Skip Navigation


Human Molecular Genetics Advance Access originally published online on March 15, 2008
Human Molecular Genetics 2008 17(13):1904-1915; doi:10.1093/hmg/ddn088
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow A corrigendum has been published
Right arrow A corrigendum has been published
Right arrow All Versions of this Article:
17/13/1904    most recent
ddn088v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Martin, D. C.
Right arrow Articles by Triggs-Raine, B. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martin, D. C.
Right arrow Articles by Triggs-Raine, B. L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2008. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

A mouse model of human mucopolysaccharidosis IX exhibits osteoarthritis

Dianna C. Martin1, Vasantha Atmuri1, Richard J. Hemming1, Judith Farley3, John S. Mort3, Sharon Byers4,5, Sabine Hombach-Klonisch2, Robert Stern6 and Barbara L. Triggs-Raine1,*

1 Department of Biochemistry and Medical Genetics and 2 Department of Human Anatomy and Cell Science, University of Manitoba, 770 Bannatyne Avenue, Winnipeg, MB, Canada R3E 0W3 3 Joint Diseases Laboratory, Shriner’s Hospital for Children, 1529 Cedar Avenue, Montreal, QC, Canada H3G 1A6 4 Matrix Biology Unit, Department of Genetic Medicine, Children, Youth and Women’s Health Service, 72 King William Road, North Adelaide, SA 5006, Australia 5 Department of Paediatrics, The University of Adelaide, Adelaide, SA 5000, Australia 6 Department of Pathology, School of Medicine, University of California, San Francisco, CA 94143-0511, USA

* To whom correspondence should be addressed: Tel: +1 2047893218; Fax: +1 2047893900; Email: traine{at}ms.umanitoba.ca

Received December 21, 2007; Revised February 14, 2008; Accepted March 13, 2008


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
Hyaluronidases are endoglycosidases that hydrolyze hyaluronan (HA), an abundant component of the extracellular matrix of vertebrate connective tissues. Six human hyaluronidase-related genes have been identified to date. Mutations in one of these genes cause a deficiency of hyaluronidase 1 (HYAL1) resulting in a lysosomal storage disorder, mucopolysaccharidosis (MPS) IX. We have characterized a mouse model of MPS IX and compared its phenotype with the human disease. The targeted Hyal1 allele in this model had a neomycin resistance cassette in exon 2 that replaced 753 bp of the coding region containing the predicted enzyme active site. As a result, Hyal1-/- animals had no detectable wild-type Hyal1 transcript, protein or serum activity. Hyal1 null animals were viable, fertile and showed no gross abnormalities at 1 year and 8 months of age. Histological studies of the knee joint showed a loss of proteoglycans occurring as early as 3 months that progressed with age. An increased number of chondrocytes displaying intense pericellular and/or cytoplasmic HA staining were detected in the epiphyseal and articular cartilage of null mice, demonstrating an accumulation of HA. Elevations of HA were not detected in the serum or non-skeletal tissues, indicating that osteoarthritis is the key disease feature in a Hyal1 deficiency. Hyal3 expression was elevated in Hyal1 null mice, suggesting that Hyal3 may compensate in HA degradation in non-skeletal tissues. Overall, the murine MPS IX model displays the key features of the human disease.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
Mucopolysaccharidoses are a group of inherited lysosomal storage disorders, each caused by a deficiency of an enzyme essential in glycosaminoglycan (GAG) degradation (1). As a result, GAG substrates accumulate in high turnover cells and organs, resulting in a range of disabling and often fatal symptoms (2). Mucopolysaccharidosis (MPS) IX is a rare autosomal recessive disease caused by a hyaluronidase deficiency. It was described in 1996, when a patient presented with periarticular masses and mild short stature (3). Radiographic analysis showed nodular synovia, acetabular erosions and a popliteal cyst. Lysosomal storage of hyaluronan (HA) was evident within the macrophages and fibroblasts of biopsied soft-tissue masses, and serum concentrations were elevated 38–90-fold. MPS IX was later determined to be caused by mutations in HYAL1, a gene encoding hyaluronidase 1 (4).

There are six human hyaluronidase-related genes that are localized in two chromosomal regions, 3p21.3 (HYAL1, HYAL2, HYAL3) and 7q31.3 (HYAL4, HYALP1, SPAM1) (5). The mouse orthologs are found in a similar organization on chromosomes 9F1–9F2 and 6A2, respectively (5). Hyal5, a seventh gene found only in rodents to date, has been identified downstream of Spam1 (6). These genes are predicted to encode hyaluronidases, endoglycosidases that initiate the degradation of HA, a large negatively charged GAG found in the extracellular matrix (ECM) of all vertebrate cells. HA is essential to ECM assembly, macromolecular steric exclusion and cell–cell adhesion (7). HA is especially abundant in loose connective tissues, such as the Wharton’s jelly of the umbilical cord, the synovial fluid of the joint and the vitreous humor of the eye (7).

HA synthesis and degradation is a constitutive process, where one-third of the 15 g of HA found in the average adult is turned over each day (8). Although most HA degradation occurs in the lymph node, local degradation has also been demonstrated (911). HA escaping local and lymphatic degradation enters the circulation and is removed by blood-filtering organs (12). The turnover rate of HA is high in most tissues, but the half-life of HA can range from 1 h to 70 days (13). Receptors for endocytosis include HyAluronan Receptor for Endocytosis (HARE) and Cluster of Differentiation 44 (CD44); however, their specific contributions to HA uptake in different tissues remain unknown (14,15). Given the biological abundance and high turnover rate of HA, the mild clinical phenotype associated with a HYAL1 deficiency was surprising and suggested that additional hyaluronidase genes may compensate in the absence of HYAL1.

Of the predicted hyaluronidases, those encoded by human HYAL4, HYALP1 and SPAM1, or mouse Hyal5, are unlikely to play a major role in constitutive HA degradation. These genes display tissue-specific expression, with the majority expressed only in the testes (6,16). Therefore, the broadly expressed genes, HYAL1, HYAL2 and HYAL3, are more likely to play a central role in constitutive degradation. HYAL2 is expressed in all tissues, with the exception of the brain, whereas HYAL1 displays the highest expression in tissues with abundant HA or high rates of turnover (16). HYAL1 and HYAL2 have acidic hyaluronidase activities, but differ in their specificities to the size of HA. HYAL2 recognizes only high-molecular-weight HA, whereas HYAL1 recognizes HA of any size (17,18). HYAL1 and HYAL2 are soluble enzymes, although a glycosylphosphatidylinositol-anchored form of HYAL2 has been described (19). HYAL3 is broadly, although weakly, expressed; however, its ability to degrade HA is currently controversial (20,21).

A model for HA degradation has been proposed that suggests co-ordination between HYAL1 and HYAL2 activities (5). Within this model, the GPI-anchored form of HYAL2 initiates HA degradation extracellularly to generate 20 kDa fragments that enter the endosomal/lysosomal pathway. Degradation continues in the lysosome by the combined actions of HYAL1 and two exoglycosidases (22). This model has been supported by the identification of an interaction between CD44, a Na+/ H+ exchanger (NHE1), and HYAL2 that generates an acidic extracellular pH and cell surface HA degradation (20,23).

