorescence, cells were blocked using 5% PBS–BSA for 1 h and washed 3x with 1% PBS–BSA prior to application of primary antibodies diluted in 1% PBS–BSA. Cells were washed 3x with 1% PBS–BSA then incubated with a secondary antibody (Sigma; 1:400 in 1% PBS–BSA) conjugated to a fluorescent moiety for 1 h. Coverslips were washed with PBS and mounted onto glass slides with 20 µl Mowiol containing 1 µg/ml Hoechst 33258 (Sigma). Fluorouridine (5-FUrd) staining of B16F10 cells or PAX3-transfected 10T1/2 cells was performed by diluting 5-FUrd in DMEM to a final concentration of 1 mM, then adding this mixture to cells and incubating for 30 min at 37°C.

Epifluorescence imaging was performed using a Zeiss Axioplan 2 optical microscope equipped with a Photometrics CoolSnap HQ CCD camera (Roper Scientific Inc.). Images were captured using Metamorph 2.6r6 (Molecular Devices) and processed with Huygens deconvolution software (Scientific Volume Imaging). Three-dimensional rendering and image construction was performed using Imaris (Bitplane AG).

Fluorescence recovery after photobleaching
PAX3-GFP constructs were transfected into 10T1/2 cells and images were collected with a Zeiss Laser Scanning Confocal Microscope (LSM 510, software version LSM 3.2) mounted on a Zeiss Axiovert M100 inverted microscope with a 40x apochromatic lens (numerical aperture 1.3). The 488 nm laser line (from a 25 mW argon laser) was used to image the PAX3-GFP constructs. A long pass filter (505 nm) was used to collect emission from the PAX3-GFP constructs. A 2 µM rectangle was bleached across the center of the nucleus and images were taken at 1 s intervals for the first 4 s, 2 s intervals from seconds 4 to 14, and 5 s intervals from seconds 14 to 90 following the bleach.

Recombinant protein expression and electrophoretic mobility shift assay
Expression and purification of the PDHD proteins and mobility shift assays were performed as previously described (26).


    SUPPLEMENTARY MATERIAL
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
Supplementary Material is available at HMG Online.


    FUNDING
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
D.A.U. is supported by the Alberta Heritage Foundation for Medical Research and Mary Johnston Melanoma Research Chair, and G.N.C. is supported by a postgraduate scholarship from the Natural Sciences and Engineering Research Council of Canada. Canadian Institutes of Health Research (MOP#37998 to D.A.U.); Alberta Cancer Board (ACB#20207 to D.A.U.).


    ACKNOWLEDGEMENTS
 
The authors wish to thank Dr R. Wevrick and J. Bush for the primary limb bud cultures, N. Hu, L. Ehrman, and K. Missiaen for technical assistance, Dr X. Sun and G. Barron for assistance with microscopy, and Dr S. Baksh for PEI.

Conflict of Interest statement. None declared.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 

  1. Relaix F., Montarras D., Zaffran S., Gayraud-Morel B., Rocancourt D., Tajbakhsh S., Mansouri A., Cumano A., Buckingham M. Pax3 and Pax7 have distinct and overlapping functions in adult muscle progenitor cells. J. Cell Biol. (2006) 172:91–102.[Abstract/Free Full Text]

  2. Kuang S., Charge S.B., Seale P., Huh M., Rudnicki M.A. Distinct roles for Pax7 and Pax3 in adult regenerative myogenesis. J. Cell Biol. (2006) 172:103–113.[Abstract/Free Full Text]

  3. Goulding M.D., Chalepakis G., Deutsch U., Erselius J.R., Gruss P. Pax-3, a novel murine DNA binding protein expressed during early neurogenesis. EMBO J. (1991) 10:1135–1147.[Web of Science][Medline]

  4. Chi N., Epstein J.A. Getting your Pax straight: Pax proteins in development and disease. Trends Genet. (2002) 18:41–47.[CrossRef][Web of Science][Medline]

  5. Treisman J., Harris E., Desplan C. The paired box encodes a second DNA-binding domain in the paired homeo domain protein. Genes Dev. (1991) 5:594–604.[Abstract/Free Full Text]

  6. Underhill D.A. Genetic and biochemical diversity in the Pax gene family. Biochem. Cell Biol. (2000) 78:629–638.[CrossRef][Web of Science][Medline]

