Skip Navigation


Human Molecular Genetics Advance Access originally published online on October 18, 2007
Human Molecular Genetics 2008 17(2):240-255; doi:10.1093/hmg/ddm301
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
17/2/240    most recent
ddm301v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Raychaudhuri, S.
Right arrow Articles by Bhattacharyya, N. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Raychaudhuri, S.
Right arrow Articles by Bhattacharyya, N. P.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

HYPK, a Huntingtin interacting protein, reduces aggregates and apoptosis induced by N-terminal Huntingtin with 40 glutamines in Neuro2a cells and exhibits chaperone-like activity

Swasti Raychaudhuri1,2, Mithun Sinha1, Debashis Mukhopadhyay1 and Nitai P. Bhattacharyya1,2,*

1 Structural Genomics Section 2 Crystallography and Molecular Biology Division, Saha Institute of Nuclear Physics, 1/AF Bidhan Nagar, Kolkata 700 064, India

* To whom correspondence should be addressed at: Crystallography and Molecular Biology Division, Saha Institute of Nuclear Physics, 1/AF Bidhan Nagar, Kolkata 700 064, India. Tel: +91 3323375345-49; Fax: +91 3323374637; Email: nitai_sinp{at}yahoo.com

Received June 1, 2007; Accepted October 10, 2007


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
Expansion of polymorphic glutamine (Q) numbers present at the protein Huntingtin (Htt) beyond 36Q results in its misfolding and aggregation, and the aggregates recruit several other proteins. Here we show that HYPK, initially identified as an Htt-interacting partner by yeast two-hybrid assay, physically interacts with N-terminal Htt in Neuro2A cells and alters the numbers and distribution of aggregates formed by N-terminal Htt with 40Q. HYPK also alters the kinetics of mutated N-terminal Htt-mediated aggregate formation. Fluorescence recovery after photobleaching studies reveal that over-expression of HYPK results in the appearance of Htt poly Q aggregates, which upon bleaching recovers ~80% of initial fluorescence intensity within 6 min. Fluorescence loss in photobleaching studies indicate loss off fluorescence intensity of the aggregates with time in presence of HYPK. Over-expression of this protein reduces poly Q-mediated caspase-2, caspase-3 and caspase-8 activations, whereas {gamma} ray-induced activations of these enzymes are not affected. In vitro and in vivo studies demonstrate that HYPK possesses a novel chaperone-like activity. We conclude that HYPK, without having any sequence similarity with known chaperones, plays an effective role in protecting neuronal cells against apoptosis induced by mutated N-terminal Htt by modulating the aggregate formation.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
Huntington’s disease (HD) is an autosomal dominant neurodegenerative disease characterized by loss of striatal neurons and caused by the expansion of polymorphic CAG repeats in the exon1 of the gene Huntingtin (htt) (1). It is hypothesized that expansion of glutamine repeats (poly Q) beyond 36 in Huntingtin protein (Htt) results in conformational changes leading to formation of aggregates in the cytoplasm and the nucleus. These poly Q aggregates recruit several other proteins involved in survival, transcription and various cellular processes, leading to the loss of their normal functions. Such aggregates are thought to result in increased neuronal death in HD (2,3). However, contradictory results that these aggregates are the consequence of the pathogenic process of HD, and hence protect cells from death, are also available (4).

Function of Htt is not fully understood. Htt interacts with a large number of proteins, which have been identified by yeast two-hybrid (Y2H) assays, co-immunoprecipitation studies or by analysis of the components of Htt aggregates. Such studies indirectly provided information about the cellular role of Htt. These interactors are involved in vesicular transport, cytoskeletal organization, post-synaptic signaling, transcription and anti-apoptotic processes (5).

Using N-terminal portion of Htt (coded by the exon1 of the gene htt) as the bait, Faber et al. (6) identified 13 proteins and named them as Huntingtin yeast two-hybrid proteins (HYPs). Among these, HYPG is involved in protein turnover; HYPJ and HYPF have roles in protein trafficking and degradation; HYPA and HYPI are involved in mRNA splicing and tight junction function, respectively (6,7); HYPB acts as a DNA-binding factor (8); HYPC is a putative splicosome protein (7); HYPL is involved in cellular morphogenesis, membrane trafficking and vesicular trafficking (9); HYPH is a palmitoyl transferase involved in palmitoylation and trafficking of multiple neuronal proteins (10) and remaining four members, HYPK, HYPD, HYPE and HYPM are not yet characterized.

The present work aims at the characterization of HYPK to understand its possible role in HD pathogenesis. This protein neither shares any sequence homology with any protein of known sequence/structure in the databases, nor does it show any direct functional similarity. In Y2H assay, its interaction with htt exon1, having expanded CAG repeats in the pathogenic range, has been reported (6). Considering that Y2H predictions are subject to high rate of false positives (11), it is essential to establish the physical interaction of the protein with Htt. Several studies have suggested that loss of function of Htt interactors might play a crucial role in evoking HD pathogenesis, at least partially (12); it is indeed necessary, therefore, to investigate whether poly Q toxicity could be compromised in the cell model of HD by exogenous expression of HYPK.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
Interactions of HYPK with N-terminal Htt coded by exon1 of htt gene
To address the possible physical interaction of HYPK with N-terminal Htt and to study its role in HD pathology, we expressed exon1 of htt gene containing 39 CAG repeats and one CAA (when expressed, this would code 40Q at a stretch) in Neuro2A cells. Cells expressing N-terminal Htt containing 40Q tagged with red fluorescent protein (DsRed) was designated as DsRed-H40. Similarly, htt-exon1 with 15 CAG repeats and a CAA (coding for 16Q at a stretch), tagged with DsRed, was designated as DsRed-H16. HYPK tagged with GFP was termed as GFP-HYPK. GFP-HYPK and either DsRed-H40 or DsRed-H16 were co-expressed in Neuro2A cells. Over-expression of all the constructs was confirmed by western blot analysis (Supplementary Material, Fig. S1). Interactions of DsRed-H40 and DsReD-H16 with GFP-HYPK were studied using confocal microscopy and immunoprecipitation. DsRed-H16 was present mainly in the cytoplasm of Neuro2A cells (Fig. 1a, Supplementary Material, Fig. S2), whereas expression of DsRed-H40 was found to form aggregates in nuclear/peri-nuclear and cytoplasmic regions (Fig. 1b, Supplementary Material, Fig. S2). GFP-HYPK, when expressed alone, was ubiquitously present in both the compartments (Fig. 1c). In GFP-HYPK and DsRed-H16 expressing cells, both the proteins were found to co-localize throughout the cytoplasm, whereas in the nucleus only GFP-HYPK was present (Fig. 1d, Supplementary Material, Fig. S2). In Neuro2A cells expressing GFP-HYPK and DsRed-H40 together, two proteins predominantly co-localized outside the nucleus in aggregates and other regions (Fig. 1e, Supplementary Material, Fig. S2). Also, co-immunoprecipitation with GFP and detection with anti-poly Q antibody revealed that GFP-HYPK interacted with both DsRed-H16 and DsRed-H40 (Fig. 1B).


Figure 1
View larger version (92K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 1. (A) Co-localization of HYPK with N-terminal Htt coded by exon1 having 16Q or 40Q repeats. Neuro2A cells were co-transfected with constructs encoding either DsRed-H16 or DsRed-H40 together with GFP-HYPK (d and e) and compared with controls transfected with only DsRed-H16 (a), DsRed-H40 (b), GFP-HYPK (c), GFP and DsRedH16 (f), GFP and DsRed-H40 (g), GFP-HYPK and DsRed (h) or GFP and DsRed (i) as indicated. Cells were visualized using confocal microscope in fluorescence and phase constrast modes. The degree of co-localization was illustrated by merging DsRed and GFP images (merge). In (b) blue arrows indicate aggregates, whereas white arrows indicate co-localization of GFP-HYPK and DsRed-H16 in (d), co-localization of GFP-HYPK and DsRed-H40 (e) and aggregates formed by DsRed-H40 (g). White bars represent scale (10 µm). (B) HYPK physically interacts with htt exon1 with different poly Q stretches. Immunoprecipitation was done with anti-GFP antibody in Neuro2A cells co-transfected with GFP/DsRed-H16 (lane 5), GFP/DsRed-H40 (lane 6), GFP-HYPK/DsRed-H16 (lane 7), GFP-HYPK/DsRed-H40 (lane 8) and were detected with mouse anti poly Q antibody (Chemicon, 1:16 000 dilutions) as bands near 40 kDa (shown by arrow in the left margin). Molecular weights of DsRed-H40 and DsRed-H16 differ by ~3.5 kDa, as expected. Input controls were 5% of the protein extracts of the co-transfected cells used in each immunoprecipitation experiments. Lanes 1, 2, 3 and 4 corresponds to input control of GFP/DsRed-H16, GFP/DsRed-H40, GFP-HYPK/DsRed-H16 and GFP-HYPK/DsRed-H40, respectively. An image of the full blot with molecular weight markers is provided as Supplementary Material, Figure S4.