As only one patient has been reported to date, characterization of a model of Hyal1 deficiency is a first step in understanding the main phenotypic symptoms associated with MPS IX. A mouse model for MPS IX has become available and we have characterized and compared the phenotype of these mice with the human MPS IX disorder. In addition, the GAG content of tissues with high HA turnover or Hyal1 expression was examined in MPS IX mice to identify tissues where Hyal1 plays a key role in HA degradation. Hyal1 null mice had evidence of osteoarthritis with a loss of proteoglycans at early ages. This was accompanied by an accumulation of HA in the cartilage of Hyal1 null mice, but no evidence of non-skeletal tissue GAG accumulation or elevated serum HA concentrations was detected. Therefore, we sought to examine related catabolic pathways that may compensate in the murine model of MPS IX.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
Molecular characterization of Hyal1-targeted mice
Hyal1+/– mice generated and submitted by another investigator were purchased from the Mutant Mouse Regional Resource Center (MMRRC). Details regarding the construction and genotyping of these mice were not published or available from the MMRRC at the time of these studies. Therefore, to provide a full molecular characterization of the mutation, we examined the Hyal1 locus and the mutation [neomycin resistance (Neo)] incorporation site. DNA from the offspring of Hyal1+/– founder mice was examined by Southern analysis to verify the incorporation of a Neo cassette within the Hyal1 locus. Since the position of integration and the amount of coding region that was removed were unknown, we used a DNA probe to a region 3' of the Hyal1 gene and within a 9.7 kb fragment generated by BsrGI restriction enzyme digestion of genomic DNA. Three possible genotypes were identified by the banding patterns that corresponded to the wild-type (+) and Hyal1-targeted (–) alleles. The expected 9.7 kb band was detected in wild-type (+/+) mice (Fig. 1A, lane 1), whereas a 10.7 kb band indicative of an insertion in the Hyal1 locus was detected in targeted (–/–) mice (Fig. 1A, lane 3). As expected, heterozygous (+/–) mice contained both bands (Fig. 1A, lane 2).


Figure 1
View larger version (30K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. Molecular characterization of Hyal1 null mice. (A) The Hyal1 genomic region was analyzed for the incorporation of the Neo cassette by Southern blot of liver genomic DNA using a probe specific to the Hyal1 locus. The 9.7 kb wild-type and 10.7 kb targeted alleles are indicated by arrows. (B) A diagrammatic representation of the targeted neomycin resistance cassette (PGK, phosphoglycerate kinase promotor) in Hyal1. Blue boxes represent exons, whereas lines indicate introns and intergenic regions. An arrow indicates the orientation of the PGK–Neo cassette. (C) PCR-genotyping of mouse tail DNA was performed using either primers to the wild-type (upper panel) or targeted (lower panel) alleles. (D) Northern blot analysis of liver mRNA for Hyal1 (upper panel) and Gapdh (lower panel) expression in wild-type and null mice. Arrows indicate the two readily detectable Hyal1 transcripts. (E) Residual Hyal1 transcript expression in liver mRNA was determined by real-time PCR and displayed as a fold-change of expression levels (n = 3). The asterisk denotes statistically significant differences between groups determined using a pair-wise fixed reallocation randomization test. (F) Hyal1 protein was detected in liver lysates by immunoblot analysis using anti-Hyal1 (1D10 [PDB] ) antibody; the arrow indicates Hyal1. (G) Serum hyaluronidase activity of genotyped animals was investigated by HA zymography. Human serum was included as a positive control (S), and areas of clearing designate enzymatic activity.

 
Southern analysis confirmed the insertion of the Neo cassette in the Hyal1 gene; however, we sought to determine the Hyal1 insertion site. To accomplish this, we used polymerase chain reaction (PCR) to amplify the junctions between Hyal1 and the Neo cassette using forward and reverse primers within the Neo-coding region in combination with forward and reverse primers within exons 1 and 4 of Hyal1. Sequencing of the resulting PCR products (data not shown) revealed that the Neo cassette was incorporated into exon 2 of Hyal1 (Fig. 1B), replacing nucleotides 6487518–6488270 of GenBank NT_039477 [GenBank] .6. This replacement resulted in the deletion of nearly half of the coding region, 753 bp, and included a DWE amino acid sequence conserved between paralogous genes and required for function in bee venom hyaluronidase (24).

Once the integration site of Neo was identified, mice were genotyped by PCR-based assays specific to the wild-type and Neo-targeted alleles. A 340 bp region of exon 2 of Hyal1 that was deleted in the targeted allele was used to identify the wild-type (+/+) allele (Fig. 1C, lane 3), and a 270 bp segment of the Neo-coding region was amplified to detect the targeted (–/–) allele (Fig. 1C, lane 5). Therefore, a heterozygous (+/–) mouse showed PCR products corresponding to both the targeted and wild-type alleles (Fig.1C, lane 4).

To begin characterizing the functional effects of the Neo integration, Hyal1 RNA transcripts were analyzed by northern analysis of liver mRNA. A full-length Hyal1 cDNA probe detected the two most abundant Hyal1 transcripts described previously (Fig. 1D, lane 1) (25). No transcripts were detected in Hyal1–/– mice (Fig. 1D, lane 2). To detect lower abundance Hyal1 transcripts not identified by northern analysis, relative quantitation by real-time PCR was performed with primers that span the exon 1–exon 2 boundary. This real-time assay detected normal and variant Hyal1 transcripts that have been described previously (25). Hyal1 transcripts were found to vary between 1 and 2% of the normal expression in three separate animal sets (Fig. 1E). Real-time PCR analysis did not detect any transcripts (data not shown) using oligonucleotides that hybridized to the region of exon 2 removed by Neo targeting, indicating that the remaining transcripts were not wild-type.

To continue characterizing the functional effects of Neo integration, immunoblot analysis of Hyal1 in liver lysates was performed. A single 55 kDa protein band corresponding to mouse Hyal1 was found in +/+ mice (Fig. 1F, lane 1), but was not detected in –/– mice (Fig. 1F, lane 2). In addition, HA zymography of serum samples showed hyaluronidase activity in +/+ mice, but no detectable hyaluronidase activity in Hyal1–/– mice (Fig. 1G, lane 4). The absence of detectable activity was confirmed in liver homogenates from Hyal1–/– mice (data not shown). Therefore, our results show that Hyal1–/– animals do not have detectable Hyal1 wild-type RNA, protein or activity, demonstrating that the Neo integration results in a null allele.

Gross morphology and viability of Hyal1 null animals
Hyal1 null mice were observed up to 20 months for males (n = 5) and 1 year for females (n = 7). Hyal1 null mice were viable and looked normal until termination. Walking and movement of Hyal1 null mice also appeared normal. Both male and female null mice were fertile and although no statistical analyses were performed, litter sizes were as expected for the C57Bl/6J mouse strain (6–8 pups/litter). Heterozygous matings displayed the expected 1:2:1 Mendelian ratio of Hyal1 wild-type, heterozygous and null genotypes ({chi}2 = 0.909; P = 0.63; n = 110).

Upon post-mortem examination of animals sacrificed at 6, 9 and 12 months of age, visual inspection revealed no evident masses over the joints. X-ray analysis of female and male 12 month null mice (n = 3) displayed no evidence of skeletal defects in comparison with age-matched controls (data not shown). At the time of necropsy, mice were of similar size, tissue morphology appeared normal and organomegaly was not observed. Body and organ weights were measured for evidence of reduced stature and/or organomegaly. No statistically significant differences in body weights were detected at 6, 9 or 12 months (Fig. 2). Examination of organ weights at the oldest age of 12 months revealed no evidence of organomegaly (Fig. 3). The only tissue that was significantly smaller was the lungs of the male null mice, but to date no pathology has been identified in this tissue.


Figure 2
View larger version (11K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. Body weights of different aged Hyal1 null mice. Mean body weights from 6, 9 and 12 month Hyal1 wild-type and null mice were calculated and compared at each age in male (n = 6) and female (n = 6; except 6 month n = 5) mice. Comparisons were performed by analysis of variance for differences between genotypes. Mean body weights (g) ± standard error of the mean are plotted at each point. No statistically significant results were found at 6 (P = 0.11 in males; P = 0.50 in females), 9 (P = 0.55 in males; P = 0.13 in females) or 12 (P = 0.06 in males; P = 0.07 in females) months.

 


Figure 3
View larger version (17K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3. Organ weights of 12 month Hyal1 wild-type and null mice. The organ weights of age-matched male and female mice at 12 months (n = 6) were compared between genotypes by analysis of covariance (three-way analysis of variance), with body weight defined as the covariant. Mean organ weights (g) ± standard deviation are plotted, and the asterisk denotes statistical significance at P < 0.003.