  7. Underhill D.A., Vogan K.J., Gros P. Analysis of the mouse Splotch-delayed mutation indicates that the Pax-3 paired domain can influence homeodomain DNA-binding activity. Proc. Natl Acad. Sci. USA (1995) 92:3692–3696.[Abstract/Free Full Text]

  8. Underhill D.A., Gros P. The paired-domain regulates DNA binding by the homeodomain within the intact Pax-3 protein. J. Biol. Chem. (1997) 272:14175–14182.[Abstract/Free Full Text]

  9. Fortin A.S., Underhill D.A., Gros P. Reciprocal effect of Waardenburg syndrome mutations on DNA binding by the Pax-3 paired domain and homeodomain. Hum. Mol. Genet. (1997) 6:1781–1790.[Abstract/Free Full Text]

  10. Fortin A.S., Underhill D.A., Gros P. Helix 2 of the paired domain plays a key role in the regulation of DNA-binding by the Pax-3 homeodomain. Nucleic Acids Res. (1998) 26:4574–4581.[Abstract/Free Full Text]

  11. Apuzzo S., Gros P. Site-specific modification of single cysteine Pax3 mutants reveals reciprocal regulation of DNA binding activity of the paired and homeo domain. Biochemistry (2002) 41:12076–12085.[CrossRef][Web of Science][Medline]

  12. Apuzzo S., Abdelhakim A., Fortin A.S., Gros P. Cross-talk between the paired domain and the homeodomain of Pax3: DNA binding by each domain causes a structural change in the other domain, supporting interdependence for DNA Binding. J. Biol. Chem. (2004) 279:33601–33612.[Abstract/Free Full Text]

  13. Epstein D.J., Vogan K.J., Trasler D.G., Gros P. A mutation within intron 3 of the Pax-3 gene produces aberrantly spliced mRNA transcripts in the splotch (Sp) mouse mutant. Proc. Natl Acad. Sci. USA (1993) 90:532–536.[Abstract/Free Full Text]

  14. Epstein D.J., Vekemans M., Gros P. Splotch (Sp2H), a mutation affecting development of the mouse neural tube, shows a deletion within the paired homeodomain of Pax-3. Cell (1991) 67:767–774.[CrossRef][Web of Science][Medline]

  15. Vogan K.J., Epstein D.J., Trasler D.G., Gros P. The splotch-delayed (Spd) mouse mutant carries a point mutation within the paired box of the Pax-3 gene. Genomics (1993) 17:364–369.[CrossRef][Web of Science][Medline]

  16. Moase C.E., Trasler D.G. Splotch locus mouse mutants: models for neural tube defects and Waardenburg syndrome type I in humans. J. Med. Genet. (1992) 29:145–151.[Free Full Text]

  17. Franz T., Kothary R. Characterization of the neural crest defect in Splotch (Sp1H) mutant mice using a lacZ transgene. Brain Res. Dev. Brain Res. (1993) 72:99–105.[CrossRef][Medline]

  18. Li J., Liu K.C., Jin F., Lu M.M., Epstein J.A. Transgenic rescue of congenital heart disease and spina bifida in Splotch mice. Development (1999) 126:2495–2503.[Abstract]

  19. Baldwin C.T., Hoth C.F., Amos J.A., da-Silva E.O., Milunsky A. An exonic mutation in the HuP2 paired domain gene causes Waardenburg’s syndrome. Nature (1992) 355:637–638.[CrossRef][Medline]

  20. Hoth C.F., Milunsky A., Lipsky N., Sheffer R., Clarren S.K., Baldwin C.T. Mutations in the paired domain of the human PAX3 gene cause Klein-Waardenburg syndrome (WS-III) as well as Waardenburg syndrome type I (WS-I). Am. J. Hum. Genet. (1993) 52:455–462.[Web of Science][Medline]

  21. Tassabehji M., Read A.P., Newton V.E., Harris R., Balling R., Gruss P., Strachan T. Waardenburg’s syndrome patients have mutations in the human homologue of the Pax-3 paired box gene. Nature (1992) 355:635–636.[CrossRef][Medline]

  22. Tassabehji M., Read A.P., Newton V.E., Patton M., Gruss P., Harris R., Strachan T. Mutations in the PAX3 gene causing Waardenburg syndrome type 1 and type 2. Nat. Genet. (1993) 3:26–30.[CrossRef][Web of Science][Medline]