 
Suppression of aggregates formed by N-terminal Htt with 40Q by co-expression of GFP-HYPK
It is known that the expression of exon1 of htt alone having CAG repeats in the pathogenic range is sufficient to mimic important features of HD, namely increased nuclear aggregates and enhanced apoptosis (13). DsRed-H16 expression did not show any appreciable visible aggregates (Fig. 1a, Supplementary Material, Fig. S2), whereas expression of DsRed-H40 in Neuro2A cells resulted in the nuclear/peri-nuclear as well as cytoplasmic aggregates (Fig. 1b, Supplementary Material, Fig. S2). When DsRed-H40 and GFP-HYPK were co-expressed (Fig. 1e, Supplementary Material, Fig. S2), only 24.6% (±1.9%) of the co-transfected Neuro2A cells exhibited aggregates as opposed to that of 59.46% (±8.4%) observed in cells co-expressing GFP and DsRed-H40. About 6% of GFP and DsRed-H16 co-expressing cells and none of the GFP-HYPK expressing Neuro2A cells exhibited aggregates (Fig. 2A). In Neuro2A cells expressing GFP and DsRed-H40, aggregates were localized mostly in nuclear or peri-nuclear regions (11.2 ± 4.2 aggregates/cell), in sharp contrast to that observed in cells expressing DsRed-H40 and GFP-HYPK together, where aggregates rarely entered the nucleus (5.1 ± 3.4 aggregates/cell) (Fig. 2B, Supplementary Material, Fig. S2). The distribution and abundance of cytoplasmic aggregates, however, remained unaltered in GFP and DsRed-H40 expressing cells (4.1 ± 2.2 aggregates/cell) or in cells co-expressing GFP-HYPK and DsRed-H40 (3.9 ± 1.3 aggregates/cells). Typical representative fluorescence micrographs indicating localization of aggregates at nuclear/peri-nuclear (nucleus stained by DAPI) and cytoplasmic regions of GFP/DsRed-H40 or GFP-HYPK/DsRed-H40 cells are shown in Supplementary Material, Figure S2.


Figure 2
View larger version (10K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 2. HYPK prevents Huntingtin protein aggregation mediated by poly Q expansion in Neuro2A cells. (A) Cells were transfected with GFP and DsRed (1), GFP and DsRed-H16 (2), GFP-HYPK (3), GFP and DsRed-H40 (4) or GFP-HYPK and DsRed-H40 (5), and number of cells with or without aggregates (percentage) after 24 h of transfection were counted and plotted. For each experiment at least 200 cells were counted (n= 5). Level of significance (P≤ 0.0001) between the aggregates formed in cells co-expressing GFP and DsRed-H40 (4) and GFP-HYPK and DsRed-H40 (5) is represented by *. (B) Mean nuclear or cytoplasmic aggregates were counted for at least 200 cells after 24 h of transfection for cells transfected with GFP and DsRed-H40 (1 nuclear and 3 cytoplasmic) or GFP-HYPK and DsRed-H40 (2 nuclear and 4 cytoplasmic) and plotted (n= 5). Level of significance (P≤ 0.009) between the nuclear/peri-nuclear aggregates formed in cells co-expressing GFP and DsRed-H40 (1) and GFP-HYPK and DsRed-H40 (3) is represented by **. (C) Frequency of cells in Neuro2A population showing aggregates against time. The experiments were repeated for at least five times. Probability of H40 molecules to form aggregates decreases in presence of HYPK. For all the co-transfection experiments, both the plasmid DNA were taken in 1:1 (w/w) stoichiometric ratio (5 µg each). The error bars in (A–C) represent SD. P-values were calculated using Student’s t-test.

 
Live cell microscopy reveals that co-expression of GFP-HYPK reduces the kinetics of mutated N-terminal Htt-mediated aggregate formation
It was evident from the above-mentioned results that GFP-HYPK not only interacted with DsRed-H16 and DsRedH40, but also altered the localization and distribution of the DsRed-H40-mediated aggregates. The inhibitory role of GFP-HYPK in the formation of poly Q aggregates was monitored with live cell confocal microscopy. In Neuro2A cells, in presence of GFP, expression of DsRed-H40 was observed after 4 h of completion of transfection. In another 4 h, tiny aggregates started to form and large aggregates emerged at around 14 h (Figs 2C and 3Ai). Number of cells having aggregates increased with time until 20 h after transfection when almost 60% of the GFP and DsRed-H40 co-expressing cells exhibited aggregates. After 22 h of transfection, number of aggregate containing cells (as observed by microscopy) decreased most probably because of fading out of fluorescence from aggregates because of cell death (Fig. 2C). On the contrary, when Neuro2A cells were expressing GFP-HYPK and DsRed-H40 together, aggregates started to appear at 12–15 h after transfection (Figs 2C and 3Aii). Numbers of cells containing aggregates were dramatically decreased and was ~22% after 22 h of transfection (Fig. 2C). To elucidate further, we monitored the aggregation process within single cells and to rule out the effects of any phototoxic or other metabolic phenomenon during live cell microscopy, rather than calculating the fluorescence intensities within the regions of interests, we calculated the relative fluorescence intensities (RFIs, see Materials and Methods for details) of DsRed signals from the aggregates vis-à-vis an aggregate-free region (Fig. 3B). In DsRed-H16 transfected Neuro2A cells, no aggregation was observed until 24 h and the cells remained healthy (Supplementary Material, Movie S1). In empty GFP vector and DsRed-H40 co-expressing Neuro2A cells, RFI of DsRed-H40 signal increased up to 4-fold of the initial intensity within 16 h (Fig. 3B, Supplementary Material, Movie S1). In comparison, in cells expressing GFP-HYPK and DsRed-H40 together, the expression of DsRed-H40 started in a similar fashion at 4 h, but aggregates formed by DsReD-H40 were detected at 12 h and the cells remained alive and healthy (as evident from the fluorescence intensities) till 24 h (Fig. 3B, Supplementary Material, Movie S2). RFI values calculated for each of DsRed-H40 and GFP-HYPK signals remained almost constant during the course of the experiment in a 1:1 ratio. Further, in both the cases the final RFI values were never beyond 1.5 times of the initial values. This probably indicates a steady interaction between these two proteins (Fig. 3B, inset). As a control, expression of empty GFP vector in DsRed-H40 expressing cells did not influence poly Q-mediated aggregation. This result ruled out the possibility of any preventive effect of GFP alone on the aggregation kinetics (Fig. 3i, Supplementary Movie S2). To check whether differences at the expression levels of the concerned proteins in either of these two cells (GFP/DsRed-H40 and GFP-HYPK/DsRed-H40) influenced the aggregation process, despite the same transfection protocol which used equal amounts of each construct, we recorded the time-course of fluorescence intensities of both GFP and DsRed signals from cytoplasmic regions (devoid of any aggregates) in both the cells. Ratios of the fluorescence intensities (DsRed to GFP) indicated that just after transfection (4 h) the expression levels of the exogenous proteins in both type of cells were almost equal (ratio equals to ~1). This value remained almost constant for about 16 h more in GFP-HYPK and DsRed-H40 co-expressing cells. On the other hand, in empty GFP and DsRed-H40 co-transfected cells, the same ratio dropped down with the emergence of larger aggregates as with time most of the DsRed-H40 signal was getting concentrated in the aggregates, but the GFP signal did not. This observation nullified the possibility of the influence of differential expression of exogenous proteins on aggregation (Supplementary Material, Fig. S3).


Figure 3
View larger version (48K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 3. Poly Q aggregation slows down in presence of HYPK as revealed by live cell microscopy. (A) GFP/DsRed-H40 co-transfected (i) and GFP-HYPK/DsRed-H40 co-transfected (ii) Neuro2A cells were used to monitor differential aggregation kinetics in vivo. Experiments were repeated for at least five times. For both the co-transfection experiments constructs were taken in 1:1 (w/w) stoichiometric ratio (5 µg each). After transfection, cells in glass bottom dishes were placed in an incubator attached to the microscope at 37°C in 5% CO2 atmosphere under humidified condition. After first manual observation of visible fluorescence signal from the cells, images were grabbed for single cells at 10 min interval until the end of the experiment. Representative still images from the movies (Supplementary Material, Movie S2) at 60, 240, 320, 420, 510 and 610 min are shown with movie time-points in minutes as indicated in each frame. The time-course of aggregation is explained in the Results section. White bars represent scale (10 µm). (B) Relative fluorescence intensities (RFI) of DsRed signals from single cells from (Ai and ii) are plotted with respect to time. Intensities were recorded up to 16 h after transfection. GFP/DsRed-H40 transfected cells were dying after this time-point resulting in huge variations in RFI between aggregates, possibly because of uncontrolled loss of signal intensity. Inset is showing the time-course of RFI of GFP and DsRed signals from aggregates found in GFP-HYPK and DsRed-H40 co-transfected cells. Both the signals show equivalence throughout the experiment. Each data point shows average of at least five experimental analyses. The error bars in (B) represent SD.