 
Since gross MPS IX symptoms were not evident at time points up to 1 year, an additional age of 20 months was added by comparing heterozygous and null male mice. Again, no detectable differences in body weights (P = 0.28; n = 4) (data not shown) and/or organomegaly (Fig. 4) were identified at 20 months of age. The only gross abnormality observed was a spotting of the liver that progressed in severity with age and the number of animals that were affected. This was observed in all genotypes and was especially evident in the male gender. However, histological examination and determination of tissue GAG content (described in what follows) suggested this may be due to liver disease occurring in the C57Bl/6 strain.


Figure 4
View larger version (12K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4. Organ weights of 20 month Hyal1 heterozygous and null mice. The organ weights of age-matched 20 month male mice (n = 4) were compared between genotypes by analysis of covariance, with body weight defined as a covariant. Mean organ weights (g) ± standard deviation are plotted and no statistically significant differences were identified.

 
Joint structure analysis
The extensive joint involvement observed in human MPS IX prompted us to examine and compare the histological structure of the knee joints from wild-type and null animals. A decrease in Safranin O staining of the articular cartilage, due to a loss of proteoglycans, was evident in Hyal1 null mice of all ages (Fig. 5D–F) in comparison with the wild-type controls (Fig. 5A–C). This proteoglycan loss occurred as early as 3 months (Fig. 5D) and progressed in severity up to 20 months of age. In addition, at 20 months, an osteophyte is present on the tibial plateau (Fig. 5F). The loss of articular cartilage proteoglycan content was also seen by toluidine blue staining of knee joints from 3, 12 or 20-month-old mice (Supplementary Material, Fig. S1). This proteoglycan loss was most evident in the superficial zone of the articular cartilage. Loss of cartilage proteoglycan content and the development of bony outgrowths, such as an osteophyte, are indicators of osteoarthritis (26,27).


Figure 5
View larger version (100K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5. Safranin O-fast green-hematoxylin staining of articular cartilage in the knee joint of wild-type and Hyal1 null mice. The proteoglycan content of articular cartilage was visualized by Safranin O (red) in age-matched male mice of 3, 12 and 20 months. Hyal1 null mice display a decreased proteoglycan staining in the articular cartilage (DF) compared with age-matched wild-type mice (AC) at 3 (A and D), 12 (B and E) and 20 (C and F) months. At 20 months of age, osteophytes (arrow) were present in Hyal1 null mice (F).

 
To determine if the loss of proteoglycans in the articular cartilage was accompanied by HA storage, HA was localized in the articular cartilage of Hyal1 wild-type and null mice at 3 and 12 months of age. HA was found on the articular surface and in the pericellular coat of chondrocytes. However, in male and female Hyal1 null mice, a larger number of articular chondrocytes displayed intense pericellular staining (Fig. 6B and E). Although this was especially evident at 12 months (Fig. 6E), it was also identifiable in null mice at 3 months of age (Fig. 6B). In addition, at 12 months, cartilage surface staining appeared stronger in null mice (Fig. 6E) when compared with wild-type controls (Fig. 6D).


Figure 6
View larger version (113K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 6. HA localization in the cartilage of knee joints from wild-type and Hyal1 null mice at 3 and 12 months of age. In the articular cartilage of wild-type mice, HA (brown-black) was detected at the surface of articular cartilage and in the pericellular coat of chondrocytes (A and D). An increased number of intensely staining chondrocytes with pericellular HA were detected in the articular cartilage of male and female Hyal1 null mice at 3 months (A and B) and 12 months (D and E) of age. In the epiphyseal cartilage, HA was detected in the pericellular coat of chondrocytes and intracellularly in both wild-type and Hyal1 null mice (G, H, J and K). The number of epiphyseal chondrocytes that display intense intracellular or pericellular HA staining was increased in Hyal1 null mice (H and K) in comparison with age-matched wild-type mice (G and J). No pericellular or intracellular HA staining was detected in the Streptomyces hyaluronidase-treated control of articular cartilage (C and F) or epiphyseal cartilage (I and L) at 3 or 12 months.

 
The epiphyseal chondrocytes of wild-type mice at 3 (Fig. 6G) and 12 (Fig. 6J) months of age contained HA in the territorial matrix and to a smaller extent in the interterritorial matrix of the growth plate. Hyal1 null mice displayed an increased number of chondrocytes with intense pericellular or cytoplasmic HA staining (Fig. 6H and K) in comparison with age-matched wild-type controls (Fig. 6G and J). The intensity of the cytoplasmic HA staining appeared to progress with age, since this was readily evident in null mice at 12 months (Fig. 6K and J). No staining was observed in the epiphyseal or articular cartilage of control sections treated with Streptomyces hyaluronidase prior to HA staining (Fig. 6C, F, I, and L).

Characterization of GAG levels
The MPS IX patient displayed serum HA concentrations elevated 38–90-fold depending on the time of sampling. Therefore, serum HA concentrations were followed to determine the earliest age that non-skeletal tissue GAG storage may be seen in null mice. Serum HA concentrations did not differ between ages (P = 0.44, n = 35), however they did significantly differ between sexes (P = 0.0001, n = 35). Males displayed a lower circulating HA concentration with a mean of 408 ng/ml, whereas females had a mean of 668 ng/ml. No significant differences in the serum HA concentrations between wild-type and null mice were found in male or female mice at any age examined (P = 0.57) (Fig. 7). In addition, the serum HA levels of male heterozygous (499 ng/ml) and null mice (343 ng/ml) did not differ significantly at the oldest time point of 20 months (P = 0.30, n = 4) (data not shown). Serum HA concentrations in general displayed large variations and ranged between 88 and 1136 ng/ml.


Figure 7
View larger version (31K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 7. Serum HA levels of different aged Hyal1 null mice. The HA concentration of serum from wild-type and null 6, 9 and 12 month mice (n = 6; except 6 month females n = 5) was determined by sandwich ELISA using a hyaluronic acid-binding protein. OD measurements were translated to serum concentrations by estimation from a standard curve using a four-parameter linear regression. The mean serum HA concentration (ng/ml) ± standard error mean are plotted on a bar graph.

 
The GAG content of tissues with high HA turnover or Hyal1 expression was examined in 12 month wild-type and null mice to identify tissues where Hyal1 had a significant contribution to constitutive HA turnover. The tissue GAG content of mice ranged from 5.2 to 161.0 µg uronic acid/g in the six tissues tested. Significant differences in tissue GAG content were observed between male and female sexes. This was especially evident in the lung, where the mean in the male mice was 27.8 µg uronic acid/g, whereas the mean in the female mice was ~4-fold higher at 111.0 µg uronic acid/g (Fig. 8). The total tissue GAG content of wild-type and null mice did not significantly differ in the brain, liver, lungs, kidney, heart and spleen (Fig. 8). Since we were unable to determine skin HA content by the uronic acid assay and HA storage was identified in the fibroblasts and macrophages of skin biopsies from the MPS IX patient, the HA content of skin from 3 month female mice (n = 2) was examined by fluorescence-assisted carbohydrate electophoresis. No significant difference in the mean HA content of skin from Hyal1 wild-type (347.8 µg/g) and null (485.2 µg/g) mice was detected (P = 0.58). To ensure HA accumulation in the skin did not occur with age, we examined the HA content of skin from 12 month male and female mice (n = 3) by HABP staining. No identifiable differences in the distribution or intensity of HA staining were detected between Hyal1 wild-type and null mice (Supplementary Material, Fig. S2). However, to further investigate tissues for GAG accumulation, the overall architecture and cellular appearance of tissues from Hyal1 null mice was reviewed by light and electron microscopy.


Figure 8
View larger version (19K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 8. GAG content of high Hyal1 expressing or HA turnover tissues. Uronic acid (UA) content was quantitated using the uronic acid assay and normalized to the total tissue weight in male and female 12 month mice (n = 3) to get the tissue GAG content. The mean GAG content (µg UA/g) ± standard deviation is plotted in bar graphs.