  23. Galili N., Davis R.J., Fredericks W.J., Mukhopadhyay S., Rauscher F.J. 3rd, Emanuel B.S., Rovera G., Barr F.G. Fusion of a fork head domain gene to PAX3 in the solid tumour alveolar rhabdomyosarcoma. Nat. Genet. (1993) 5:230–235.[CrossRef][Web of Science][Medline]

  24. Shapiro D.N., Sublett J.E., Li B., Downing J.R., Naeve C.W. Fusion of PAX3 to a member of the forkhead family of transcription factors in human alveolar rhabdomyosarcoma. Cancer Res. (1993) 53:5108–5112.[Abstract/Free Full Text]

  25. Chalepakis G., Goulding M., Read A., Strachan T., Gruss P. Molecular basis of splotch and Waardenburg Pax-3 mutations. Proc. Natl. Acad. Sci. USA (1994) 91:3685–3689.[Abstract/Free Full Text]

  26. Corry G.N., Underhill D.A. Pax3 target gene recognition occurs through distinct modes that are differentially affected by disease-associated mutations. Pigment Cell Res. (2005) 18:427–438.[Web of Science][Medline]

  27. Epstein J.A., Shapiro D.N., Cheng J., Lam P.Y., Maas R.L. Pax3 modulates expression of the c-Met receptor during limb muscle development. Proc. Natl Acad. Sci. USA (1996) 93:4213–4218.[Abstract/Free Full Text]

  28. Watanabe A., Takeda K., Ploplis B., Tachibana M. Epistatic relationship between Waardenburg syndrome genes MITF and PAX3. Nat. Genet. (1998) 18:283–286.[CrossRef][Web of Science][Medline]

  29. Galibert M.D., Yavuzer U., Dexter T.J., Goding C.R. Pax3 and regulation of the melanocyte-specific tyrosinase-related protein-1 promoter. J. Biol. Chem. (1999) 274:26894–26900.[Abstract/Free Full Text]

  30. de Jong L., Grande M.A., Mattern K.A., Schul W., van Driel R. Nuclear domains involved in RNA synthesis, RNA processing, and replication. Crit. Rev. Eukaryot. Gene Expr. (1996) 6:215–246.[Web of Science][Medline]

  31. Lamond A.I., Earnshaw W.C. Structure and function in the nucleus. Science (1998) 280:547–553.[Abstract/Free Full Text]

  32. Misteli T. Beyond the sequence: cellular organization of genome function. Cell (2007) 128:787–800.[CrossRef][Web of Science][Medline]

  33. Spector D.L. The dynamics of chromosome organization and gene regulation. Annu. Rev. Biochem. (2003) 72:573–608.[CrossRef][Web of Science][Medline]

  34. Corry G.N., Underhill D.A. Subnuclear compartmentalization of sequence-specific transcription factors and regulation of eukaryotic gene expression. Biochem. Cell Biol. (2005) 83:535–547.[CrossRef][Web of Science][Medline]

  35. Gorski S.A., Dundr M., Misteli T. The road much traveled: trafficking in the cell nucleus. Curr. Opin. Cell Biol. (2006) 18:284–290.[CrossRef][Web of Science][Medline]

  36. Lanctot C., Cheutin T., Cremer M., Cavalli G., Cremer T. Dynamic genome architecture in the nuclear space: regulation of gene expression in three dimensions. Nat. Rev. Genet. (2007) 8:104–115.[CrossRef][Web of Science][Medline]

  37. Marshall W.F., Straight A., Marko J.F., Swedlow J., Dernburg A., Belmont A., Murray A.W., Agard D.A., Sedat J.W. Interphase chromosomes undergo constrained diffusional motion in living cells. Curr. Biol. (1997) 7:930–939.[CrossRef][Web of Science][Medline]

  38. Vazquez J., Belmont A.S., Sedat J.W. Multiple regimes of constrained chromosome motion are regulated in the interphase Drosophila nucleus. Curr. Biol. (2001) 11:1227–1239.[CrossRef][Web of Science][Medline]

  39. Chuang C.H., Carpenter A.E., Fuchsova B., Johnson T., de Lanerolle P., Belmont A.S. Long-range directional movement of an interphase chromosome site. Curr. Biol. (2006) 16:825–831.[CrossRef][Web of Science][Medline]