 
FRAP and FLIP of Htt aggregates in the presence and absence of GFP-HYPK
To delve deeper, the spatial dynamics of the proteins localized with the poly Q aggregates were studied using fluorescence recovery after photobleaching (FRAP) in combination with the complementary technique fluorescence loss in photobleaching (FLIP). When attempts were made to bleach a cytoplasmic region in cells co-expressing GFP and DsRed-H16, no prominent bleach zone could be detected after using FRAP, albeit an immediate decrease in fluorescence intensity throughout the cell (Fig. 4Aii). The calculated RFI did not change appreciably with time (Fig. 4B). This could be ascribed to the high mobility of DsRed-H16 in the cytosol as the protein was moving through the bleached region faster than the time of the pulse and the subsequent imaging (<20 s). Hence, this observation was not because of any technical inability of the laser to create a bleach zone. The mobile fraction, i.e. the fraction of fluorescent molecules that were free to move within the bleached region, was calculated to be 85.1 ± 1.8% of the total pool. When cytoplasmic or nuclear regions of cells, expressing GFP-HYPK, were bleached with the same FRAP protocol, again no discernible bleach zones could be observed but a drop of intensity in the bleach zone along with the surroundings was noticed. (Fig. 4Aiv). Interestingly, upon recovery, the RFI in this case could not reach 100% of the initial intensity within the time-span of the experiment (6 min) (Fig. 4C). The mobile fraction was calculated to be 69.2 ± 6.4%. Similarly, a cytoplasmic region having co-localized GFP-HYPK and DsRed-H16 failed to yield any noticeable bleaching with similar laser treatment (Fig. 4V). Mobile fraction for DsRed-H16 increased to 99.8 ± 7.6%, while that for GFP-HYPK remained almost similar (68.4 ± 3.3%). In contrast, DsRed-H40 localized to either nuclear or cytoplasmic aggregates in cells co-expressing empty GFP and DsRed-H40 constructs showed markedly different behavior. Larger aggregates could not be bleached with the same FRAP protocol. This could be because of inadequate laser power. DsRed-H40 molecules within the smaller aggregates, however, were bleached (Fig. 4Aiii) and did not show any recovery within the experimental time-span (6 min) (Fig. 4C) with a mobile fraction of only 9.1 ± 3.5%. Quite the opposite was the behavior of DsReD-H40 in the cytoplasmic aggregates of GFP-HYPK and DsRed-H40 co-expressing cells (Fig. 4Avi). RFI of DsRed-H40 inside the bleached zone within the aggregates recovered within 6 min with an increased mobile fraction of 74.9 ± 11.2% (Fig. 4C). Within the bleached region, the RFI of GFP-HYPK recovered with a mobile fraction of 70.3 ± 3.9%, similar to that found in only GFP-HYPK transfected cells (Fig. 4C). To validate that such differential behavior of DsRED-H40 was solely influenced by GFP-HYPK and not was an artifact because of GFP, empty GFP vector was used as a control in all the FRAP experiments wherever GFP-HYPK was absent.


Figure 4
View larger version (75K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 4. FRAP analysis of polyglutamine aggregates and co-localized proteins. (A) FRAP analysis of the molecular interaction between H40 and HYPK. Neuro2A cells were transfected with GFP and DsRed (i), GFP and DsRed-H16 (ii), GFP and DsRed-H40 (iii), GFP-HYPK (iv), GFP-HYPK and DsRed-H16 (v) and GFP-HYPK and DsRed-H40 (vi) and subjected to FRAP. Fluorescent molecules within the boxed area (yellow box) in each image were bleached. Inset provides a magnified view of each bleached (yellow boxed) area to provide closer details of the FRAP event. In image iii, the inset represents a closer look of the upper bleach zone (upper yellow box) only. For each experiment, single scanned images were grabbed just before photobleaching (pre-bleach); just after bleaching (0 min) and every 20 s thereafter up to 6 min. Experiments were repeated for at least five times. Scale bar (white) represents 10 µm. (B) Quantitative FRAP analysis of GFP or DsRed fusion proteins from GFP and DsRed co-transfected cells (i) or GFP and DsRed-H16 co-transfected cells (ii) or GFP-HYPK and DsRed-H16 co transfected cells (v). Separate symbols for each RFI time-course from each experiment are indicated in the figure. The average RFI was calculated from the analysis of five cells (n= 5) against indicated time-points and error bars indicate SD. (C) Quantitative FRAP analysis of GFP or DsRed fusion proteins from aggregate or non-aggregate regions of GFP-HYPK (iv) or GFP and DsRed-H40 co-transfected Neuro2A cells (iii) or GFP-HYPK and DsRed-H40 co-transfected cells (vi). Separate symbols for each RFI time-course from each experiment are indicated in the figure. Each data point indicates average RFI analysis of five cells (n= 5) and error bars indicate SD.

 
To confirm the experimental results obtained in FRAP, we carried out FLIP analysis in Neuro2A cells expressing either GFP and DsRed-H40 or GFP-HYPK and DsRed-H40 together (Fig. 5A). In principle during FLIP, a region of the cell is repeatedly bleached, and loss of fluorescence in the surrounding area is followed over time. In these two experimental cells, smaller regions other than the aggregates were continuously bleached and the RFI in the aggregate regions were simultaneously monitored to check whether intensities decreased near the background levels over time (Fig. 5B). In cells expressing GFP and DsRed-H40, the fluorescence intensity of DsRed-H40 in aggregates did not alter, whereas RFI of GFP decreased significantly (Fig. 5B). In contrast, in cells expressing GFP-HYPK and DsRed-H40, significant reduction of both GFP-HYPK and DsRed-H40 signals in the aggregates were observed (Fig. 5B). FLIP analysis, therefore, further indicated that HYPK, interacting with the N-terminal Htt with 40Q, could alter poly Q-mediated aggregation kinetics and prevent sequestration of aggregate components.


Figure 5
View larger version (35K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 5. FLIP analysis of polyglutamine aggregates and co-localized proteins. (A) FLIP analysis of polyglutamine aggregates in GFP and DsRed-H40 (i) or GFP-HYPK and DsRed-H40 (ii) co-transfected Neuro2A cells. Single scanned images were grabbed just before photobleaching (pre-bleach) and at 1 min intervals during continuous photobleaching of the yellow-boxed area. Note that in case of GFP/DsRed-H40 cells, fluorescence intensity of DsRed signal from the aggregates did not reduce with continuous bleaching of an area devoid of aggregates, whereas in GFP-HYPK/DsRed-H40 cells significant reduction of DsRed signal from the aggregates is apparent. Scale bar (white) represents 10 µm. (B) Quantitative FLIP analysis of aggregates associated with GFP or DsRed fusion proteins in GFP and DsRedH40 or GFP-HYPK and DsRed-H40 co-transfected cells. Percentage RFI is plotted against time indicating loss of fluorescence intensity of DsRed-H40 in aggregates of GFP-HYPK/DsRed-H40 cells. Each data point represents average of five experiments. Error bars in each figure indicate SD of the data points.

 
Consistent with the microscopic analysis, a filter retardation assay (14) with cells expressing both GFP-HYPK and DsRed-H40 together showed a considerable reduction in the amount of SDS insoluble poly Q aggregates in comparison to cells expressing DsRed-H40 alone (Fig. 6A).


Figure 6
View larger version (25K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 6. HYPK prevents poly Q-mediated aggregation and cytotoxicity in Neuro2A cells. (A) Filter trap assay of SDS insoluble DsRed-H40 aggregates. Amount of aggregate formed by Htt was reduced in presence of HYPK. In the blot, bands corresponding to SDS insoluble aggregates were visible when 20 µg of the insoluble fraction of Neuro2A cell extract transfected with DsRed-H40 was loaded in absence of HYPK. In presence of HYPK, no such bands could be seen up to 30 µg of the load. (B) Mean nuclear fragmentation in cells expressing GFP and DsRed (1) or GFP and DsRed-H16 (2) or GFP and DsRed-H40 (3) or GFP-HYPK (4) or GFP-HYPK and DsRed-H16 (5) or GFP-HYPK and DsRedH40 (6) were counted as per the protocol described in Majumder et al. (15). Experiments were repeated at least five times. Level of significance (P≤ 0.0001) between the nuclear fragmentation observed in cells co-expressing GFP and DsRed (1) and GFP and DsRed-H16 (2) is represented by *; between GFP and DsRed (1) and GFP and DsRed-H40 (3) (P≤ 0.0001) is represented by **; between GFP and DsRed (1) and GFP-HYPK (4) (P≤ 0.05) is represented by ***, between GFP and DsRed-H16 (2) and GFP-HYPK and DsRed-H16 (5) (P≤ 0.6348; not statistically significant) is represented by ****; between GFP and DsRed-H40 (3) and GFP-HYPK and DsRedH40 (6) (P≤ 0.0001) is represented by *****. (C) Neuro2A cells were transfected with GFP and DsRed (1) or GFP-HYPK (2) or GFP and DsRed-H16 (3) or GFP-HYPK and DsRed-H16 (4) or GFP and DsRed-H40 (5) or GFP-HYPK and DsRed-H40 (6) and percentage cell survival were determined by MTT assay, taking the survival of control GFP and DsRed co-transfected cells as 100% after 24 h of transfection, as described by Majumder et al. (15). Experiments were repeated at least five times. Level of significance (P≤ 0.0383) between the cell survival observed in cells co-expressing GFP and DsRed (1) and GFP-HYPK (2) is represented by *, between GFP and DsRed (1) and GFP and DsRed-H16 (3) (P≤ 0.001) is represented by **; between GFP and DsRed-H16 (3) and GFP-HYPK and DsRed-H16 (4) (P≤ 0.9371; not statistically significant) is represented by ***; between GFP and DsRed (1) and GFP and DsRed-H40 (5) (P≤ 0.0001) is represented by **** and between GFP and DsRed-H40 (5) and GFP-HYPK and DsRed-H40 (6) (P≤ 0.0006) is represented by *****. Error bars in figures indicate SD of the data points. The P-values were calculated using Student’s t-test.