 
Histological examination for GAG accumulation
Histological examination of all major tissues was performed by light microscopy observing overall tissue architecture, connective tissue thickness and evidence of intracellular vacuolation. However, no major abnormalities in Hyal1 null mice were found in either sex. A more intensive review of high expression and high turnover tissues was performed secondarily by a pathologist, but again no major abnormalities were identified. EM analysis of tissues with high Hyal1 expression or turnover was performed on one set of animals of each gender. No vacuolation was evident in the macrophages or fibroblasts of the skin. In addition, the major cell types of the skin, intestinal lymph node, liver, kidney or lung tissues appeared normal. Liver samples from older animals were difficult to interpret, as both wild-type and null animals displayed intracellular vacuolation that occasionally correlated with the infiltration of inflammatory cells. This pathological phenotype is similar to steatohepatitis. Furthermore, GAG analysis in liver tissues detected no significant increase (Fig. 8), indicating that liver vacuolation was not due to GAG storage.

Examining related catabolic pathways
Despite the complete absence of detectable Hyal1 activity, Hyal1 null mice displayed no HA storage outside of the skeletal system. Therefore, to begin examining potential hyaluronidase redundancies in constitutive HA degradation, two hyaluronidase genes, Hyal2 and Hyal3, were chosen as candidates for gene expression analysis because of their similarity in expression profiles to Hyal1. The relative expression levels were compared between wild-type and null mice in the liver, a tissue that displays high expression of Hyal1, Hyal2 and Hyal3 (Fig. 9). Despite no increase in the relative levels of the Hyal2 transcript, Hyal3 transcripts were consistently elevated in male age-matched animal sets (n = 3). The fold increase ranged from 4.3 to 7.4, and the difference between expression means of wild-type and null mice was statistically significant (P = 0.001). This was also evident in RNA from testes of wild-type and null mice, where a 2.6-fold elevation was detected in null mice despite no increase in Hyal2, Hyal4, Hyal5, Spam1 or HyalP1 (n = 2; data not shown).


Figure 9
View larger version (17K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 9. Effect of the null mutation on gene expression of Hyal2, Hyal3 and HexB. The mRNA levels of broadly expressed Hyal2, Hyal3, and HexB, an exoglycosidase gene, were quantitated in the liver of 3 or 6 month wild-type and null male mice (n = 3). Expression is displayed as the mean fold-change of null mice compared with the wild-type expression levels. The asterisk denotes statistically significant differences between groups determined using a pair-wise fixed reallocation randomization test.

 
The exoglycosidase enzymes, β-hexosaminidase and β-glucuronidase, remove terminal saccharide units from hyaluronidase-produced HA fragments and therefore may compensate in HA degradation in a Hyal1 deficiency. To examine this possibility, expression analysis of the HexB gene, which encodes the β-subunit of the two major β-hexosaminidase isoenzymes, was performed in wild-type and null mice. The relative expression level of HexB in the liver (n = 3; Fig. 9) and testes (n = 2; data not shown) did not significantly differ in any of the male mice pairs (n = 3; Fig. 9). We also examined the total β-hexosaminidase activity in the livers from wild-type and null mice at 12 months, and no statistically significant difference was found (n = 4; data not shown).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
We have characterized a novel mouse model of MPS IX and compared the mouse and human phenotypes of disease. This model is completely deficient in Hyal1 owing to a deletion of nearly half of the Hyal1-coding region. Overall, the phenotype of the murine model of MPS IX is similar to that seen in the human disease. Typical of osteoarthritic changes, Hyal1 null mice display bony outgrowths at older ages and a premature loss of the articular cartilage proteoglycans that increases in severity with age. The development of progressive degenerative joint disease was also observed in the MPS IX patient as indicated by bi-lateral hip surgeries at age 18 and unilateral hip replacement at 25 years (M. Natowicz, personal communication). In contrast to a human HYAL1 deficiency, Hyal1 null mice display no joint masses, symptomatic evidence of joint involvement, serum HA elevations or evidence of non-skeletal tissue HA storage. Therefore, the joint involvement that results in disabling symptoms in human MPS IX appears to be the most prominent feature in both human and murine MPS IX.

Our Hyal1-deficient model is one of seven murine MPS diseases described to date (28). As is true for other murine models of lysosomal storage disorders, including Fabry disease, Tay-Sachs disease, MPS IIIB, MPS IV and others, this model is milder and does not completely recapitulate the entire human MPS IX phenotype (2932). However, only one MPS IX patient has been reported to date and it is therefore likely that the full range of clinical symptoms remains to be determined. The premature and degenerative joint disease seen in both human and mouse MPS IX may be used as a key pathological feature in identifying additional patients.

MPS IX mice display no apparent symptomatic evidence of joint involvement and are less severely affected than murine models of MPS I, MPS II, MPS VI and MPS VII which have significantly impaired joint function (3336). These MPS models have a range of pathological features including a thickened joint capsule, synovial fibroblast proliferation, disorganization of the growth plate, ballooning of chondrocytes and/or synoviocytes and proteoglycan loss (3438). Although most of these features are not reproducibly seen in the Hyal1 null mice, proteoglycan loss is observed consistently in murine MPS IX. In the rat and cat MPS VI models, the accumulation of dermatan sulfate causes a loss of proteoglycan and collagen content owing to an increased rate of chondrocyte apoptosis (38). Chondrocyte cultures from these animal models show an increased ability to secrete nitric oxide and tumor necrosis factor-{alpha} (38). The accumulation of HA within the articular cartilage of MPS IX mice at both 3 and 12 months suggests that the pericellular accumulation either causes a disruption in the ECM organization or may potentially increase the secretion of inflammatory cytokines similarly to MPS VI models. Further studies will be necessary to determine the effects of HA accumulation in the articular cartilage of MPS IX mice.

A mild alteration in the matrix components within the epiphyseal plate, similar to that seen in the articular cartilage, may also occur in MPS IX mice as a result of the increased number of chondrocytes that display intense pericellular and/or cytoplasmic HA staining. MPS I, VI and VII models that display more severe skeletal phenotypes exhibit a thickened growth plate with an increased number of chondrocytes and/or a persisting epiphyseal plate (3537). However, evidence for short stature is not clearly identified in our investigations of MPS IX mice. The absence of thickened digits and broadened long bone structures by X-ray analysis also indicates that any effect due to HA accumulation in the growth plate of MPS IX mice is minimal. However, a complete characterization of the structure and closing of the epiphyseal plate in MPS IX mice may reveal subtle defects that could be useful in studying the early pathogenic events of MPS disorders.

Given the high turnover rate of HA in the joint, it is not surprising that the joint is the principal site of HA accumulation in the absence of Hyal1. HA concentrations in human articular cartilage range from 0.5–2.5 µg/mg of tissue wet weight, and the synovial fluid contains one of the highest HA concentrations found in the body (1400–3600 µg/g) (7,39). In the rabbit, synovial fluid HA has been estimated to have a half-life of 0.5–1 day, and the majority of degradation occurs locally in the cartilage and synovium (11,40,41). Human and mouse articular chondrocytes express the three most broadly distributed hyaluronidases, HYAL1/Hyal1, HYAL2/Hyal2 and HYAL3/Hyal3 (4245). Yet, only Hyal1 appears to be essential to HA turnover in the joint to date, as Hyal3-deficient mice do not display premature articular cartilage loss (Triggs-Raine et al., unpublished data). It will be interesting to examine Hyal2-deficient mice to determine the contribution of Hyal2 to joint turnover of HA.

Increases in tissue GAG content correlate with storage in mouse models of MPS IIIA and MPS IIIB, yet we found no evidence of non-skeletal GAG accumulation in MPS IX mice (32,46). The cellular HA storage in human MPS IX, identifiable as vacuolation using light and electron microscopy, is not detected in murine MPS IX. Furthermore, no detectable differences in the HA content of skin from MPS IX mice was identified. Overall, this suggests that mice may differ in the production and/or turnover of HA. If such differences exist, this would explain the higher circulating serum HA concentrations in mice (88–1136 ng/ml) than in humans (25–75 ng/ml). Species-specific differences in GAG distribution and synthesis have been described previously in the mouse, therefore it is conceivable that species-specific differences in HA turnover may also exist (47).