  40. Dundr M., Ospina J.K., Sung M.H., John S., Upender M., Ried T., Hager G.L., Matera A.G. Actin-dependent intranuclear repositioning of an active gene locus in vivo. J. Cell Biol. (2007) 179:1095–1103.[Abstract/Free Full Text]

  41. Chubb J.R., Boyle S., Perry P., Bickmore W.A. Chromatin motion is constrained by association with nuclear compartments in human cells. Curr. Biol. (2002) 12:439–445.[CrossRef][Web of Science][Medline]

  42. Levi V., Ruan Q., Plutz M., Belmont A.S., Gratton E. Chromatin dynamics in interphase cells revealed by tracking in a two-photon excitation microscope. Biophys. J. (2005) 89:4275–4285.[CrossRef][Web of Science][Medline]

  43. Schneider R., Grosschedl R. Dynamics and interplay of nuclear architecture, genome organization, and gene expression. Genes Dev. (2007) 21:3027–3043.[Abstract/Free Full Text]

  44. Eberharter A., Becker P.B. Histone acetylation: a switch between repressive and permissive chromatin. Second in review series on chromatin dynamics. EMBO Rep. (2002) 3:224–229.[CrossRef][Web of Science][Medline]

  45. Ng H.H., Robert F., Young R.A., Struhl K. Targeted recruitment of Set1 histone methylase by elongating Pol II provides a localized mark and memory of recent transcriptional activity. Mol. Cell (2003) 11:709–719.[CrossRef][Web of Science][Medline]

  46. Santos-Rosa H., Schneider R., Bannister A.J., Sherriff J., Bernstein B.E., Emre N.C., Schreiber S.L., Mellor J., Kouzarides T. Active genes are tri-methylated at K4 of histone H3. Nature (2002) 419:407–411.[CrossRef][Medline]

  47. Krogan N.J., Kim M., Tong A., Golshani A., Cagney G., Canadien V., Richards D.P., Beattie B.K., Emili A., Boone C., et al. Methylation of histone H3 by Set2 in Saccharomyces cerevisiae is linked to transcriptional elongation by RNA polymerase II. Mol. Cell. Biol. (2003) 23:4207–4218.[Abstract/Free Full Text]

  48. Li B., Howe L., Anderson S., Yates J.R. 3rd, Workman J.L. The Set2 histone methyltransferase functions through the phosphorylated carboxyl-terminal domain of RNA polymerase II. J. Biol. Chem. (2003) 278:8897–8903.[Abstract/Free Full Text]

  49. Xiao T., Hall H., Kizer K.O., Shibata Y., Hall M.C., Borchers C.H., Strahl B.D. Phosphorylation of RNA polymerase II CTD regulates H3 methylation in yeast. Genes Dev. (2003) 17:654–663.[Abstract/Free Full Text]

  50. Lachner M., O’Carroll D., Rea S., Mechtler K., Jenuwein T. Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature (2001) 410:116–120.[CrossRef][Web of Science][Medline]

  51. Peters A.H., Mermoud J.E., O’Carroll D., Pagani M., Schweizer D., Brockdorff N., Jenuwein T. Histone H3 lysine 9 methylation is an epigenetic imprint of facultative heterochromatin. Nat. Genet. (2002) 30:77–80.[CrossRef][Web of Science][Medline]

  52. Schotta G., Lachner M., Sarma K., Ebert A., Sengupta R., Reuter G., Reinberg D., Jenuwein T. A silencing pathway to induce H3-K9 and H4-K20 trimethylation at constitutive heterochromatin. Genes Dev. (2004) 18:1251–1262.[Abstract/Free Full Text]

  53. Grande M.A., van der Kraan I., de Jong L., van Driel R. Nuclear distribution of transcription factors in relation to sites of transcription and RNA polymerase II. J. Cell Sci. (1997) 110:1781–1791.[Abstract]

  54. Verschure P.J., Van Der Kraan I., Enserink J.M., Mone M.J., Manders E.M., Van Driel R. Large-scale chromatin organization and the localization of proteins involved in gene expression in human cells. J. Histochem. Cytochem. (2002) 50:1303–1312.[Abstract/Free Full Text]

  55. He S., Davie J.R. Sp1 and Sp3 foci distribution throughout mitosis. J. Cell Sci. (2006) 119:1063–1070.[Abstract/Free Full Text]