 
Reduction of DsRed-H40-induced apoptosis by co-expression of GFP-HYPK
To address whether this quantitative reduction in aggregates could also lead to the reduction of poly Q-mediated cytotoxicity, extents of cell survival and apoptosis were studied in presence of HYPK. There was a 2.5-fold decrease in nuclear fragmentation, an indication of apoptosis (15), in cells expressing GFP-HYPK and DsRed-H40 together (14.3 ± 1.07%) in comparison to those cells co-expressing GFP and DsRed-H40 (36.2 ± 1.2%) (Fig. 6B). Increase in survival was also observed by [3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide] (MTT) assay in cells expressing GFP-HYPK and DsRed-H40 together (89.1 ± 2.6%) in comparison to that obtained (57.2 ± 3.3%) in empty GFP and DsRed-H40 co-expressing cells (Fig. 6C). Fluorometric measurements of caspase-2, caspase-3 and caspase-8 activities indicated elevated levels of activation of all the three caspases (1.9, 1.8 and 2.2-fold for caspase-2, caspase-3 and caspase-8, respectively) in Neuro2A cells co-expressing empty GFP and DsRed-H40 constructs vis-à-vis control empty GFP/empty DsRed co-expressing cells. In contrast, significant decrease in activations of these three caspases (1.6, 2 and 1.8-fold for caspase-2, caspase-3 and caspase-8, respectively) were also observed in GFP-HYPK and DsRed-H40 expressing cells vis-à-vis cells co-expressing GFP and DsRed-H40 (Fig. 7A–C). Independent expression of GFP-HYPK in Neuro2A cells decreased cellular survival to some extent (Fig. 6C), as revealed by MTT assay, for unknown reasons. But we did not observe any significant increase in the levels of caspase-2, caspase-3 and caspase-8 activities in the same cells (Fig. 7A–C). However, co-expression of GFP-HYPK with DsRed-H40 in Neuro2A cells could decrease aggregates as well as aggregation kinetics, as shown above, suppress the toxicity and reduce apoptosis. To check whether this unique role of HYPK in reducing cytotoxicity was a general phenomenon or was it specific for poly Q-mediated toxicity, we tested for any modulatory effect of HYPK expression on {gamma}-irradiation-induced cytotoxicity. Results of these experiments are compiled in Fig 7D and E. It was evident that {gamma}-radiation-induced toxicity was not altered in presence of HYPK as revealed by MTT and caspase-activation assays. This result indicated that the ability of HYPK to reduce toxicity was probably specific for poly Q aggregates.


Figure 7
View larger version (45K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 7. Over-expression of HYPK decreases poly Q-mediated apoptosis by reducing caspase activities. (A) Fluorometric measurement of caspase-2 activity indicated 1.9-fold activation in empty GFP and DsRed-H40 (3) co-expressing cells compared with control GFP/ DsRed expressing cells (1), which was significantly reduced (1.6-fold) when GFP-HYPK was co-expressed with DsRed-H40 (4). No appreciable change in caspase-2 activity in GFP-HYPK expressing cells (2) was observed compared with control GFP/DsRed expressing cells (1). (B) Fluorometric measurement of caspase-3 activity increased up to 1.8-fold in empty GFP and DsRed-H40 co-expressing Neuro2A cells (3) compared with control GFP/DsRed expressing cells (1), whereas co-expression of GFP-HYPK (4) decreased activity by ~2-fold. In GFP-HYPK expressing cells (2), caspase-3 activity was found to be almost equivalent to control cells. (C) Fluorometric measurement of caspase-3 activity was reduced 1.8-fold in GFP-HYPK/DsRed-H40 co-expressing cells (4) than empty GFP and DsRed-H40 co-expressing cells (3). While compared with control cells (1), in empty GFP and DsRed-H40 expressing cells caspase-8 activity increased 2.2-fold. No appreciable change in caspase-8 activity in GFP-HYPK expressing cells (2) was observed compared with control GFP/DsRed expressing cells (1). All the caspase assay experiments were carried out at least five times and the activities were measured after 24 h of transfection. Expression of the proteins were confirmed by western blot with anti-GFP (for GFP and GFP-HYPK) and anti-poly Q (for DsRed-H40) antibody. See Supplementary Material, Figure S1 for the images of the blots. Error bars in each figure indicate SD and level of significance (P< 0.05) of all the caspase activities between control GFP/DsRed cells and GFP/DsRed-H40 cells are indicated by #, whereas between GFP/DsRed-H40 and GFP-HYPK/DsRed-H40 cells (P< 0.05) are indicated as ## in each figure. (D) MTT assay of GFP or GFP-HYPK transfected Neuro2A cells after {gamma} irradiation of 0, 3.2, 6.4 and 12.8 GY doses. Cell survival was determined after 36 h considering the survival of non-irradiated only GFP expressing cells as 100% (n= 5). Survival decreased in a dose-depended manner in both GFP and GFP-HYPK transfected cells. There was no noticeable difference between the survivals in these two cells indicating GFP-HYPK did not alter {gamma}-ray-induced cell death. (E) Fluorometric determination of caspase-2, -3 and -8 activities after {gamma}-irradiation in cells transfected either with GFP or GFP-HYPK. Caspase activities were measured after 36 h of {gamma}-irradiation. Caspase-2, -3 and -8 activities were increased in a similar way in both types of cells after {gamma} exposure as described in the figure. For fold calculation, caspase-2, -3 and -8 activities in GFP transfected cells without {gamma} exposure were considered as 1-fold. Experiments were repeated for at least five times. Error bars in each figure indicate SD of the data points. The P-values were calculated using Student’s t-test.

 
HYPK has chaperone-like activity
There are reports that chaperones alter poly Q protein aggregations and subsequent toxicity, presumably by redirecting the aggregation process through the formation of non-fibrillar, amorphous aggregates (16). Here we have observed that HYPK was able to reduce both poly Q aggregate formation and apoptosis. With this premise, we tested whether HYPK has chaperone-like activity even though it has no sequence homology with any known chaperone. To test the hypothesis, we expressed and purified HYPK from bacterial source by affinity chromatography and performed in vitro chaperone-activity assays. In presence of purified HYPK, temperature-induced aggregation of alcohol dehydrogenase (Fig. 8A) and malate dehydrogenase (Fig. 8B) was reduced in a dose (concentration of HYPK)-dependent manner. Renaturation kinetics of unfolded bovine carbonic anhydrase (BCA) was also accelerated significantly in presence of HYPK (Fig. 8C). These results showed that HYPK exhibit chaperone-like activity in vitro.


Figure 8
View larger version (22K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 8. HYPK exhibits chaperone-like activity. (A) In vitro aggregation reduction assay for alcohol dehydrogenase. The time-course of thermal aggregation of alcohol dehydrogenase in absence and presence of purified HYPK, BSA (non-chaperone control) and {alpha}-casein (positive control with known chaperone activity) (42), was monitored by light scattering (n= 5). (B) In vitro aggregation reduction assay for malate dehydrogenase. The time-course of thermal aggregation of malate dehydrogenase in absence and presence of purified HYPK, BSA and {alpha}-casein, was monitored by light scattering (n= 5). (C) In vitro refolding assay of bovine carbonic anhydrase (BCA). Refolding of BCA in absence and presence of HYPK and domain V of 23S ribosomal subunit (positive control) (43) was measured in terms of percentage functional reactivation of BCA after 2 h of incubation at 25°C (n= 5). Level of significance (P≤ 0.005) between unassisted folding of BCA and HYPK assisted folding of BCA is represented by *. (D) In vivo chaperone-like activity of exogenous HYPK and its loss of function. Luciferase activities of H-Tet-Off-Luc+ve cells, transfected with blank GFP vector; before heat shock (1), immediately after heat shock (5) and 4 h recovery after heat shock (9) are plotted as relative light units per second. For cells expressing GFP-HYPK; before heat shock (2), immediately after heat shock (6) and 4 h recovery after heat shock (10), for cells co-transfected with blank GFP and DsRed-H40; before heat shock (3), immediately after heat shock (7) and 4 h recovery after heat shock (11), and for cells co-expressing GFP-HYPK and DsRed-H40; before heat shock (4), immediately after heat shock (8) and 4 h recovery after heat shock (12) are also plotted. In every case, heat shock was administered 24 h after transfection of H-Tet-Off-Luc+ve cells with experimental constructs. Each of these experiments was repeated at least five times. Levels of significance between 1 and 2; 5 and 6; and 9 and 10 is P≤ 0.005 and represented by *. Levels of significance between 2 and 4; 6 and 8; and 10 and 12 (P≤ 0.05) is represented by #. Error bars in each figure indicate SD of the data points. The P-values were calculated using Student’s t-test.

 
To check whether HYPK could show chaperone-like activity in vivo, we tendered heat shock at 45°C for 30 min to HeLa cells expressing well-characterized, heat sensitive protein luciferase. The basis of this in vivo assay was to monitor refolding of heat-denatured luciferase in vivo as a measure of chaperone activity. HeLa cells were stably transfected with pTet-Off-Advanced inducible vector to give rise to H-Tet-Off+ve cells, which upon transfection with pTRE-Tight-Luc vector express luciferase (described in details in Materials and Methods). These cells (H-Tet-Off-Luc+ve) were then transfected with GFP-HYPK or blank GFP vectors, and luciferase activity was measured at immediately after (0 h) and 4 h of recovery following heat shock. Luciferase activity was also determined in the same cells without applying heat shock. Enzyme activity obtained from the cell extract of GFP-HYPK expressing H-Tet-Off-Luc+ve cells before heat shock was ~5-fold higher than H-Tet-Off-Luc+ve cells expressing blank GFP vector, indicating greater amount of properly folded luciferase in presence of HYPK. Similarly, ~5 times more luciferase activity was observed in presence of HYPK immediately after heat shock and the recovery was 15-fold more in HYPK transfected cells than in the control GFP transfected H-Tet-Off-Luc+ve cells after 4 h of incubation at 37°C (Fig. 8D). This result confirms the results obtained in vitro and showed that HYPK could act as a chaperone in vivo.