Although the murine MPS IX model has a milder phenotype than its human counterpart, human MPS IX displays a relatively mild phenotype in comparison with other MPS disorders given the abundance and distribution of HA (4). This suggests that the hyaluronidase gene family may contain several genes with redundant functions. Yet despite investigating all the known hyaluronidases and an exoglycosidase in the liver and testes, only an increased expression of Hyal3 is detected in Hyal1 null mice. The extent of the elevation is tissue specific such that the liver displays a much larger relative increase (5-fold) than the testes (2.5-fold). This increase is intriguing given the controversy regarding the activity of Hyal3 in the literature. Although originally reported to have acidic activity (21), recent studies have not detected activity in vitro (20,48). However, in vitro studies of activity can be problematic and may not accurately reflect enzymatic activity in vivo. In addition, the expression of Hyal3 in the mouse is broader than in humans and may explain the milder phenotype associated with murine MPS IX as well (25). Our data suggest that Hyal3 is the main gene that compensates in a murine Hyal1 deficiency and may also compensate in human MPS IX. Thus, examining the hyaluronidase expression in human MPS IX cells and characterizing the phenotype of mice deficient in Hyal1 and Hyal3 will be important to determine the redundancy between these genes.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
Experimental animals
Hyal1+/–B6.129X1–Hyal1tm1Stn/Mmcd mice (N7) were purchased from the MMRRC (MMRRC: 000086-UCD, Davis, CA, USA) and mated to establish a colony. All procedures were approved by the University of Manitoba Animal Protocol Management and Review Committee, in accordance with the Canadian Council on Animal Care guidelines for the care and use of animals.

Southern blotting and PCR genotyping
Genomic DNA was isolated from mouse liver using standard methods (49), and 9 µg of DNA was restriction-enzyme-digested with BsrGI, separated by agarose gel electrophoresis, transferred and immobilized to an Immobilon Ny+ nylon membrane (Millipore, Billerica, MA, USA) according to the recommended protocol. The blot was hybridized overnight with a 330 bp DNA fragment encompassing nucleotides 6492719–6493057 (GenBank NT_039477 [GenBank] .6) in Expresshyb (Clontech Laboratories, Mountain View, CA, USA). The probe was labeled with {alpha}32P-dCTP by random primer extension using a Rediprime II kit (GE Healthcare, Baie d’Urfe, QC, Canada) and separated from free nucleotides using a ProbeQuant G-50 Micro column (GE Healthcare). The hybridized blot was exposed to Kodak Biomax MS autoradiographic film at –80°C.

Genomic DNA for PCR-based genotyping was isolated from 2 mm biopsies of mouse tails as described previously (50). Wild-type and Neo-targeted alleles were detected using two separate PCR assays and products were resolved by agarose gel electrophoresis. For the detection of the wild-type allele, PCR amplification of a 340 bp fragment of Hyal1 exon 2 was performed using forward (WPG 612: 5'-ctgggacagcaaggacattt-3') and reverse (WPG 613: 5'-cagtgctgcaggcaaataaa-3') primers with 35 PCR cycles of 94°C for 1 min, 50°C for 1 min and 72°C for 1 min. For the detection of the Neo-targeted allele, 270 bp of the Neo-coding region was amplified using forward (WPG 610: 5'-cttgggtggagagaggctattc-3') and reverse (WPG 611: 5'-aggtgagatgacaggagatc-3') primers with 35 PCR cycles of 94°C for 1 min, 58°C for 1 min and 72°C for 1 min.

DNA sequencing
The 5' and 3' junctions between the Hyal1 gene and the Neo cassette were PCR-amplified and sequenced. The 5' junction was PCR-amplified using a forward primer (WPG 379: 5'-cgccagcttctaagctg-3') in exon 1 of Hyal1 and a reverse primer (WPG 617: 5'-atcgccttctatcgcctt-3') in the Neo cassette. PCR-cycling conditions of 94°C for 1 min, 55°C for 1 min and 72°C for 2.5 min maintained for 35 cycles were used for the amplification. The 3' junction was PCR-amplified using a forward primer (WPG 618: 5'-gtcatagccgaatagcctct-3') in the Neo cassette and a reverse primer (WPG 198: 5'-agctgcactggtcacgttctc-3') situated in exon 4 of Hyal1. Amplification was for 35 PCR cycles of 94°C for 1 min, 60°C for 1 min and 72°C for 2.5 min followed by a final extension at 72°C for 10 min. PCR products were TA-cloned into the pCR 4.0 TOPO vector following the manufacturer’s instructions (Invitrogen Inc., Carlsbad, CA, USA) and sequenced using T7, T3 and sequence-specific primers (WPG 191: 5' aagtggactcagcggttggac; WPG 228: 5' tttaagtaggggtcaaaa).

RNA isolation and northern blotting
Livers were collected, flash-frozen in liquid nitrogen and stored at –80°C until use. Total RNA was extracted from crushed liver samples using acid–phenol extraction (49). RNA pellets were resuspended in RNase free water, and mRNA isolation was performed using the Oligotex mRNA suspension mix according to the manufacturer’s protocol (Qiagen Inc., Mississauga, ON, Canada). The quantity and purity of mRNA were assessed using the A260/280 optical density ratio and diluted in 4x glyoxyl loading dye (Ambion Inc., Austin, TX, USA) according to the manufacturer’s protocol. Samples (3 µg) were separated by gel electrophoresis, transferred to a Brightstar®-Plus nylon membrane (Ambion Inc.) and UV-cross-linked according to the manufacturer’s instructions. A Hyal1 mouse EST clone (NIA H4011E09) was digested with KpnI/XhoI to generate a 1162 bp Hyal1 probe, and a Gapdh mouse EST clone (IMAGE: 3044486) was digested with AflIII/ SfiI to generate an 857 bp Gapdh probe. Probes were labeled as described earlier, however free nucleotides were removed using a Nick Column (GE Healthcare). RNA blots were hybridized overnight at 68°C in ExpressHyb (Clontech Laboratories) with a Hyal1 or Gapdh-specific probe and washed to remove non-specific binding before exposure to Kodak Biomax MS film at –80°C with intensifying screens.

Real-time PCR
cDNA was produced using random primer extension with Superscript III reverse transcriptase (Invitrogen). TaqMan gene expression assays (Applied Biosystems, Foster, CA, USA) for Hyal1 (Mm00476206_m1), Hyal2 (Mm00477731_m1), Hyal3 (Mm00662097_m1), Hyal4 (Mm01165340_m1), Hyal5 (Mm01165333_m1), Spam1 (Mm00486329_m1), HexB (Mm00599880_m1) or a HyalP1 custom assay [primers: forward (gggaacccttctgtgttttggaaa), reverse (cccactggataaacatggattgct); probe (cctttgagcacacttcc)] were performed in triplicate using 10, 25 or 50 ng of liver or testes cDNA. A Gapdh TaqMan gene expression assay (4352339E; Applied Biosystems) was included in experiments to normalize for cDNA loading. All assays were performed using an Applied Biosystems 7300 real-time PCR system under standard cycling conditions [initial denaturing steps: 50.0°C for 2 min; 95.0°C for 10 min; cycling conditions (40x): 95°C for 15 s; 60.0°C for 1 min]. Relative transcript levels were determined using the comparative Ct method with the +/+ liver mRNA sample as the calibrator (51).

Immunoblotting
Liver protein extracts were prepared by homogenization and sonication in 10 mM imidazole, 0.25 M sucrose buffer with protease inhibitors in excess. Cell debris was removed by centrifugation at 17 500g for 10 min at 4°C. The protein concentration in the supernatant was determined using a Bradford assay (Bio-Rad Protein Assay, Hercules, CA, USA). Extracts containing 30 µg of protein were prepared in Laemmli sample buffer, separated on a 10% SDS–PAGE gel and transferred to a nitrocellulose membrane as described previously (52). An anti-Hyal1 monoclonal antibody (1D10) was used for immunoblotting as described previously (25) except using an overnight incubation in primary antibody at 4°C and a species-specific Trueblot ULTRA HRP-conjugated secondary antibody (eBioscience, San Diego, CA, USA). Signals were detected using the Western Lightning Chemiluminescent reagent (Perkin Elmer, Boston, MA, USA).