  56. Riz I., Akimov S.S., Eaker S.S., Baxter K.K., Lee H.J., Marino-Ramirez L., Landsman D., Hawley T.S., Hawley R.G. TLX1/HOX11-induced hematopoietic differentiation blockade. Oncogene (2007) 26:4115–4123.[CrossRef][Web of Science][Medline]

  57. Berry F.B., O’Neill M.A., Coca-Prados M., Walter M.A. FOXC1 transcriptional regulatory activity is impaired by PBX1 in a filamin A-mediated manner. Mol. Cell. Biol. (2005) 25:1415–1424.[Abstract/Free Full Text]

  58. Zirbel R.M., Mathieu U.R., Kurz A., Cremer T., Lichter P. Evidence for a nuclear compartment of transcription and splicing located at chromosome domain boundaries. Chromosome Res. (1993) 1:93–106.[CrossRef][Medline]

  59. Phair R.D., Scaffidi P., Elbi C., Vecerova J., Dey A., Ozato K., Brown D.T., Hager G., Bustin M., Misteli T. Global nature of dynamic protein-chromatin interactions in vivo: three-dimensional genome scanning and dynamic interaction networks of chromatin proteins. Mol. Cell. Biol. (2004) 24:6393–6402.[Abstract/Free Full Text]

  60. van Steensel B., Brink M., van der Meulen K., van Binnendijk E.P., Wansink D.G., de Jong L., de Kloet E.R., van Driel R. Localization of the glucocorticoid receptor in discrete clusters in the cell nucleus. J. Cell Sci. (1995) 108:3003–3011.[Abstract]

  61. van Steensel B., van Binnendijk E.P., Hornsby C.D., van der Voort H.T., Krozowski Z.S., de Kloet E.R., van Driel R. Partial colocalization of glucocorticoid and mineralocorticoid receptors in discrete compartments in nuclei of rat hippocampus neurons. J. Cell Sci. (1996) 109:787–792.[Abstract]

  62. Elefanty A.G., Antoniou M., Custodio N., Carmo-Fonseca M., Grosveld F.G. GATA transcription factors associate with a novel class of nuclear bodies in erythroblasts and megakaryocytes. EMBO J. (1996) 15:319–333.[Web of Science][Medline]

  63. Hager G.L., Elbi C., Becker M. Protein dynamics in the nuclear compartment. Curr. Opin. Genet. Dev. (2002) 12:137–141.[CrossRef][Web of Science][Medline]

  64. Hendzel M.J., Kruhlak M.J., MacLean N.A., Boisvert F., Lever M.A., Bazett-Jones D.P. Compartmentalization of regulatory proteins in the cell nucleus. J. Steroid Biochem. Mol. Biol. (2001) 76:9–21.[CrossRef][Web of Science][Medline]

  65. van Holde K., Zlatanova J. Scanning chromatin: a new paradigm? J. Biol. Chem. (2006) 281:12197–12200.[Free Full Text]

  66. Kino T., Liou S.H., Charmandari E., Chrousos G.P. Glucocorticoid receptor mutants demonstrate increased motility inside the nucleus of living cells: time of fluorescence recovery after photobleaching (FRAP) is an integrated measure of receptor function. Mol. Med. (2004) 10:80–88.[Medline]

  67. Sharp Z.D., Stenoien D.L., Mancini M.G., Ouspenski I.I., Mancini M.A. Inactivating Pit-1 mutations alter subnuclear dynamics suggesting a protein misfolding and nuclear stress response. J. Cell. Biochem. (2004) 92:664–678.[CrossRef][Web of Science][Medline]

  68. Rajaram N., Kerppola T.K. Synergistic transcription activation by Maf and Sox and their subnuclear localization are disrupted by a mutation in Maf that causes cataract. Mol. Cell. Biol. (2004) 24:5694–5709.[Abstract/Free Full Text]

  69. Nazareth L.V., Stenoien D.L., Bingman W.E. 3rd, James A.J., Wu C., Zhang Y., Edwards D.P., Mancini M., Marcelli M., Lamb D.J., et al. A C619Y mutation in the human androgen receptor causes inactivation and mislocalization of the receptor with concomitant sequestration of SRC-1 (steroid receptor coactivator 1). Mol. Endocrinol. (1999) 13:2065–2075.[Abstract/Free Full Text]