Loss of function of HYPK
When DsRed-H40, together with GFP-HYPK, was over-expressed in H-Tet-Off-Luc+ve cells, a reduction in the luciferase activity was observed compared with H-Tet-Off-Luc+ve cells transfected with GFP-HYPK only (P< 0.0001). Upon heat shock to both the cells, the retained luciferase activity in presence of only GFP-HYPK was higher than that with concurrent expression of DsRed-H40 and GFP-HYPK (P< 0.04). After 4 h of recovery, luciferase activity in GFP-HYPK expressing H-Tet-Off-Luc+ve cells was higher compared with that obtained in cells expressing GFP-HYPK and DsRed-H40 together (P< 0.0002) (Fig. 8D). This data indicated that in presence of N-terminal Htt with 40Q, activity of exogenous HYPK had been reduced. Thus it is likely that the function of HYPK is partially lost because of interaction with aggregates.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
In the present study, we have confirmed, by confocal microscopy and immunoprecipitation, that HYPK interacts with the N-terminal of Htt. In addition, we showed that the extent of aggregation and apoptosis induced by the N-terminal fragment of Htt with 40Q were reduced by HYPK. Besides, we have identified both in vitro and in vivo that the protein HYPK had chaperone-like activity.

Aggregation of Htt is initiated by the misfolding of the protein because of increased number of Q residues, forming parallel β-sheet structures that associate together to form self-aggregates (17). It is known that the accumulation of the poly Q-mediated aggregates and subsequent toxicity is age and poly Q length dependent (18). This reflects the progressive reduction in the cells’ ability of quality control to eliminate the toxic load induced by poly Q aggregation.

Aggregates formed by mutated Htt recruit several proteins including various heat-shock proteins (HSP) with chaperone activity, proteins involved in ubiquitin proteosomal degradation pathway, transcription factors and others (5,19). It has been hypothesized that recruitment of proteins to aggregates disrupts the normal functions of the recruited proteins. Over-expression of any of the interacting proteins would preferentially release other recruited partners, whose normal functions would be gained thereby and would reduce mutated Htt-mediated toxicity (20). On the other hand, over expressed protein might directly play a role to modulate the aggregation process and toxicity (21). Among various Htt interacting proteins, different HSPs like HSP70, HSP90, HSP40, yeast chaperone Hsp104, cytoplasmic chaperone TRiC (16,22,23), Hsc70 and BAG-1 (24,25) have been shown to reduce Htt aggregates and toxicity. However, HSP27 has been shown to reduce toxicity without altering the aggregates in HD cell model (26), although distributions and sizes of the aggregates are altered in animal model of HD (23). In a contradictory report, no effect of HSP27 over-expression on aggregation, toxicity and reduction of oxidative stress have been observed (27). Transcription regulator CA150 expression in cell model of HD causes redistribution of the nuclear and cytoplasmic aggregates and rescues the toxicity (28), while CREB expression decreases the lethality in Drosophila model (29). It is interesting to note that co-expression of HIP2/E2-25K and mutated Htt increases aggregation and apoptosis (30). All these results indicate that effects of co-expression of Htt-interacting proteins together with mutated Htt depend on the protein concerned and the model system used. Reduction of N-terminal Htt aggregates and toxicity by HYPK, as observed in the present investigation, could either be because of its ability to replace other proteins that interact with Htt which probably lead to loss of their functions or because of direct interference with the formation of aggregates.

Very little information about HYPK is available in the literature. In the present study, we observed in vitro that purified HYPK had chaperone-like activity, which was validated by in vivo observation (Fig. 8). HYPK does not have any similarity with known chaperones at sequence level. It has earlier been shown that HYPK is associated with chaperone complex together with MPP11 and Hsp70L1 (31). Computational analysis of the primary structure of HYPK revealed limited functional/structural information. It is predicted to be an intrinsically unstructured protein with an endoplasmic reticulum retention signal. A putative nascent peptide-binding motif at the C-terminal domain has also been predicted (unpublished data). All these characteristics together might also qualify HYPK as a chaperone (32,33).

Our observations that HYPK could modulate the aggregate forming ability and subsequent apoptosis caused by N-terminal Htt with 40Q repeats are intriguing and can easily be ascribed to its novel chaperone-like activity. Chaperones are known to modulate the aggregation process in a variety of ways (21,22). Lack of recovery of RFI of DsRed signal on bleaching an aggregate (Fig. 4A) could be because of sequestration of the proteins inside the aggregates. However, in presence of GFP-HYPK, mobile fraction of DsRed-H40 molecules within aggregates increased by ~7 times. Rapid recovery of fluorescence intensity in the bleached region on the aggregates in FRAP and loss of fluorescence intensity of the aggregates as detected by FLIP indicated that HYPK possibly interacted with the misfolded poly Q at an ‘intermediate state’, which was still freely mobile and not sequestered within the aggregates. This way it possibly slowed down the poly Q-mediated aggregation kinetics by reducing its growth rate. In case of Hsp70, it has been reported that such transient protein–protein interactions lead to inhibition of its sequestration within the aggregate, whereas over-expression of TATA box-binding protein fails to show similar results (34).

It is well accepted that the aggregates formed by the mutated N-terminal Htt leads to enhanced apoptosis (13). Recruitment of pro-caspase-8 to the poly Q aggregates is known to activate caspase-8 (35). Activation of caspase-8, one of the initiator caspases, is thought to be the initial event of apoptosis that leads to the activation of several downstream caspases like caspase-3. In presence of HYPK, as aggregate formation is reduced, caspase-8 activity is also decreased (Fig. 7C) which in turn inhibited the activation of caspase-3 (Fig. 7B). Similar mechanism for activation of caspase-2 because of its interaction with poly Q aggregates has been proposed (36). In presence of HYPK, reduction of aggregate formation might reduce the activation of caspase-2, as observed (Fig. 7A). However, HYPK could not affect the {gamma}-ray-induced activation of caspase-8 significantly, as well as that of other apoptotic markers studied. These results indicated that HYPK might not alter the apoptotic pathway in general and reduction in the activation of caspases, in Neuro2A cells containing mutated N terminal Htt, could be because of its modulatory effects on aggregate formation.

Similar results of aggregate formation by DsRed-H40 and reduction of the same in presence of exogenous HYPK, as described in this manuscript, were also observed in HeLa cells (unpublished data). Experiments to assay chaperone activities in vivo using HeLa cells revealed chaperone-like activity of exogenous HYPK. Preliminary results indicated that similar in vivo chaperone-like activity of HYPK could be detected in Neuro2A cells as well. Direct evidence showing the involvement of endogenous HYPK in aggregate formation remains elusive because of non-availability of commercial antibody against HYPK and failures of earlier attempts to raise antibody against HYPK (31). Chaperone-like activity of exogenous HYPK is reduced to some extent in the presence of DsRed-H40 (Fig. 8D). This result indicated that loss of chaperone-like activity of exogenous HYPK was because of its interaction with the aggregates.

Given that HYPK reduced Htt aggregates and toxicity, it would be important to look into the tissue/region-specific expression of the gene. Recently, expression of Hsp70 has been shown to increase in neuronal subtypes that are not affected in HD, while the expression is not changed in neurons destined for neurodegeneration (37).

In our experimental system, possibly for the first time, we observed that HYPK interacted with the N-terminal Htt and reduced aggregation and apoptosis induced by the mutated N-terminal Htt. However, the cytotoxicity induced by {gamma}-radiation had not been changed. This result indicates that unlike several other chaperones (38), HYPK is most possibly not involved in modulating the apoptotic pathway in general. HYPK, as an interactor of Htt with chaperone-like activity, has the potential to play important role in HD pathway and demands immediate attention.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 
Cloning of normal and expanded htt exon1 in DsRedC1 vector
Specific primers (forward: 5'- CGCGTCGACGTCATGGCGACCCTGGAAAAGCTGA TGAAGG-3' and the reverse: 5'-TGGGATCCGGTCGGTGCAGCGGCTCCTCAGC-3') for htt exon1 with adaptors (underlined) for the restriction enzymes (RE) SalI and BamH1 were synthesized (MWG Biotech, Ebersberg, Germany) to amplify htt exon1 (Ensemble transcript ID ENST00000355072) from HD patient or normal individual. PCR products were digested with SalI and BamH1 (Promega, Madison, WI, USA) and ligated to DsRedC1 vector (BD Biosciences, Palo Alto, CA, USA). Constructs were confirmed both by DNA sequencing and RE digestion.