Serum preparation, ELISA and zymography
Blood was collected by cardiac puncture and allowed to clot at room temperature. Serum was collected by centrifugation at 800g for 15 min at room temperature and stored at –80°C until use. Serum HA levels were quantitated by assaying 5 µl of serum, in duplicate, on an ELISA hyaluronic acid test plate (Corgenix Inc., Broomfield, CO, USA) according to the manufacturer’s protocol. Serum HA concentrations were estimated from an HA standard curve.

HA substrate zymography was performed as described previously (53) with a few modifications. Briefly, either 1 µl of human serum or 5 µl of mouse serum was separated on a 7% polyacrylamide gel containing 0.18 mg/ml umbilical cord HA (Sigma-Aldrich, Oakville, ON, Canada) using 20 mA constant current at 4°C. To remove interfering protein bands, the gel was incubated in 0.2 mg/ml protease in 20 mM Tris (pH 8.0) at 37°C for 3 h after hyaluronidase digestion.

Histological analysis
Upon dissection of animals, tissues were collected and fixed in 4% paraformaldehyde overnight at 4°C. Skin samples were collected and fixed for 2 days at room temperature in 4% paraformaldehyde containing 0.5% hexadecylpyridinium chloride monohydrate (CPC). Tissues were then washed with phosphate-buffered saline (PBS), pH 7.4, and stored in 70% ethanol until processing. For processing, tissues were dehydrated using ethanol and xylene, embedded in paraffin, and sections of 6 µm in thickness were prepared. Sections were stained using established protocols (54) with the following modifications, incubation in Mayer’s hematoxylin was for 5 min, and counterstaining in eosin Y was for 1 min.

Joint proteoglycan analysis
After sacrifice, mice hind knee joints were removed and fixed in periodate lysine paraformaldehyde fixative (0.1 M phosphate buffer, 4% paraformaldehyde, 0.2% sodium metaperiodate, 1.2% lysine, pH 7.4) for 1 h at room temperature, then at 4°C overnight. Joints were washed with PBS and stored in 70% ethanol until decalcification in formic acid at 4°C. Joints were paraffin-embedded and serial sections (5 µm thickness) were stained with 0.1% Safranin O, 0.2% Fast Green and Gill’s hematoxylin. Some sections were also stained with 0.1% toluidine blue and 1% sodium chloride at pH 2.3.

HA staining
HA staining of the joints was performed as described previously (55) with a few modifications. Briefly, sections were treated with 0.25% trypsin–EDTA for 15 min at 37°C, quenched for endogenous peroxidases in 3% hydrogen peroxide in PBS (pH 7.4), blocked in 10% fetal calf serum in 0.01% Tween-20 in Tris-buffered saline (pH 7.4), blocked for endogenous biotin using an Avidin-Biotin blocking kit (Vector Laboratories, Burlingame, CA, USA), incubated overnight in biotinylated HABP (3.3 µg/ml) prepared in Tris-buffered saline (pH 7.4) containing 10% fetal calf serum in 0.01% Tween-20 (Associates of Cape Cod Inc., East Falmouth, MA, USA) and stained with 0.1% Nuclear Fast Red. Control sections were incubated overnight in 50 U/ml of hyaluronate lyase from Streptomyces hyalurolyticus (Sigma-Aldrich). For skin HA staining, trypsin treatment and biotin blocking were not performed. Instead, upon rehydration, slides were incubated for 3 h in 1.3 M potassium chloride to compete for CPC binding prior to proceeding with the HABP staining.

Electron microscopic analysis
Tissues were collected post-dissection and fixed in 2% glutaraldehyde, 2% paraformaldehyde (10 mM calcium chloride, 100 mM sodium cacodylate, 0.15% Ruthenium Red, pH 7.2) at 4°C until processing within 1 week. Tissues were washed in 10 mM calcium chloride, 100 mM sodium cacodylate, 0.7% sucrose (pH 7.2) and post-fixed in 1% osmium tetroxide, 0.8% potassium ferricyanide for 1 h. Tissues were washed in water, stained overnight in non-buffered 2% uranyl acetate, dehydrated in acetone and embedded in Epon. Slow hardening of the Epon mixture was accomplished through 1 day incubations at room temperature, 45°C and 60°C.

GAG analysis
At necroscopy, tissues were removed, weighed, flash-frozen in liquid nitrogen and stored at –80°C. Tissues were crushed and lyophilized in a ThermoSavant Supermodulyo Freeze Dryer. After lyophilization, GAGs were extracted into 6 M urea, 0.05 M sodium acetate, 0.1 M disodium ethylenediamine tetraacetate, 0.1 M aminocaproic acid (pH 6.5) for 2 days at 4°C. After centrifugation, extracts were applied to a Q-Sepharose column equilibrated with 50 mM sodium acetate, 10 M formamide (pH 6.0), and GAGs were eluted with the same buffer containing 4 M sodium chloride. Fractions were assayed for uronic acid according to a previous protocol (56) and normalized to tissue wet weight.

For skin GAG quantitation, dorsal and knee skin was collected from each animal for fluorescence-assisted carbohydrate electrophoresis. The purification of GAGs, 2-aminoacridone labeling and quantitation using known disaccharide standards were performed as described previously (57). Labeled disaccharides were run according to previous procedures (58), except the stacking gel contained 0.36 M Tris–HCl (pH 6.8).

Hexosaminidase assays
Tissue extracts were prepared in PBS containing 0.1% Triton X-100 and protease inhibitors in excess. Protein concentrations were determined as described earlier and β-hexosaminidase activity was assayed using 4-methylumbelliferyl-N-acetyl-β-D-glucosaminide as described previously (59), except that extracts were diluted with phosphate–citrate buffer containing 0.6% bovine serum albumin.

Statistical analysis
The genotype distribution was compared with expected Mendelian ratios by {chi}2 analysis using the online GraphPad QuickCalcs (San Diego, CA, USA). Real-time PCR results were tested for significance using the Relative Expression Software Tool-384 (REST-384©) that uses a pair-wise fixed reallocation randomization test (60). All additional statistical analyses were performed using NCSS software (Kayville, UT, USA). Body weights and skin GAG content were compared by one-way analysis of variance, whereas serum HA concentrations and organ GAG content were compared by multiple analysis of variance (two or three-way analysis of variance). Organ weights of 1 year mice were compared between sex and genotype by analysis of covariance (three-way analysis of variance), with body weight defined as a covariant. Organ weights of 20 month animals were compared by analysis of covariance, with body weight defined as the covariant. For all statistical tests, significance was established when the level of probability was less than 0.05 (P < 0.05).


    SUPPLEMENTARY MATERIAL
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
Supplementary Material is available at HMG Online.


    FUNDING
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
This work is funded by the Canadian Institutes for Health Research to B.L.T-R. (FRN 15463), National Health and Medical Research Council of Australia to S.B. and Shriners of North America to J.S.M. D.C.M. was supported by a Manitoba Health Research Council studentship, V.A. was supported by a Canadian Institutes for Health Research Strategic Training Program studentship and J.F. was supported by a Canadian Institutes of Health Research Fellowship.


    ACKNOWLEDGEMENTS
 
The authors would like to thank Ms Xioali Wu, Dr Hao Ding, Dr Anna Plaas and Mr Wan Chin Liaw for their technical assistance and Dr Marvin Natowicz for critical review of this manuscript. This research was conducted using facilities of the Manitoba Institute of Child Health in the John Buhler Research Centre.

Conflict of Interest statement. None declared.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 

  1. Neufeld E.F., Muenzer J. The Metabolic and Molecular Mechanisms of Inherited Disease—Scriver C., Beaudet A., Sly W., Valle D., eds. (2001) New York: McGraw-Hill. 3421–3452.