  70. Enwright J.F. 3rd, Kawecki-Crook M.A., Voss T.C., Schaufele F., Day R.N. A PIT-1 homeodomain mutant blocks the intranuclear recruitment of the CCAAT/enhancer binding protein alpha required for prolactin gene transcription. Mol. Endocrinol. (2003) 17:209–222.[Abstract/Free Full Text]

  71. Black B.E., Vitto M.J., Gioeli D., Spencer A., Afshar N., Conaway M.R., Weber M.J., Paschal B.M. Transient, ligand-dependent arrest of the androgen receptor in subnuclear foci alters phosphorylation and coactivator interactions. Mol. Endocrinol. (2004) 18:834–850.[Abstract/Free Full Text]

  72. Read A.P., Newton V.E. Waardenburg syndrome. J. Med. Genet. (1997) 34:656–665.[Abstract/Free Full Text]

  73. Agresti A., Scaffidi P., Riva A., Caiolfa V.R., Bianchi M.E. GR and HMGB1 interact only within chromatin and influence each other’s residence time. Mol. Cell (2005) 18:109–121.[CrossRef][Web of Science][Medline]

  74. Kawate H., Wu Y., Ohnaka K., Tao R.H., Nakamura K., Okabe T., Yanase T., Nawata H., Takayanagi R. Impaired nuclear translocation, nuclear matrix targeting, and intranuclear mobility of mutant androgen receptors carrying amino acid substitutions in the deoxyribonucleic acid-binding domain derived from androgen insensitivity syndrome patients. J. Clin. Endocrinol. Metab. (2005) 90:6162–6169.[Abstract/Free Full Text]

  75. Day R.N., Voss T.C., Enwright J.F. 3rd, Booker C.F., Periasamy A., Schaufele F. Imaging the localized protein interactions between Pit-1 and the CCAAT/enhancer binding protein alpha in the living pituitary cell nucleus. Mol. Endocrinol. (2003) 17:333–345.[Abstract/Free Full Text]

  76. Farla P., Hersmus R., Geverts B., Mari P.O., Nigg A.L., Dubbink H.J., Trapman J., Houtsmuller A.B. The androgen receptor ligand-binding domain stabilizes DNA binding in living cells. J. Struct. Biol. (2004) 147:50–61.[CrossRef][Web of Science][Medline]

  77. Karpova T.S., Chen T.Y., Sprague B.L., McNally J.G. Dynamic interactions of a transcription factor with DNA are accelerated by a chromatin remodeller. EMBO Rep. (2004) 5:1064–1070.[CrossRef][Web of Science][Medline]

  78. Schaaf M.J., Willetts L., Hayes B.P., Maschera B., Stylianou E., Farrow S.N. The relationship between intranuclear mobility of the NF-kappaB subunit p65 and its DNA binding affinity. J. Biol. Chem. (2006) 281:22409–22420.[Abstract/Free Full Text]

  79. Schaaf M.J., Cidlowski J.A. Molecular determinants of glucocorticoid receptor mobility in living cells: the importance of ligand affinity. Mol. Cell. Biol. (2003) 23:1922–1934.[Abstract/Free Full Text]

  80. Schaaf M.J., Lewis-Tuffin L.J., Cidlowski J.A. Ligand-selective targeting of the glucocorticoid receptor to nuclear subdomains is associated with decreased receptor mobility. Mol. Endocrinol. (2005) 19:1501–1515.[Abstract/Free Full Text]

  81. Jun S., Desplan C. Cooperative interactions between paired domain and homeodomain. Development (1996) 122:2639–2650.[Abstract]

  82. Hager G.L., Elbi C., Johnson T.A., Voss T., Nagaich A.K., Schiltz R.L., Qiu Y., John S. Chromatin dynamics and the evolution of alternate promoter states. Chromosome Res. (2006) 14:107–116.[CrossRef][Web of Science][Medline]

  83. Rutherford S.L. Between genotype and phenotype: protein chaperones and evolvability. Nat. Rev. Genet. (2003) 4:263–274.[CrossRef][Web of Science][Medline]

  84. Yeyati P.L., Bancewicz R.M., Maule J., van Heyningen V. Hsp90 selectively modulates phenotype in vertebrate development. PLoS Genet. (2007) 3:e43.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
17/12/1825    most recent
ddn076v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Corry, G. N.
Right arrow Articles by Underhill, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Corry, G. N.
Right arrow Articles by Underhill, D. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?