Cloning, expression and purification of HYPK
Gene specific primers (forward: 5' ACGCGTCGACGTCGTGGTGAAATAGATA TG 3' and the reverse: 5' CGGGATCCCGTCAGTTGGTTAGGGCAATAA 3') for HYPK (NM_016400 [GenBank] ) with adaptors for the REs SalI and BamH1 were synthesized. Total RNA was isolated from leukemic cell line P3HR1 using standard methods. The first strand cDNA was synthesized using oligo dT primers and reverse transcriptase (Invitrogen, Carlsbad, CA, USA) and amplified using the above primers. RT–PCR product was digested with SalI and BamH1 and ligated with pPROTETC2 vector (BD Biosciences). Construct was confirmed both by DNA sequencing and RE digestion. The gene was further subcloned to PET 28a+ vector (Novagen, San Diego, CA, USA) using REs NcoI and NotI to obtain better expression keeping the 6HN tag intact. Recombinant HYPK was expressed in Escherichia coli BL21DE3 cells and affinity purified through Ni-NTA column (Qiagen GmbH, Hilden, Germany). To further verify the molecular weight, mass spectra of purified native HYPK was obtained by using a MALDI-TOF-TOF mass spectrometer (ABI 4700, Applied Biosystems Inc., Foster City, CA, USA). To remove the affinity tag, affinity purified protein was incubated with EKMax (Invitrogen) on ice for 60 min and passed through Ni-NTA column. HYPK was also cloned in pEGFPC2 (BD Biosciences) using the same primers and protocol.

Cell culture and transfection
Neuro2A and HeLa cells were obtained from National Cell Science Centre, Pune, India and grown in DMEM (HiMedia, Mumbai, India) supplemented with 10% fetal bovine serum (PAN Biotech GmbH, Aidenbach, Germany) at 37°C in 5% CO2 atmosphere under humidified condition.

Transfection of cells was performed using SuperFect Transfection Reagent (Qiagen). For single transfection experiments 5 µg of DNA constructs were used in each event. In co-transfection experiments, where GFP-HYPK was not used for transfection, empty pEGFPC2 was used for blank controls. In all the cases of co-transfection, constructs were taken in 1:1 (w/w) stoichiometric ratio to keep the transfection efficiency unaltered (~5 µg each). After 24 h, G418 (Sigma Chemicals, St, Louis, MO, USA) was added at final concentration of 0.4 mg/ml and 80–95% transfected cell population, as revealed by fluorescence microscopy, was used for experiments. In some cases, transiently transfected cells were used for experiments.

Microscopy, live cell microscopy and photobleaching
Imaging was performed on LSM 510 confocal laser scanning microscope equipped with an argon-krypton laser (Carl Zeiss, Jena, Germany). Cells were grown on cover slips, fixed with (1: 1 v/v) acetone:methanol and washed with PBS, mounted on slides and images were grabbed with either x40 or x63 plan-apochromatic objectives. For localization studies of the cells containing GFP, DsRed or both signals, spectral data were collected from 361.8 to 704.2 nm at a step of 10.70 nm using the {lambda} mode of the spectral imaging facility. For co-localization experiments, images were generated after appropriate linear un-mixing of the spectra. For live-cell imaging, cells were grown in glass bottom dishes and kept at 37°C in 5% CO2 atmosphere under humidified condition in an incubator (PeCon GmbH, Erbach, Germany) attached to the microscope and, using x40 objective and 488 and 543 nm laser lights, images were grabbed.

To nullify the effects of any phototoxic or other metabolic phenomenon during live cell microscopy experiments, rather than calculating the fluorescence intensities within the region of interest, we calculated the RFI. The RFI [RFI = (Ft/F1t)/(F0/F10)] at each time-point for live cell microscopy, FRAP and FLIP was calculated similarly as described by Reits et al. (39). In live cell microscopy, two issues were of major concern while calculating the RFI. First, there was a possibility of differential expression of the two interacting proteins during the time-course (~16 h) of the experiment. Further, there was a chance of reaching pixel saturation by the very high intensity of signal from the aggregates. To overcome these, our strategy was to analyze the movie frame by frame in retrospect. So, we looked into the aggregate when it attained its maximum size (at terminal time-point of the movies), selected the region of interest circumscribing the mature aggregates and collected the mean pixel intensity data (Ft). The average fluorescence intensity was traced back for the same area up to the time-point when the aggregate first appeared. For the purpose of F1t, fluorescence intensity was recorded from a cytosolic region having no aggregates and having an area exactly equivalent to that used for measuring Ft, as described above. F0, the average fluorescence intensity of the aggregate region at initiation of the event and F10, the average fluorescence intensity of corresponding equivalent control area at initiation of visible aggregation. Thus measurement of the relative mean pixel intensities over the selected areas took care of the saturation problem. To avoid problems out of differential expressions, the ratio of fluorescence intensities from GFP and DsRed was measured for each frame from an equal area of the cytosol devoid of any aggregates. Efforts were made to make sure that the ratio was consistent throughout the time-course of the experiment.

For FRAP or FLIP, after transfection (24 h), cover slips were placed on chamber slides containing medium surrounded by vacuum grease at room temperature. The 488 and 543 nm laser lights and x63 plan-apochromatic oil objective were used in bleaching. We used high iteration and intensity levels (250 and 100%, respectively) for all experiments to optimize bleaching of aggregates. For imaging, the laser power was attenuated to 10% of the bleach intensity to decrease possible phototoxicity. In FRAP analyses, images were collected before, immediately following, and at 20 s intervals after bleaching. For FLIP analyses, cells were repeatedly imaged and bleached at intervals of 1 min (250 iterations) at the same defined region. The RFI at each time-point for FRAP and FLIP was calculated similarly as described above (39), where Ft the average fluorescence intensity of the photobleached region at various time-points after photobleaching, F1t, the average fluorescence intensity of corresponding nuclear or cytoplasmic non-bleached area at the corresponding time-point, F0, the average fluorescence intensity of the photobleached region before photobleaching and F10, the average fluorescence intensity of corresponding non-bleached area before photobleaching. The mobile fraction, defined as R= (F{alpha}–Fi)/(F0–Fi) (34,39), was determined by comparing the RFI in the bleached region after full recovery (F{alpha}) with the fluorescence before bleaching (F0) and just after bleaching (Fi). For FLIP, RFI was calculated using the same equation excepting the Ft was the average fluorescence intensity of the aggregate at various time-points and F1t was the average fluorescence intensity of a non-bleached area from a neighboring cell. All the data were analyzed by using Microsoft Excel and Origin 6.1. For the detailed basic principle of FRAP and FLIP, please see Supplementary Material, Information 1.

Co-immunoprecipitation
Cell lysate was prepared in co-immunoprecipitation buffer (50 mM Tris–Cl, pH 7.5, 15 mM EDTA, 100 mM NaCl, 0.1% Triton X-100 and protease inhibitor cocktail obtained from Sigma). One milligram of the lysate was pre-cleared with protein G-sepharose beads (GE Healthcare, Uppsala, Sweden) at 4°C for 2 h and centrifuged at 18 000g for 15 min at 4°C. Supernatant was incubated with anti-GFP (Alexis Corporation, Lausen, Switzerland) antibody (1:5000 dilutions), overnight at 4°C with constant shaking. Next day, 50 µl slurry of protein G-sepharose bead was added to it and kept shaking for 6 h at 4°C. The beads were precipitated by centrifuging at 18 000g for 15 min at 4°C, washed thrice by co-immunoprecipitation buffer, boiled with SDS–PAGE loading buffer and run in 12.5% SDS–PAGE. The gel was transferred on PVDF membrane (Millipore Corporation, Bedford, USA) and blotted with mouse anti-poly Q antibody (Chemicon, CA, USA; 1:16000 dilutions, catalog number: MAB1574, Lot number: 22120934).

Filter retardation assay
Cell lysate was prepared in 50 mM Tris–HCl (pH 8.0), 100 mM NaCl, 5 mM MgCl2, 0.5% NP-40 and protease inhibitor cocktail. Insoluble material was pelleted by centrifugation for 10 min at 18 000g at 4°C and were resuspended in 100 µl DNase I buffer [20 mM Tris–HCl (pH 8.0) and 15 mM MgCl2], and DNase I (Sigma) was added to a final concentration of 0.5 mg/ml followed by incubation at 37°C for 1 h. The protein concentration was determined by the Bio-Rad protein assay dye reagent concentrate and aliquots corresponding to increasing protein content were prepared for the filter retardation assay. The samples were diluted into 100 ml of 1% SDS and 50 mM DTT in PBS, boiled for 5 min, and filtered through a nitro-cellulose membrane (Hybond, Amersham Bisciences, Little Chaflon, UK; 0.2 mM pore size) using a BRL Hybrislot manifold. Two washes were performed with 200 µl of 0.1% SDS and then processed for immunodetection as in a regular western blot with anti-poly Q antibody (Chemicon).

Detection of nuclear fragmentation
Nuclear fragmentation was detected using the methods described earlier (15). In brief, cells were grown on cover slips overnight. Next morning, the cover slips were washed thrice with PBS and fixed with 1:1 mixture of methanol–acetone (1 h at 4°C). Cells were then stained with 1 mM Hoechst in PBS in the dark at room temperature for 5 min and observed under a fluorescence microscope (Olympus BX60 with appropriate attachment). About 200–500 cells were counted for each experiment. Cells with intact nuclear morphology (normal) and fragmented nuclei (apoptotic cells) were determined and the fraction of cells with apoptotic nuclei was calculated. Each experiment was repeated at least five times.

MTT assay
MTT assay was carried out using the method described earlier (15). Cells were plated in triplicate (1 x 105 per plate) and grown overnight. Next morning, MTT dissolved in complete medium was added (final concentration 500 µg/ml) and grown for another 4 h. Medium was dumped off from each plate. Cells were washed with PBS, scraped and dissolved in 50% DMSO (in PBS). The color generated was quantified by taking absorbance at 570 nm using Beckman DU-600 spectrophotometer. Fifty percent DMSO in PBS was taken as the blank for the detection of absorbance. Each experiment was repeated at least five times. Survivals of experimental cells were analyzed using the survival of control cells as 100%. For the detailed basic principle of MTT assay, please see Supplementary Material, Information 1.