  2. Wraith J.E. The mucopolysaccharidoses: a clinical review and guide to management. Arch. Dis. Child (1995) 72:263–267.[Free Full Text]

  3. Natowicz M.R., Short M.P., Wang Y., Dickersin G.R., Gebhardt M.C., Rosenthal D.I., Sims K.B., Rosenberg A.E. Clinical and biochemical manifestations of hyaluronidase deficiency. N. Engl. J. Med (1996) 335:1029–1033.[Free Full Text]

  4. Triggs-Raine B., Salo T., Zhang H., Wicklow B.A., Natowicz M. Mutations in HYAL1, a member of a tandemly distributed multigene family encoding disparate hyaluronidase activities, cause a newly described lysosomal disorder, mucopolysaccharidosis IX. PNAS (1999) 96:6296–6300.[Abstract/Free Full Text]

  5. Csoka A.B., Frost G.I., Stern R. The six hyaluronidase-like genes in the human and mouse genomes. Matrix Biol (2001) 20:499–508.[CrossRef][Web of Science][Medline]

  6. Kim E., Baba D., Kimura M., Yamashita M., Kashiwabara S., Baba T. Identification of a hyaluronidase, Hyal5, involved in penetration of mouse sperm through cumulus mass. Proc. Natl Acad. Sci. USA (2005) 102:18028–18033.[Abstract/Free Full Text]

  7. Fraser J.R.E., Laurent T.C., Laurent U.B.G. Hyaluronan: its nature, distribution, functions and turnover. J. Int. Med (1997) 242:27–33.[CrossRef][Web of Science][Medline]

  8. Fraser J.R.E., Laurent T.C. Turnover and metabolism of hyaluronan. Ciba Found. Symp (1989) 143:41–59.[Medline]

  9. Fraser J.R., Kimpton W.G., Laurent T.C., Cahill R.N., Vakakis N. Uptake and degradation of hyaluronan in lymphatic tissue. Biochem. J (1988) 256:153–158.[Web of Science][Medline]

  10. Laurent U.B., Dahl L.B., Reed R.K. Catabolism of hyaluronan in rabbit skin takes place locally, in lymph nodes and liver. Exp. Physiol (1991) 76:695–703.[Abstract]

  11. Laurent U.B., Fraser J.R., Engstrom-Laurent A., Reed R.K., Dahl L.B., Laurent T.C. Catabolism of hyaluronan in the knee joint of the rabbit. Matrix (1992) 12:130–136.[Web of Science][Medline]

  12. Fraser J.R., Appelgren L.E., Laurent T.C. Tissue uptake of circulating hyaluronic acid. A whole body autoradiographic study. Cell Tissue Res (1983) 233:285–293.[Web of Science][Medline]

  13. Laurent T.C., Fraser J.R. Hyaluronan. FASEB J (1992) 6:2397–2404.[Abstract]

  14. Zhou B., Weigel J.A., Fauss L., Weigel P.H. Identification of the hyaluronan receptor for endocytosis (HARE). J. Biol. Chem (2000) 275:37733–37741.[Abstract/Free Full Text]

  15. Culty M., Nguyen H.A., Underhill C.B. The hyaluronan receptor (CD44) participates in the uptake and degradation of hyaluronan. J. Cell Biol (1992) 116:1055–1062.[Abstract/Free Full Text]

  16. Csoka A., Scherer S.E., Stern R. Expression analysis of six paralogous human hyaluronidase genes clustered on chromosomes 3p21 and 7q31. Genomics (1999) 60:356–361.[CrossRef][Web of Science][Medline]

  17. Frost G.I., Csoka T.B., Wong T., Stern R. Purification, cloning, and expression of human plasma hyaluronidase. Biochem. Biophys. Res. Commun (1997) 236:10–15.[CrossRef][Web of Science][Medline]

  18. Lepperdinger G., Strobl B., Kreil G. HYAL2, a human gene expressed in many cells, encodes a lysosomal hyaluronidase with a novel type of specificity. J. Biol. Chem (1998) 273:22466–22470.[Abstract/Free Full Text]

  19. Rai S.K., Duh F.M., Vigdorovich V., Danilkovitch-Miagkova A., Lerman M.I., Miller A.D. Candidate tumor suppressor HYAL2 is a glycosylphosphatidylinositol (GPI)-anchored cell-surface receptor for jaagsiekte sheep retrovirus, the envelope protein of which mediates oncogenic transformation. Proc. Natl Acad. Sci. USA (2001) 98:4443–4448.[Abstract/Free Full Text]

  20. Harada H., Takahashi M. CD44-dependent intracellular and extracellular catabolism of hyaluronic acid by hyaluronidase-1 and -2. J. Biol. Chem (2007) 282:5597–5607.[Abstract/Free Full Text]

  21. Lokeshwar V.B., Schroeder G.L., Carey R.I., Soloway M.S., Iida N. Regulation of hyaluronidase activity by alternative mRNA splicing. J. Biol. Chem (2002) 277:33654–33663.[Abstract/Free Full Text]

  22. Roden L., Campbell P., Fraser J.R.E., Laurent T.C., Pertoft H., Thompson J.N. Enzymic pathways of hyaluronan catabolism. Ciba Found. Symp (1989) 143:60–86.[Medline]

  23. Bourguignon L.Y., Singleton P.A., Diedrich F., Stern R., Gilad E. CD44 interaction with Na+–H+ exchanger (NHE1) creates acidic microenvironments leading to hyaluronidase-2 and cathepsin B activation and breast tumor cell invasion. J. Biol. Chem (2004) 279:26991–27007.[Abstract/Free Full Text]

  24. Markovic-Housley Z., Miglierini G., Soldatova L., Rizkallah P.J., Muller U., Schirmer T. Crystal structure of hyaluronidase, a major allergen of bee venom. Structure (2000) 8:1025–1035.[Medline]

  25. Shuttleworth T.L., Wilson M.D., Wicklow B.A., Wilkins J.A., Triggs-Raine B.L. Characterization of the murine hyaluronidase gene region reveals complex organization and cotranscription of Hyal1 with downstream genes, Fus2 and Hyal3. J. Biol. Chem (2002) 277:23008–23018.[Abstract/Free Full Text]

  26. Dieppe P.A., Lohmander L.S. Pathogenesis and management of pain in osteoarthritis. Lancet (2005) 365:965–973.[CrossRef][Web of Science][Medline]

  27. Aigner T., McKenna L. Molecular pathology and pathobiology of osteoarthritic cartilage. Cell Mol. Life Sci (2002) 59:5–18.[CrossRef][Web of Science][Medline]

  28. Haskins M.E. Animal models for mucopolysaccharidosis disorders and their clinical relevance. Acta Paediatr. Suppl (2007) 96:56–62.[Medline]

  29. Tomatsu S., Orii K.O., Vogler C., Nakayama J., Levy B., Grubb J.H., Gutierrez M.A., Shim S., Yamaguchi S., Nishioka T., et al. Mouse model of N-acetylgalactosamine-6-sulfate sulfatase deficiency (Galns–/–) produced by targeted disruption of the gene defective in Morquio A disease. Hum. Mol. Genet (2003) 12:3349–3358.[Abstract/Free Full Text]

  30. Ohshima T., Murray G.J., Swaim W.D., Longenecker G., Quirk J.M., Cardarelli C.O., Sugimoto Y., Pastan I., Gottesman M.M., Brady R.O., Kulkarni A.B. Alpha-galactosidase A deficient mice: a model of Fabry disease. Proc. Natl Acad. Sci. USA (1997) 94:2540–2544.[Abstract/Free Full Text]

  31. Phaneuf D., Wakamatsu N., Huang J.Q., Borowski A., Peterson A.C., Fortunato S.R., Ritter G., Igdoura S.A., Morales C.R., Benoit G., et al. Dramatically different phenotypes in mouse models of human Tay-Sachs and Sandhoff diseases. Hum. Mol. Genet (1996) 5:1–14.[Abstract/Free Full Text]

  32. Li H.H., Yu W.H., Rozengurt N., Zhao H.Z., Lyons K.M., Anagnostaras S., Fanselow M.S., Suzuki K., Vanier M.T., Neufeld E.F. Mouse model of Sanfilippo syndrome type B produced by targeted disruption of the gene encoding alpha-N-acetylglucosaminidase. Proc. Natl Acad. Sci. USA (1999) 96:14505–14510.[Abstract/Free Full Text]

  33. Clarke L.A., Russell C.S., Pownall S., Warrington C.L., Borowski A., Dimmick J.E., Toone J., Jirik F.R. Murine mucopolysaccharidosis type I: targeted disruption of the murine alpha-L-iduronidase gene. Hum. Mol. Genet (1997) 6:503–511.[Abstract/Free Full Text]