Fluorometric determination of caspase-2, caspase-3 and caspase-8 activity
Caspase activation assays were performed as described earlier (15). Activation of caspases was determined according to the protocols provided by the manufacturers of the kits. In short, exponentially growing cells were trypsinized and counted in a hemocytometer and collected by centrifugation. For caspase-2 assay, one million cells and for caspase-3 and caspase-8 assay two million cells were used. Cells were washed with PBS and then lysed in 50 µl of chilled lysis buffer (as provided by the respective manufacturers) on ice for 10 min. The lysate was centrifuged at 18 000g for 5 min at 4°C to precipitate cell debris and supernatant was added to 1 ml of supplied caspase-3 assay buffer (for caspase-3 assay) or 50 µl of 2x reaction mix containing 10 mM DTT for the rest. The substrates for caspase-3 (Ac-DEFD-AFC; final concentration 9.4 ng/µl), caspase-2 (VDVAD-AFC; final concentration 50 µM), and that for caspase-8 (IETD-AFC; final concentration 50 µM) were added to the individual reaction mixture, incubated at 37°C for 2 h. The fluorescence of liberated AFC was measured at its emission maxima ({lambda}max 505 nm) with the excitation at the 400 nm for the caspase-2, caspase-3 and caspase-8 detection. Uses of inhibitors, provided by the manufacturers of these kits, inhibited the increase in fluorescence. Each of the experiments was repeated at least five times. In addition, caspase activations determined as above corroborated with the cleavage of pro-caspases to activated caspases (15).

In vitro chaperone activity assays
The recombinant HYPK was tested for possible chaperone activity using two approaches: (a) by monitoring thermal aggregation of heat-labile ADH or MDH in presence or absence of HYPK and (b) by measuring refolding kinetics of BCA II after denaturing it with guanidium hydrochloride in presence or absence of HYPK. ADH and MDH were chosen as model substrates for thermal danaturation experiments because they are known to be relatively heat-labile and have been used in chaperone studies (40,41). ADH and MDH were obtained from Sigma. In separate trials, ADH (0.4 mg/ml) and MDH (0.3 µM) were mixed with various amounts of purified recombinant HYPK or BSA or {alpha}-casein as positive control (42) as indicated in Fig. 5A and B, in 20 mM Tris–HCl buffer [7 mM MgCl2, 60 mM NH4Cl, 0.2 mM EDTA, and 10% (v/v) glycerol; pH 8; total volume 1 ml] in covered quartz cuvettes. Samples were incubated at 50°C and ADH or MDH stability was estimated by monitoring light scattering at 450 nm during incubation.

Refolding kinetics of denatured BCA was measured according to Chowdhury et al. (43). BCA (Sigma) was denatured at a concentration of 45 µM in presence of 6 M guanidium hydrochloride and 1 mM EDTA for 2 h at 25°C. For refolding, denatured proteins were diluted 100 times (final concentration: 450 nM) in refolding buffer (50 mM Tris–HCl; pH 7.5, 100 mM NaCl, 10 mM magnesium acetate) in absence of HYPK (self folding) and in presence of equimolar concentration of HYPK or in presence of equimolar concentration of domain V of 23s ribosomal subunit and kept for 30 min at 25°C. After that enzyme activity was determined spectrophotometrically from the rate of hydrolysis of p-nitrophenyl acetate (Sigma) dissolved in absolute alcohol by following the absorbance at 400 nm. Each of the experiments was repeated at least five times.

In vivo chaperone activity assay
The basis of this assay is to monitor refolding of heat denatured luciferase in vivo as a measure of chaperone activity. We used the Tet-Off Advanced Inducible Gene Expression System (BD Biosciences) for steady expression of luciferase in HeLa cells. At first, HeLa cells were transfected with pTet-Off-Advanced vector (BD Biosciences) and selected with G418 to generate stably transfected cells (H-Tet-Off+ve). H-Tet-Off+ve cells had been transfected with a luciferase expression construct (pTRE-Tight-Luc, BD Biosciences) to form H-Tet-Off-Luc+ve cells. In these cells, luciferase expression was successfully regulated by the TRE promoter present in the vector under Doxycycline (Sigma) selection pressure. These H-Tet-Off-Luc+ve cells were grown in absence of Doxycycline (Sigma) and transfected with either only GFP or GFP-HYPK or co-transfected with either GFP and DsRed-H40 or GFP-HYPK and DsRed-H40. After 24 h of transfection of H-Tet-Off-Luc+ve cells with these constructs, luciferase activities were measured before heat shock, immediately after heat shock at 45°C for 30 min (sufficient to induce unfolding and aggregation of luciferase making it inactive) and after 4 h of recovery at 37°C with the Luciferase Assay System (Promega), according to the protocol described by the manufacturer. Relative luminescence was measured in a Sirius Luminometer (Berthold Detection Systems GmbH, Germany). Each experiment was repeated at least five times.


   SUPPLEMENTARY MATERIAL
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
FUNDING
 REFERENCES
 
Supplementary Material is available at HMG Online.


   FUNDING
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
REFERENCES
 
This work was supported by Institutional grant from the Department of Atomic Energy, Government of India.


   ACKNOWLEDGEMENTS
 
We are grateful to Professor J.K. Dattagupta, for encouragement and support throughout the work. Professor S. Basak and Ms Ashima Chakroborty, Chemical Sciences Division, Saha Institute of Nuclear Physics, and Professor C.K. DasGupta and Mr Dibyendu Samanta, Molecular Biology and Biophysics Department, Calcutta University, are acknowledged for helping in in vitro chaperone assay experiments. We also acknowledge Ms Pritha Majumder for her support during the initial experiments and Professor A. Lohia of Bose Institute, Kolkata for allowing us to use Fluorescence Microscope for imaging DAPI stains.

Conflict of Interest statement: None declared.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 SUPPLEMENTARY MATERIAL
 FUNDING
 REFERENCES
 

  1. The Huntington’s Disease Collaborative Research Group. A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington’s disease chromosomes. Cell (1993) 72:971–983.[CrossRef][Web of Science][Medline]

  2. Gidalevitz T., Ben-Zvi A., Ho K.H., Brignull H.R., Morimoto R.I. Progressive disruption of cellular protein folding in models of polyglutamine diseases. Science (2006) 311:1471–1474.[Abstract/Free Full Text]

  3. Ross C.A. Intranuclear neuronal inclusions: a common pathogenic mechanism for glutamine-repeat neurodegenerative diseases? Neuron (1997) 19:1147–1150.[CrossRef][Web of Science][Medline]

  4. Arrasate M., Mitra S., Schweitzer E.S., Segal M.R., Finkbeiner S. Inclusion body formation reduces levels of mutant Huntingtin and the risk of neuronal death. Nature (2004) 431:805–810.[CrossRef][Medline]

  5. Li S.-H., Li J. Huntingtin–protein interactions and the pathogenesis of Huntington’s disease. Trends Genet. (2004) 20:146–154.[CrossRef][Web of Science][Medline]

  6. Faber W.P., Barnes T.G., Srinidhi J., Chen J., Gusella F.J., MacDonald E.M. Huntingtin interacts with a family of WW domain proteins. Hum. Mol. Genet. (1998) 7:1463–1474.[Abstract/Free Full Text]

  7. Passani L.A., Bedford M.T., Faber P.W., McGinnis K.M., Sharp A.H., Gusella J.F., Vonsattel J., MacDonald M.E. Huntingtin’s WW domain partners in Huntington’s disease post-mortem brain fulfill genetic criteria for direct involvement in Huntington’s disease pathogenesis. Hum. Mol. Genet. (2000) 9:2175–2182.[Abstract/Free Full Text]

  8. Rega S., Chang D., Pollmeier B., Esche H., Bardenheuer W., Marquitan G., Pützer B.M. Identification of the full-length Huntingtin-interacting protein p231HBP/HYPB as a DNA-binding factor. Mol. Cell. Neurosci. (2001) 18:68–79.[CrossRef][Web of Science][Medline]

  9. Anborgh P.H., Godin C., Pampillo M., Dhami G.K., Dale L.B., Cregan S.P., Truant R., Ferguson S.S.G. Inhibition of metabotropic glutamate receptor signaling by the Huntingtin-binding protein optineurin. J. Biol. Chem. (2005) 280:34840–34848.[Abstract/Free Full Text]

  10. Huang K., Kang R., Arstikaitis P., Singaraja R.R., Metzler M., Mullard A., Haigh B., Gauthier-Campbell C., Gutekunst C., Hayden M.R., El-Husseini A. Huntingtin-interacting protein HIP14 is a palmitoyl transferase involved in palmitoylation and trafficking of multiple neuronal proteins. Neuron (2004) 44:977–986.[CrossRef][Web of Science][Medline]

  11. Von Mering C., Krause R., Snel B., Cornell M., Oliver S.G., Fields S., Bork P. Comparative assessment of large-scale data sets of protein–protein interactions. Nature (2002) 417:399–403.[Medline]

  12. Kim W.Y., Fayazi Z., Bao X., Higgins D., Kazemi-Esfarjani P. Evidence for sequestration of polyglutamine inclusions by Drosophila myeloid leukemia factor. Mol. Cell. Neurosci. (2005) 29:536–544.[CrossRef][Web of Science][Medline]

  13. Mangiarini L., Sathasivam K., Seller M., Cozens B., Harper A., Hetherington C., Lawton M., Trottier Y., Lehrach H., Davies S.W., Bates G.P. Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell (1996) 87:493–506.[CrossRef][Web of Science][Medline]

  14. Sittler A., Wälter S., Wedemeyer N., Hasenbank R., Scherzinger E., Eickhoff H., Bates G.P., Lehrach H., Wanker E.E. SH3GL3 associates with the Huntingtin exon 1 protein and promotes the formation of polygln-containing protein aggregates. Mol. Cel. (1998) 2:427–436.[CrossRef][Web of Science][Medline]

  15. Majumder P., Chattopadhyay B., Mazumder A., Das P., Bhattacharyya N.P. Induction of apoptosis in cells expressing exogenous Hippi, a molecular partner of huntingtin-interacting protein HIP1. Neurobiol. Dis. (2006) 22:242–256.[CrossRef][Web of Science][Medline]

  16. Kitamura A., Kubota H., Pack C., Matsumoto G., Hirayama S., Takahashi Y., Kimura H., Kinjo M., Morimoto R.I., Nagata K. Cytosolic chaperonine prevents polyglutamine toxicity with altering the aggregation state. Nat. Cell Biol. (2006) 8:1163–1169.[CrossRef][Web of Science][Medline]

  17. Perutz M.F., Finch J.T., Berriman J., Lesk A. Amyloid fibers are water-filled nanotubes. Proc. Natl. Acad. Sci. (2002) 99:5591–5595.[Abstract/Free Full Text]

  18. Scherzinger E., Sittler A., Schweiger K., Heiser V., Lurz R., Hasenbank R., Bates G.P., Lehrach H., Wanker E.E. Self-assembly of polyglutamine-containing huntingtin fragments into amyloid-like fibrils: implications for Huntington’s disease pathology. Proc. Natl. Acad. Sci. (1999) 96:4604–4609.[Abstract/Free Full Text]

  19. Wang H., Lim P.J., Yin C., Rieckher M., Vogel B.E., Monteiro M.J. Suppression of polyglutamine-induced toxicity in cell and animal models of Huntington’s disease by ubiquilin. Hum. Mol. Genet. (2006) 15:1025–1041.[Abstract/Free Full Text]

  20. Kazemi-Esfarjani P., Benzer S. Suppression of polyglutamine toxicity by a Drosophila homolog of myeloid leukemia factor 1. Hum. Mol. Genet. (2002) 11:2657–2672.[Abstract/Free Full Text]

  21. Muchowski P.J. Protein misfolding, amyloid formation, and neurodegeneration: a critical role for molecular chaperones? Neuron (2002) 35:9–12.[CrossRef][Web of Science][Medline]

  22. Muchowski P.J., Wacker J.L. Modulation of neurodegeneration by molecular chaperones. Nat. Rev. Neurosci. (2005) 6:11–22.[CrossRef][Web of Science][Medline]

  23. Perrin V., Regulier E., Abbas-Terki T., Hassig R., Brouillet E., Aebischer P., Luthi-Carter R., Deglon N. Neuroprotection by Hsp104 and Hsp27 in lentiviral-based rat models of Huntington’s disease. Mol. Ther. (2007) 15:903–911.[CrossRef][Web of Science][Medline]

  24. Novoselova T.V., Margulis B.A., Novoselov S.S., Sapozhnikov A.M., van der Spuy J., Cheetham M.E., Guzhova I.V. Treatment with extracellular HSP70/HSC70 protein can reduce polyglutamine toxicity and aggregation. J. Neurochem. (2005) 94:597–606.[CrossRef][Web of Science][Medline]

  25. Jana N.R., Nukina N. BAG-1 associates with the polyglutamine-expanded huntingtin aggregates. Neurosci. Lett. (2005) 22:171–175.

  26. Wyttenbach A., Sauvageot O., Carmichael J., Diaz-Latoud C., Arrigo A., Rubinsztein D.C. Heat shock protein 27 prevents cellular polyglutamine toxicity and suppresses the increase of reactive oxygen species caused by huntingtin. Hum. Mol. Genet. (2002) 11:1137–1151.[Abstract/Free Full Text]

  27. Zourlidou A., Gidalevitz T., Kristiansen M., Landles C., Woodman B., Wells D.J., Latchman D.S., de Belleroche J., Tabrizi S.J., Morimoto R.I., Bates G.P. Hsp27 overexpression in the R6/2 mouse model of Huntington’s disease: chronic neurodegeneration does not induce hsp27 activation. Hum. Mol. Genet. (2007) 16:1078–1090.[Abstract/Free Full Text]

  28. Arango M., Holbert S., Zala D., Brouillet E., Pearson J., Régulier E., Thakur A.K., Aebischer P., Wetzel R., Déglon N., Néri C. CA150 Expression delays striatal cell death in overexpression and knock-in conditions for mutant Huntingtin neurotoxicity. J. Neurosci. (2006) 26:4649–4659.[Abstract/Free Full Text]

  29. Iijima-Ando K., Wu P., Drier E.A., Iijima K., Yin J.C.P. cAMP-response element-binding protein and heat-shock protein 70 additively suppress polyglutamine-mediated toxicity in Drosophila. Proc. Natl. Acad. Sci. (2005) 102:10261–10266.[Abstract/Free Full Text]

  30. de Pril R., Fischer D.F., Roos R.A.C., van Leeuwen F.W. Ubiquitin-conjugating enzyme E2-25K increases aggregate formation and cell death in polyglutamine diseases. Mol. Cell Neurosci. (2007) 34:10–19.[CrossRef][Web of Science][Medline]

  31. Otto H., Conz C., Maier P., Wölfle T., Suzuki C.K., Jenö P., Rücknagel P., Stahl J., Rospert S. The chaperones MPP11 and Hsp70L1 form the mammalian ribosome-associated complex. Proc. Natl. Acad. Sci (2005) 102:10064–10069.[Abstract/Free Full Text]

  32. Dunker A.K., Lawson J.D., Brown C.J., Williams R.M., Romero P., Oh J.S., Oldfield C.J., Campen A.M., Ratliff C.M., Hipps K.W., et al. Intrinsically disordered protein. J. Mol. Graph. Model. (2001) 19:26–59.[CrossRef][Web of Science][Medline]

  33. Sickmeier M., Hamilton J.A., LeGall T., Vacic V., Cortese M.S., Tantos A., Szabo B., Tompa P., Chen J., Uversky V.N., Obradovic Z., Dunker A.K. DisProt: the database of disordered proteins. Nucleic Acids Res. (2007) 35:D786–D793.[Abstract/Free Full Text]

  34. Kim S., Nollen E.A.A., Kitagawa K., Bindokas V.P., Morimoto R.I. Polyglutamine protein aggregates are dynamic. Nat. Cell Biol. (2002) 4:826–831.[CrossRef][Web of Science][Medline]

  35. Sanchez I., Xu C.J., Juo P., Kakizaka A., Biens J., Yuan J. Caspase 8 is required for cell death induced by expanded polyglutamine repeats. Neuron (1999) 22:623–633.[CrossRef][Web of Science][Medline]

  36. Hermel E., Gafni J., Propp S.S., Leavitt B.R., Wellington C.L., Young J.E., Hackam A.S., Logvinova A.V., Peel A.L., Chen S.F., et al. Specific caspase interactions and amplification are involved in selective neuronal vulnerability in Huntington’s disease. Cell Death Differ. (2004) 11:424–438.[CrossRef][Web of Science][Medline]

  37. Tagawa K., Marubuchi S., Qi M., Enokido Y., Tamura T., Inagaki R., Murata M., Kanazawa I., Wanker E.E., Okazawa H. The induction levels of heat shock protein 70 differentiate the vulnerabilities to mutant Huntingtin among neuronal subtypes. J. Neurosci. (2007) 27:868–880.[Abstract/Free Full Text]

  38. Mosser D.D., Morimoto R.I. Molecular chaperones and the stress of oncogenesis. Oncogene (2004) 23:2907–2918.[CrossRef][Web of Science][Medline]

  39. Reits E.A.J., Neefjes J.J. From fixed to FRAP: measuring protein mobility and activity in living cells. Nat. Cell Biol. (2001) 3:E145–E147.[CrossRef][Web of Science][Medline]

  40. Bhattacharyya M., Ray S., Bhattacharya S., Chakrabarti A. Chaperone activity and prodan binding at the self-associating domain of erythroid spectrin. J. Biol. Chem. (2004) 279:55080–55088.[Abstract/Free Full Text]

  41. Rao D., Momcilovic I., Kobayashi S., Callegari E., Ristic Z. Chaperone activity of recombinant maize chloroplast protein synthesis elongation factor, EF-Tu. Eur. J. Biochem. (2004) 271:3684–3692.[Web of Science][Medline]

  42. Bhattacharyya J., Das K.P. Molecular chaperone-like properties of an unfolded protein, {alpha}-casein. J. Biol. Chem. (1999) 274:15505–15509.[Abstract/Free Full Text]

  43. Chowdhury S., Pal S., Ghosh J., DasGupta C. Mutations in domain V of the 23S ribosomal RNA of Bacillus subtilis that inactivate its protein folding property in vitro. Nucleic Acids Res. (2002) 30:1278–1285.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
17/2/240    most recent
ddm301v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Raychaudhuri, S.
Right arrow Articles by Bhattacharyya, N. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Raychaudhuri, S.
Right arrow Articles by Bhattacharyya, N. P.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?