  34. Garcia A.R., Pan J., Lamsa J.C., Muenzer J. The characterization of a murine model of mucopolysaccharidosis II (Hunter syndrome). J. Inherit. Metab. Dis (2007) 30:924–934.[CrossRef][Web of Science][Medline]

  35. Evers M., Saftig P., Schmidt P., Hafner A., McLoghlin D.B., Schmahl W., Hess B., von F.K., Peters C. Targeted disruption of the arylsulfatase B gene results in mice resembling the phenotype of mucopolysaccharidosis VI. Proc. Natl Acad. Sci. USA (1996) 93:8214–8219.[Abstract/Free Full Text]

  36. Vogler C., Birkenmeier E.H., Sly W.S., Levy B., Pegors C., Kyle J.W., Beamer W.G. A murine model of mucopolysaccharidosis VII. Gross and microscopic findings in beta-glucuronidase-deficient mice. Am. J. Pathol (1990) 136:207–217.[Abstract]

  37. Russell C., Hendson G., Jevon G., Matlock T., Yu J., Aklujkar M., Ng K.Y., Clarke L.A. Murine MPS I: insights into the pathogenesis of Hurler syndrome. Clin. Genet (1998) 53:349–361.[CrossRef][Web of Science][Medline]

  38. Simonaro C.M., Haskins M.E., Schuchman E.H. Articular chondrocytes from animals with a dermatan sulfate storage disease undergo a high rate of apoptosis and release nitric oxide and inflammatory cytokines: a possible mechanism underlying degenerative joint disease in the mucopolysaccharidoses. Lab. Invest (2001) 81:1319–1328.[CrossRef][Web of Science][Medline]

  39. Holmes M.W., Bayliss M.T., Muir H. Hyaluronic acid in human articular cartilage. Age-related changes in content and size. Biochem. J (1988) 250:435–441.[Web of Science][Medline]

  40. Brown T.J., Laurent U.B., Fraser J.R. Turnover of hyaluronan in synovial joints: elimination of labelled hyaluronan from the knee joint of the rabbit. Exp. Physiol (1991) 76:125–134.[Abstract]

  41. Antonas K.N., Fraser J.R., Muirden K.D. Distribution of biologically labelled radioactive hyaluronic acid injected into joints. Ann. Rheum. Dis (1973) 32:103–111.[Free Full Text]

  42. Tanimoto K., Suzuki A., Ohno S., Honda K., Tanaka N., Doi T., Nakahara-Ohno M., Yoneno K., Nakatani Y., Ueki M., et al. Hyaluronidase expression in cultured growth plate chondrocytes during differentiation. Cell Tissue Res (2004) 318:335–342.[CrossRef][Web of Science][Medline]

  43. Nicoll S.B., Barak O., Csoka A.B., Bhatnagar R.S., Stern R. Hyaluronidases and CD44 undergo differential modulation during chondrogenesis. Biochem. Biophys. Res. Commun (2002) 292:819–825.[CrossRef][Web of Science][Medline]

  44. Flannery C.R., Little C.B.H.C.E., Caterson B. Expression and activity of articular cartilage hyaluronidases. Biochem. Biophys. Res. Commun (1998) 251:824–829.[CrossRef][Web of Science][Medline]

  45. Bastow E.R., Byers S., Golub S.B., Clarkin C.E., Pitsillides A.A., Fosang A.J. Hyaluronan synthesis and degradation in cartilage and bone. Cell Mol. Life Sci (2008) 65:395–413.[CrossRef][Web of Science][Medline]

  46. Roberts A.L., Rees M.H., Klebe S., Fletcher J.M., Byers S. Improvement in behaviour after substrate deprivation therapy with rhodamine B in a mouse model of MPS IIIA. Mol. Genet. Metab (2007) 92:115–121.[CrossRef][Web of Science][Medline]

  47. Venn G., Mason R.M. Absence of keratan sulphate from skeletal tissues of mouse and rat. Biochem. J (1985) 228:443–450.[Web of Science][Medline]

  48. Hemming R., Martin D.C., Slominski E., Nagy J.I., Halayko A.J., Pind S., Triggs-Raine B. Mouse Hyal3 encodes a 45–56 kDa glycoprotein whose overexpression increases hyaluronidase 1 activity in cultured cells. Glycobiology (2008) 2008 Jan 30; [Epub ahead of print].

  49. Sambrook J., Russell D.W. Molecular Cloning: A Laboratory Manual (2001) New York, NY: Cold Spring Harbor Laboratory Press.

  50. Mullenbach R., Lagoda P.J., Welter C. An efficient salt-chloroform extraction of DNA from blood and tissues. Trends Genet (1989) 5:391.[Web of Science][Medline]

  51. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (2001) 25:402–408.[CrossRef][Web of Science][Medline]

  52. Towbin H., Staehelin T., Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl Acad. Sci. USA (1979) 76:4350–4354.[Abstract/Free Full Text]

  53. Miura R.O., Yamagata S., Miura Y., Harada T., Yamagata T. Analysis of glycosaminogycan-degrading enzymes by substrate gel electrophoresis (zymography). Anal. Biochem (1995) 225:333–340.[CrossRef][Web of Science][Medline]

  54. Armed Forces Institute of Pathology. Laboratory Methods in Histotechnology (1994) Washington, D.C: American Registry of Pathology.

  55. Parkkinen J.J., Hakkinen T.P., Savolainen S., Wang C., Tammi R., Agren U.M., Lammi M.J., Arokoski J., Helminen H.J., Tammi M.I. Distribution of hyaluronan in articular cartilage as probed by a biotinylated binding region of aggrecan. Histochem. Cell Biol (1996) 105:187–194.[CrossRef][Web of Science][Medline]

  56. Blumenkrantz N., Asboe-Hansen G. New method for quantitative determination of uronic acids. Anal. Biochem (1973) 54:484–489.[CrossRef][Web of Science][Medline]

  57. Plaas A.H., West L., Midura R.J., Hascall V.C. Disaccharide composition of hyaluronan and chondroitin/dermatan sulfate. Analysis with fluorophore-assisted carbohydrate electrophoresis. Methods Mol. Biol (2001) 171:117–128.[Medline]

  58. Karousou E.G., Porta G., De L.G., Passi A. Analysis of fluorophore-labelled hyaluronan and chondroitin sulfate disaccharides in biological samples. J. Pharm. Biomed. Anal (2004) 34:791–795.[CrossRef][Web of Science][Medline]

  59. Shapira E., Blitzer M.G., Miller J.B., Africk D.K. Biochemical Genetics: A Laboratory Manual (1989) New York, NY: Oxford University Press.

  60. Pfaffl M.W., Horgan G.W., Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res (2002) 30:e36.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
C. Duterme, J. Mertens-Strijthagen, M. Tammi, and B. Flamion
Two Novel Functions of Hyaluronidase-2 (Hyal2) Are Formation of the Glycocalyx and Control of CD44-ERM Interactions
J. Biol. Chem., November 27, 2009; 284(48): 33495 - 33508.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
L. Jadin, X. Wu, H. Ding, G. I. Frost, C. Onclinx, B. Triggs-Raine, and B. Flamion
Skeletal and hematological anomalies in HYAL2-deficient mice: a second type of mucopolysaccharidosis IX?
FASEB J, December 1, 2008; 22(12): 4316 - 4326.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. M. Orimoto, K. Dumaresq-Doiron, J.-Y. Jiang, N. Tanphaichitr, B. K. Tsang, and E. Carmona
Mammalian Hyaluronidase Induces Ovarian Granulosa Cell Apoptosis and Is Involved in Follicular Atresia
Endocrinology, November 1, 2008; 149(11): 5835 - 5847.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow A corrigendum has been published
Right arrow A corrigendum has been published
Right arrow All Versions of this Article:
17/13/1904    most recent
ddn088v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Martin, D. C.
Right arrow Articles by Triggs-Raine, B. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martin, D. C.
Right arrow Articles by Triggs-Raine, B. L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?